Rene's DNA things
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
NumberNameTemplateConfirmedSequenceBasesAnnealing TempWhat will it do
P001crtE RFC[23] F1WorksCCTTTCTAGAATGACGGTCTGCGCAAAAAA3060.9Forward primer to amplify just crtE and add biobrick cloning site
P002crtE RFC[23] R1WorksAAGGCTGCAGCGGCCGCTACTAGTTTATTAACTGACGGCAGCGA44Reverse primer to amplify just crtE and add biobrick cloning site
P003crtB RFC[23] F1Doesn't workCCTTTCTAGAATGAATAATCCGTCG 25Forward primer to amplify just crtB and add biobrick cloning site
P004crtB RFC[23] R1Doesn't workAAGGCTGCAGCGGCCGCTACTAGTTTATTAGAGCGGGCGCT 41Reverse primer to amplify just crtB and add biobrick cloning site
P005crtI RFC[23] F1WorksCCTTTCTAGAATGAAACCAACTACGG26Forward primer to amplify just crtI and add biobrick cloning site
P006crtI RFC[23] R1WorksAAGGCTGCAGCGGCCGCTACTAGTATATCAGATCCTCCA 39Reverse primer to amplify just crtI and add biobrick cloning site
P007crtB RFC[23] F2WorksCCTTTCTAGAatgaataatccgtcgttact30Forward primer to amplify just crtB and add biobrick cloning site
P008crtB RFC[23] R2WorksAAGGCTGCAGCGGCCGCTACTAGTTTA TTA GAG CGG GCG CTG CC44Reverse primer to amplify just crtB and add biobrick cloning site
P009EPX F1 TCG CTG CCG TCA GTT AAT AAG GCG GTG GCG GAT CTG GAG G40Forward primer to amplify just PLFlex with 5' overlap with crtE for final assembly crtE-PLFlex-Anything else
P010EPX R1CCT CCA GAT CCG CCA CCG CCT TAT TAA CTG ACG GCA GCG A40Reverse primer to amplify just crtE with 3' overlap with PLFlex for final assembly crtE-PLFlex-Anything else
P011IPX F1 TGG AGG ATC TGA TAT AAT AAG GCG GTG GCG GAT CTG GAG G40Forward primer to amplify just PLFlex with 5' overlap with crtI for final assembly crtI-PLFlex-Anything else
P012IPX R1CCT CCA GAT CCG CCA CCG CCT TAT TAT ATC AGA TCC TCC A40Reverse primer to amplify just crtI with 3' overlap with PLFlex for final assembly crtI-PLFlex-Anything else
P013BPX F1GGC AGC GCC CGC TCT AAT AAG GCG GTG GCG GAT CTG GAG G40Forward primer to amplify just PLFlex with 5' overlap with crtB for final assembly crtB-PLFlex-Anything else
P014BPX R1CCT CCA GAT CCG CCA CCG CCT TAT TAG AGC GGG CGC TGC C40Reverse primer to amplify just crtB with 3' overlap with PLFlex for final assembly crtB-PLFlex-Anything else
P015XPE F1GAT CTG GAG GAG GTG GTT CAA TGA CGG TCT GCG CAA AAA A40Forward primer to amplify just crtE with 5' overlap with PLFlex for final assembly Anything else-PLFlex-crtE
P016XPE R1TTT TTT GCG CAG ACC GTC ATT GAA CCA CCT CCT CCA GAT C40Reverse primer to amplify just PLFlex with 3' overlap with crtE for final assembly Anything else-PLFlex-crtE
P017XPI F1GAT CTG GAG GAG GTG GTT CAA TGA AAC CAA CTA CGG TAA T40Forward primer to amplify just crtI with 5' overlap with PLFlex for final assembly Anything else-PLFlex-crtI
P018XPI R1ATT ACC GTA GTT GGT TTC ATT GAA CCA CCT CCT CCA GAT C40Reverse primer to amplify just PLFlex with 3' overlap with crtI for final assembly Anything else-PLFlex-crtI
P019XPB F1GAT CTG GAG GAG GTG GTT CAA TGA ATA ATC CGT CGT TAC T40Forward primer to amplify just crtB with 5' overlap with PLFlex for final assembly Anything else-PLFlex-crtB
P020XPB R1AGT AAC GAC GGA TTA TTC ATT GAA CCA CCT CCT CCA GAT C40Reverse primer to amplify just PLFlex with 3' overlap with crtB for final assembly Anything else-PLFlex-crtB
P026LsrA scar crtEBI FTCA AAA CTC ACC TGC AAA AC ACT AGA GAG GTA CTA GAT GAC GGT CTadds LsrA overlap + the Silver scar to crtE (or anything starting with crtE like crtEBI)
P027LsrA scacr crtEBI RAGA CCG TCA TCT AGT ACC TC TCT AGT GTT TTG CAG GTG AGT TTT GAadds crtE overlap + the Silver scar to LsrA
P028crtEBI scar LuxS FTGG AGG ATC TGA TAT AAT AA ACT AGA AAA GAG GAG AAA TAC TAG AT adds crtI overlap + the Silver scar to LuxS
P029crtEBI scar LuxS RATC TAG TAT TTC TCC TCT TT TCT AGT TTA TTA TAT CAG ATC CTC CA adds LuxS overlap + the Silver scar to crtI (or anything ending with crtI like crtEBI)
P034Lacp scar LuxS FAATTGTGAGCGGATAACAAT ACT AGA AAA GAG GAG AAA TAC TAG ATadds Lacp overlap + the Silver scar to LuxS
P035Lacp scar LuxS RATC TAG TAT TTC TCC TCT TT TCT AGT ATT GTT ATC CGC TCA CAA TT adds LuxS overlap + the Silver scar to Lacp
P038Lacp scar crtEIB FAATTGTGAGCGGATAACAAT ACT AGA GAG GTA CTA GAT GAC GGT CT adds Lacp overlap + the Silver scar to to crtE (or anything starting with crtE like crtEBI)
P039Lacp scar crtEIB RAGA CCG TCA TCT AGT ACC TC TCT AGT ATC TAG TAT TTC TCC TCT TT adds crtE overlap + the Silver scar to Lacp
P041crtEIB pSB1A2 RTGC AGC GGC CGC TAC TAG TA TTA TTA TAT CAG ATC CTC CAadds pSB1A2 overlap to crtI (or anything ending with crtI like crtEBI)
P044GG pSB1A3 - lacp F cacaccaCGTCTCaTAGAaattgtgagcggata33
P045GG lacp - crtE RcacaccaCGTCTCaCCTCtgtgctcagtatctt33
P046GG lacp - crtE FcacaccaCGTCTCagaggtactagatgac29
P047GG crtI - pSB1A3 RcacaccaCGTCTCaTAGTttattatatcagatc33
P048GG lacp - LuxS R cacaccaCGTCTCaCTTTtgtgctcagtatctt33
P049GG lacp - LuxS F cacaccaCGTCTCaaaagaggagaaatac29
P050GG LuxS - pSB1A3 RcacaccaCGTCTCaTAGTttagatgtgcagttc33
P051GG pSB1A3 - lsrA F cacaccaCGTCTCaTAGAcacaacatcaactga33
P052GG lsrA - crtE RcacaccaCGTCTCaCCTCtttctcctcttttta33
P053GG crtI - LuxS RcacaccaCGTCTCaCTTTttattatatcagatc33
P054gg001 v2tgccacctgacgtctaagaa
P055gg002 v2(not 100% this is the sequence)attaccgcctttgagtgagc
P056pSB1A3 sequencing F
P057pSB1A3 sequencing R
P058Yeast IP-HIS F RFC[23]
P059Yeast IP-HIS R RFC[23]
P060GG I13522 Sndr Const Fnot with 62cacaccaCGTCTCaGGATtactagagaaagagg6349.8adds BsmBII site and B0034 RBS to I13522 to make the backbone for the sender constructs
P061GG I13522 Sndr Const RwrongcacaccaCGTCTCa ATCT CTAGTATTTCTCCTC 33adds BsmBII site and B0034 RBS to I13522 to make the backbone for the sender constructs
P062I13522 Sndr GG R2not with 60cacaccaCGTCTCa ATGT CTAGTATTTCTCCTC 36
P063LuxI Sender GG FyescacaccaCGTCTCaACATatgactataatgata33
P065LuxR Rec FF2620yescacaccaCGTCTCaTAGCatgaaaaacataaatAdds GG cut sites to LuxR to clone into Receiver expression vector
P066LuxR Rec RF2620yescacaccaCGTCTCaTACCGTG ATC TAC ACT AGCAdds GG cut sites to LuxR to clone into Receiver expression vector
P067Lux Box Rec FF2620yescacaccaCGTCTCaACTTacctgtaggatcgtaAdds GG cut sites to Lux-box to clone into Receiver expression vector
P068Lux Box Rec RF2620yescacaccaCGTCTCaATGGTTT ATT CGA CTA TAAAdds GG cut sites to Lux-box to clone into Receiver expression vector
P069LasI Sender GG FK084007not with 70 (may have been template)cacaccaCGTCTCaACATatgatcgttcagatc3432 with P070Adds GG cut sites to LasI to clone into Sender expression vector
P070LasI Sender GG RK084007not with 69 (unconfirmed template)cacaccaCGTCTCaATCC TTA TTA AGC AAC CAG Adds GG cut sites to LasI to clone into Sender expression vector
P071LasR Rec FcacaccaCGTCTCaTAGCatggccttggttgac
P073Las Box Rec FcacaccaCGTCTCaACTTtaacaccgtgcgtgt
P075RhlI Sender GG FK082035cacaccaCGTCTCaACATatgatcgaactgctg39 w P076Adds GG cut sites to RhlI to clone into Sender expression vector
P076RhlI Sender GG RK082035cacaccaCGTCTCaATCC GCA ACA GCC ATG GAC Adds GG cut sites to RhlI to clone into Sender expression vector
P077RhlR Rec FK092900-E0420cacaccaCGTCTCaTAGCatgatcgaactgctgAdds GG cut sites to RhlR to clone into Receiver expression vector
P078RhlR Rec RK092900-E0420cacaccaCGTCTCaTACCTTA TTA AGC TAC TAAAdds GG cut sites to RhlR to clone into Receiver expression vector
P079Rhl Box Rec FK092900-E0420cacaccaCGTCTCaACTTtcctgtgaaatctggAdds GG cut sites to Rhl-box to clone into Receiver expression vector
P080Rhl Box Rec RK092900-E0420cacaccaCGTCTCaATGGGAA CAC TTT TTA GCCAdds GG cut sites to Rhl-box to clone into Receiver expression vector
P081Part B Receiver GG FIn progresscacaccaCGTCTCaCCATaaagaggagaaataAdds GG cut sites to Part B (RBS-mCh-S-S-pLac-RBS) to clone into Receiver expression vector
P082Part B Receiver GG RIn progresscacaccaCGTCTCaGCTA CTA GTA TTT CTC CTCAdds GG cut sites to Part B (RBS-mCh-S-S-pLac-RBS) to clone into Receiver expression vector
P083Receiver Vec GG FpSB1A3cacaccaCGTCTCaGGTAtactagagccaggcaAdds GG cut sites to make the Receiver expression vector
P084Receiver Vec GG RpSB1A3workscacaccaCGTCTCaAAGTAGACGTCAGGTGGCAAdds GG cut sites to make the Receiver expression vector
P085RBS VioC bb FViolacein operonCCTTgaattcgcggccgcaTCTAGAaaagaggagaaatactagatgaaaagagcaatcatagAdds RBS and biobrick overhangs to VioC
P086VioC bb RViolacein operonAAGGCTGCAGCGGCCGCTACTAGTTCA GTT GAC CCT CCC TAdds RBS and biobrick overhangs to VioC
P087pLux vector FcacaccaCGTCTCaCCATtcacacaggacatgcgtaaaggagaagaacttt5147 with P088Adds pLux overhangs, B0033 med RBS, BsmBI cut site to I13522 just downstream of B0034
P088pLux vector RcacaccaCGTCTCaAAGTAGACGTCAGGTGGCA33Adds pLux overhangs, BsmBI cut site to I13522 just upstream of pTet
P089Sender GG 2 FI13522cacaccaCGTCTCaGGATtactagagaaagaggagaaatactag4445 w P090, P0097Adds LuxI overhangs, BsmBI cut site to I13522 just downstream of B0034
P090Sender GG 2 RI13522doesn't workcacaccaCGTCTCaATGTctagtatttctcctctttctctagtag45
P091LuxR vector FcacaccaCGTCTCaGGTAaaagaggagaaatactagatggtga4348 with P092
P093pTet GG LuxR const FworkscacaccaCGTCTCaACTTtccctatcagtgata33
P094pTet GG LuxR const RworkscacaccaCGTCTCaATGGGTGCTCAGTATCTCT33
P095medRBS GG FworkscacaccaCGTCTCaCCATtactagagtcacacaggaaagtactagatgcgtaaa54
P096Sender GG 3 FcacaccaCGTCTCaGGATtactagagaaagaggagaaatactagatgcgtaaaggag5756 with P097
P097Sender GG 3 RcacaccaCGTCTCaATGTctagtatttctcctctttctctagtagtgctcagtatctcta6056 with P096Adds ACAT overhang and gg cut site downstream of pTet-B0034
P098I13522 GG remove FP FI13522 cacaccaCGTCTCa TGCA tactagagccaggcatcaaataaaacg46 with P099
P099I13522 GG remove FP RI13522 cacaccaCGTCTCa GACG ctagtatttctcctctttctctagtag46 with P098