R91 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79X80X81X82X83X84X85X86X87X88
2
1JR_Asymlvl0Gap0_Sub1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5077381
GGAAAGAAACAAAACAAACAAACAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGACAUACUUCGGUAUGUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
4.282
medium
990.1011.1060.6030.40580.46650.73010.32330.28460.4520.59770.60930.74920.50750.37690.97531.08061.06240.32150.9211.35420.69680.4951.31011.03221.50921.34870.81440.44761.34251.40920.16540.08260.10990.10970.27310.13850.29810.73060.57060.23790.05280.18440.75470.14280.19410.18070.43570.93430.53830.50910.06760.06190.19760.92480.33890.24110.16110.81870.95820.97680.18340.18280.22770.07882.11044.75972.04250.24450.0590.17540.21360.5391.24521.4830.44610.03650.30910.19940.16270.51990.2650.24740.33420.61741.34321.23591.31021.20980.41520.23870.3133
3
2JR_Asymlvl0Gap0_Sub2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5077386
GGAAAGAAAGAAAAGAAAGAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAGUAACUUCGGUUACUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.805
medium
990.111.2090.659-0.06130.73810.6020.6870.67960.36040.49171.22710.6591.03080.71621.19850.69481.28130.55561.2831.22010.86490.92841.72870.50021.15742.93991.24480.58420.98741.15960.15630.12480.06230.06230.06220.06220.27850.54810.51270.26810.120700.53870.059800.17890.17840.93720.54610.59770.114700.16581.15060.16790.22310.57341.05161.32871.09670.07010.31130.25830.0693.02034.66952.320.17460.30410.17330.23350.85071.35271.0840.49320.1340.20760.28070.20560.30370.23750.39340.41510.40181.40161.30091.34271.10530.39110.17660.0028
4
3JR_Asymlvl0Gap0_Sub3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5077394
GGAAAUAAAUAAAAUAAAUAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAGUUACUUCGGUAACUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.636
medium
94.90.0941.0380.5660.93560.80990.45020.4470.37030.75511.0050.42780.98260.41830.89350.61260.27110.4040.70140.43110.90971.33570.74770.49731.21920.78261.71670.69390.34510.7950.67410.33530-0.09580.22270.770.2192-0.04090.81090.853200.10650.10630.42230.1054-0.09550.10520.20980.72570.20670.41060.10250.10230.10221.05480.05020.10020.29920.78790.6820.67470.09690.38160.09520.04762.0263.50832.01720.083900.08380.25050.41471.28431.50460.97460.11670.15530-0.20590.44380.3060.15260.52970.89521.09951.40841.55170.95930.4760.20330.2364
5
4AsymLab0
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5078033
GGAAAAGAAAAGAAAAGAAAAGAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUAGCACUUCGGUGCUGGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.344
medium
970.1141.2560.6851.12040.6730.77090.76160.87620.51251.16190.48251.06720.93461.03421.62420.88230.97720.96230.31911.45211.02151.15331.1491.5351.09680.92760.91411.11310.88460.95830-0.10640.08700.17350.60150.17140.59420.50530.251600.25060.24960.24860.24770.08240.24641.28720.67650.591300.31380.15650.84920.23070.32910.17541.30871.27791.00340.285400.03570.08942.75545.58112.11330.11930.06640.42620.35230.46631.25672.15180.38570.16390.2450.19150.21620.95760.31720.15820.49590.43911.36491.33751.82240.82470.30660.25840.3446
6
5Gap 0 Frozen 1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5078042
GGAUAAAUAAAAUAAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAUAUACUUCGGUAUAUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.286
medium
92.90.1051.1510.6280.64750.74050.68020.50140.41960.19830.58950.69860.90860.3330.56570.71371.28870.63120.4590.66350.7950.98751.50871.27290.56971.43161.69840.68720.52791.21920.97910.07270.072700.07260.07250.28860.25160.52210.84180.34880.13920.34610.54040.068500.27270.47371.12970.52720.327800.02170.32560.99340.31880.19070.11370.75150.86470.490300.12230.24370.04532.76924.20022.06790.31220.15570.1310.30890.58641.29711.29090.58030.12070.16850.1920.27780.18110.65690.60410.64390.45711.24871.70191.38561.42750.61460.16350.0816
7
6Gap 0 Frozen 2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5078047
GGAUAAAAUAAAAUAAAAUAAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUUAUACUUCGGUAUAACAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.163
medium
980.1141.2520.683-0.18851.07150.69610.73260.48211.26160.95420.79540.90071.23680.64130.26770.91420.90111.91140.59510.56251.81141.02061.57761.45441.46791.11630.82631.43551.05851.2960.17230.263200.26150.085100.25430.50460.83230.08280.00340.12370.85450.162300.2840.67861.0210.66060.42460.07710.0770.30650.60710.15140.15110.22160.73160.79821.06930.21450.21380.142202.55813.91492.80820.24330.30260.04240.16230.8021.45771.47180.44960.27980.20040.03310.16640.42530.46640.11590.43050.70850.69640.87661.50981.54960.43660.28970.1639
8
7Gap 0 Frozen 3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5078053
GGAAAAUAAAUAAAAUAAAUAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUUCUUCUUCGGAAGAACAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.599
medium
92.90.0861.0690.5770.11521.19140.83970.33410.49720.37761.28860.16070.39911.25181.45230.90411.32750.43940.58051.02460.56490.69830.8270.81631.20110.66031.68091.25740.74550.97860.844800.18050.060100.2395000.35730.4728000.0590.98800.11600.11580.63060.51170.33930.1129001.1092-0.1150.11070.22070.32930.97260.74750.10660.21250.317103.06723.24331.6920.36850.0920.52280.36210.67171.27250.86550.51510.08570.25610.33970.30740.33560.71380.41130.65130.9620.91131.31281.10020.89420.44480.22160.3672
9
8civilized design
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5079152
GGAUAAAUAAAUAAAUAAAUAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUGUGCUUUCGGGUAUGGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.856
medium
85.90.0330.9640.4990.690.32170.21380.1270.10630.01520.419-0.23490.20850.41420.30910.01810.76220.4540.13220.84210.8310.29190.48280.77290.93840.78761.32430.71550.53210.70160.8650.08640.17230.34270.2560.00110.170.16990.42040.41760.08340.2492-9.00E-040.8996-0.1673000.16310.96390.39480.709400.23560.15670.77370.077300.15420.91160.82470.3633-0.00890.07430.14820.10152.7064.70461.8181-0.01960.16950.50040.35220.08261.13141.07380.23770.1186-0.04580.15390.29350.49980.40460.09110.22970.48741.09120.93530.62580.61510.34530.07720.4719
10
9civilized design
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5079155
GGAUAAAUAAAUAAAUAAAUAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUGUGCUUUCGGGUAUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.728
medium
83.80.1141.2520.6831.24730.6488-0.13470.3350.49850.38530.16440.54180.16230.05301.2690.78330.62050.76621.4961.60370.43441.58210.90280.890.74421.51860.93050.64271.50581.35070.12260.12230.36480.12140.373400.240.35791.05580.23370.23290.11620.57580.1150.11470.22870.4541.00530.22260.66080.21950.32750.1090.75190.21290.10680.31650.94031.02770.71130.20260.1011-0.10760.09422.51634.8261.9906-0.21410.17260.17220.25720.25610.84240.83130.16580.12410.2062-0.02450.43910.3790.13560.32070.55620.70710.62230.66251.4271.36140.18650.43510.4338
11
10civilized design
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5079159
GGAUAAAUAAAUAAAUAAAUAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUGUGGCUUCGGUUAUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.827
medium
82.80.0151.070.542-0.35090.56540.14590.0627-0.24770.33040.42990.48590.05970.20020.42030.69280.68530.27290.85920.6651.22090.83550.94951.6641.18661.06861.98560.90551.32960.79271.38920.213-0.08130.106300.211900.31630.44160.82550.2057000.81220.202400.1010.69940.88660.09840.5847000.19430.29010.28880.0150.94660.56291.01541.08860.190.26980.08980.00881.82873.6121.20590.08030.07960.15890.31760.5511.00690.76510.60620.07570.2209-0.00510.20810.81110.512-0.01370.50670.70660.70681.43790.64860.8420.06730.18850.7285
12
11Along
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5079437
GGAAAUAAAAUAAAAUAAAAUAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUAUAUAUUCGUAUAUAGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.539
medium
91.90.111.2090.6590.04370.70670.2810.59880.1990.22722.46240.74871.10341.26150.41491.56811.19650.84321.32090.81491.27740.63230.31461.60930.53190.77792.23961.06540.97890.69151.220700-0.12070.1353-0.06030.00740.4030.20090.53110.13250.13220.26331.1631000.38530.3830.88120.74630.858900.12250.12220.24350.12150.24210.24120.71270.9330.808500.11530.11510.28642.84423.94781.5765-0.01990.19860.78460.34140.5320.95261.48820.46160.09220.18390.18330.09150.3062-0.23730.36090.88940.11740.58171.25131.25781.07910.45250.08130.6061
13
12CE0702-Exp001
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5079713
GGAAUAACAACAUAUAUAUAUAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCGUUUCGUUCGCGGAGCGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.789weak84.800.6320.316-0.3280.5120.75880.74980.7410.97270.48260.24040.7131.1664-0.194800.232400.231600.687100.48561.43910.98080.85991.46980.62370.61760.81280.99990.199300000.19870.19810.19750.19690000.19620000.19560.38890.76820.571-0.1936000.3784000.37610.373900.37170.18530000.5511.95761.050.1745-0.19300-0.19240.86070.68110.506700000.50270.14160.49610.16490.8140.16240.80160.63480.4725000.1571
14
13Assymetry Gap 0 - 1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5079838
GGAAAGAGAAAAGAAAAGAAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCAUAGCUUCGGCUAUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.784
medium
960.0921.1030.5970.52870.23150.44760.44440.17340.43980.22061.14480.42640.56350.8340.82311.79920.90380.80980.84630.75721.6290.99821.12890.94630.81742.54590.81940.72891.16590.86250.104400.05210.211900.05190.33550.89040.85330.10020.05010.14990.39710.049600.12380.56420.87080.43210.57090-1.00E-04-1.00E-040.8437-0.00150.14010.30210.75760.68130.45090.26660.1790.13390.22242.21083.46851.69740.19680.07860.10930.27320.69491.06270.97160.37150.14820.0370.21080.22060.7510.2170.32380.23920.50850.70161.1031.28311.11280.49330.21480.1633
15
14Assymetry Gap 0 -2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5079874
GGAAAGAGAAAAGAAAAGAAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCAUGGCUUCGGCCAUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.73
medium
89.90.0760.970.5230.32720.2470.49020.24420.24320.12140.89741.11650.03430.23380.69350.57270.79170.44920.55650.55170.65510.86150.74490.73620.70610.77821.40230.54610.68750.82390.8605000.09550.19030.37840.09450.14140.60670.371200.09270.18480.45860.09160.10.18210.2720.53930.53470.354500.088500.87270.08710.0870.08690.60260.51430.25480000.21161.84842.67471.68440.07650.07640.22160.30260.22610.89171.30980.145200.14490.36010.20440.35640.21310.05950.42250.39420.82650.47841.00881.10590.45860.06540.3255
16
15Assymmetry Gap0 - 3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5080047
GGAAAGAAAAGAAAAGAAAGAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCACAGCUUCGGCUGUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.399
medium
91.90.0231.1060.5640.14860.88350.52170.24890.73810.48821.66370.7050.46660.3481.59030.44831.10120.55110.21720.43141.26830.41991.63620.90711.66090.67843.3061.08310.53691.14230.78100.17310.17260000.08620.59760.339600.169400.835600.16670.166200.82040.16360.4871000.48340.32060.47730.15870.15830.62691.07830.458800.30440.453301.61943.99852.6420.26310.1313-0.10240.39140.3891.02050.50610.502100.0230.24960.24860.24760.24660.36780.84660.36080.83071.84331.13141.0020.111100.3317
17
16LEL0/ALR LDM 1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5081251
GGAAAAGAAAGAAAGAAAGAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCAGUCUGUUCGCAGGCUGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.933
medium
990.1221.340.7310.21780.7950.86891.04610.79750.70181.26180.9760.7440.21720.69041.47490.94720.41180.88411.3491.99771.13180.88491.80540.77530.85913.23050.85420.86231.37990.9120.12420.01790.12380.12360.21550.03080.18410.71371.10190.05950.11880.05930.471100.29310.05860.58030.92720.67820.72630.0558-0.0440.41591.6470.21530.26790.26681.0571.23371.06130.35180.20040.29910.19882.20625.36672.70460.2090.12280.20030.28080.80961.3131.85370.49810.0656-0.01620.22240.62660.78890.21460.28650.31820.3831.30761.56581.16531.39830.34440.14730.2932
18
17LEL0/ALR LDM 2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5081258
GGAAAAGAAAGAAAGAAAGAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUGCGUCUUCGGGCGCGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.144
medium
960.1021.1180.610.06160.7030.63770.63131.0720.26540.82330.32880.43540.26680.26521.05920.46720.25560.92681.2121.28620.44210.76631.14240.84531.15262.37990.87420.56310.93880.570.08410.0420.0420.08390.08380.16720.08350.90510.81220.1620.08090.24180.95260.02170.15820.31470.46860.5420.30820.91130.151500.22650.68840.14880.11140.18520.80430.53650.71540.14280.14240.42440.01332.64043.8762.20740.24430.12540.06780.3380.39190.77141.27220.34510.20070.37040.39640.05580.61520.38750.27650.49140.62111.16631.27071.11841.30070.29870.09940.1982
19
18LEL0/ALR LDM 3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5081274
GGAAAAGAAAGAAAGAAAGAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCUUCUGUUCGCAGGAGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.733
medium
1000.111.2130.6620.72520.74880.73381.2761.15970.54440.50031.07921.36030.34760.89941.2181.47660.56910.32351.38431.69350.45860.37950.96951.24150.93612.82030.61310.74050.92860.91510.06530.065200.13020.0650.12980.31720.60710.75770.12600.21980.62170.1551-0.03760.18550.6730.93421.00820.5584-0.03760.11730.17551.48540.17090.07620.0010.61840.83210.60430.27350.21810.21730.40481.99965.44682.06730.18370.18320.00220.03120.72231.19581.04530.47550.14080.17180.12860.28260.7880.38070.20830.29020.50091.44520.75761.28071.4410.15190.2260.1503
20
19didnt use any G-C
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5082224
GGAAAACAAAACAAAACAACAACAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAUAUAUUUCGAUAUAUUAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
3.197
medium
960.1771.951.0640.43140.91450.29520.65741.21770.98711.45751.8031.81591.5191.24091.6292.14691.13761.76061.08870.85911.86471.11371.76092.06142.38121.5211.14461.29361.76042.1850.3220.179700.19990.51540.3940.33081.75112.01190.14680.21940.30291.83550.14090.14060.14020.59861.72620.4020.66290.2640.19740.35991.37810.19430.12710.6311.41321.32341.75440.3464-0.00430.28870.19864.826.32343.76910.1790.13390.16250.19960.87941.57611.84050.81560.28420.20230.30230.16090.55580.47280.58550.38050.90791.62981.16371.65911.94980.2220.34660.3067
21
20
The Sazerac - Jieux - Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5082609
GGAAAAUAAAAUAAGAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGACACUCUUCGGAGUGUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.541
medium
93.90.0751.2780.6771.60540.80691.31671.1690.51170.75831.36061.3291.06890.70471.26590.33681.23220.98062.41551.54571.11350.60160.59591.73830.76321.67182.42971.04960.05531.22222.63970.32550000.162300.16190.4821.10490.038800.15710.6220.1551000.69040.83270.30140.772900.2220.07391.30320.28830.14380.28630.49710.92930.8270.41080.4081-0.05910.48052.21265.1322.06460-0.00240.34240.45320.11311.11111.09190.6484-0.0090.10770.32140.3091.04660.41590.61770.40910.70791.19071.52631.27811.58790.18370.09170.274
22
21
The Mint Julep - Jieux - Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5082637
GGAAAAUAAAAUAAGAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAGACUCUUCGGAGUCUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.583
medium
1000.1221.3420.7320.6710.52831.17791.40750.3720.75250.74360.35651.20610.95032.50940.89951.53580.80862.28611.4221.77670.77991.52210.7521.82552.62432.62580.58011.45732.63751.2172-0.13420.15180.3021000.01680.44890.31210.45540.29300.43641.00220.1428000.42560.70150.27940.27810.13880.13850.13811.48390.268600.53280.6591.2911.14090.12650.37730.12550.12531.94234.50852.28130.10840.43080.08160.42640.42361.24561.08870.50490.1008000.15090.6470.26310.49070.58340.73091.18271.28791.48220.92930.26440.43760.5208
23
22
The Absinthe Frappe - Jieux - Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5082644
GGAAAAUAAAAUAAGAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGGAUCCUUCGGGAUCCCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.064
medium
87.90.0161.1070.561-0.5990.8143.0960.384600.3823-0.1991.12641.10671.44180.71281.3940.68940.68191.65991.30051.27431.05060.923-0.19780.30621.29751.63340.57341.26431.50821.34190.2672000000.26610.52781.29240.512800.50860.75380.49860.248300.12390.369500.2454000.24451.43340.23800.7060.46720.26840.2310.23020.229300.22853.45573.85282.7166000.38570.19230.57160.93840.92470.36770.183300.545200.18120.36040.17970.16260.88080.86861.02540.67631.806500.16380.4876
24
23Rock That Lock (GC closing barcode gap 0 - reverse rotation)
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5082677
GGAACAAAAUAACAAAACAAAACAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUGUACCUUCGGGUACAGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.69
medium
990.1031.2880.6950.54881.36260.78090.44310.92671.22950.99961.03491.41641.09362.33650.96390.74260.7340.4012.36691.28810.90531.88522.32871.35181.67371.87091.07020.9140.81280.82130.20470.08220.40580.1350.13470.43470.24560.5280.91070.25910.07550.06460.57600.06390.07380.50630.88150.37191.15610.18870.06060.24131.64490.18050.17510.17460.77610.96240.81030.11160.16690.05560.1682.44915.58072.82750.0926-0.06080.0850.22220.39471.07531.13360.52310.13050.34610.04320.17250.34310.34120.12770.7570.66580.86191.04931.46760.99170.30810.23020.2294
25
24Rock That Lock 2 (GC closing barcode gap 0 - right rotation)
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5082685
GGAACAAAAUAACAAAACAAAACAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGAUAGCUUCGGCUAUCCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.92
medium
970.1071.1770.6420.58980.38430.60890.75210.84010.43490.87030.88591.0370.81351.28760.67050.63061.01240.83781.01451.54630.44811.38291.14761.40961.21051.56660.81090.34941.16091.17350.06080.2060.15410.20480.10220.11880.25380.65290.79350.19770.1480.27010.37220.09740.19420.24190.29430.83090.44790.28160.23380.04670.16311.30080.09120.18180.4960.62670.66210.69920.13270.17430.08650.3872.1174.51082.05150.260.12970.09250.45930.44391.17991.0470.7979-0.04220.01970.17270.17220.51250.37360.19480.33660.74621.36471.18951.37781.160.3340.16990.2593
26
25Rock That Lock 3 (Quad GC closing barcode gap 0 - reverse rotation)
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5082692
GGAACAAAAUAACAAAACAAAACAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCCUAUGCUUCGGCAUAGGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.958
medium
980.1161.2760.6960.06620.66370.35670.96580.85581.30621.31831.3211.64560.70332.13761.06910.78931.06051.32940.99851.11610.65981.00350.71421.52061.19511.9190.89320.17691.10091.52660.16920.16870.11230.11210.01810.27850.6340.58080.80820.10760.08060.16080.63650.10890.08230.26310.15750.67510.57030.73690.12680.05070.15171.19040.0990.09890.31981.231.13651.56910.18410.22920.04580.18272.28494.61792.82140.1940.1934-0.0080.26940.60981.45231.45510.57670.08660.16840.24970.46040.64220.38270.3460.41250.65051.15140.95741.25441.09070.40790.28120.0633
27
26Will it hold?
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5085553
GGAAAAGAGAAGAAGAGAAGAGAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCGCGCGUUCGCGCGCGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.587weak66.700.9270.4631.7148000.66820.66120.65430000.64760.6410.634601.24410000-0.30971.220.60410.598401.46140.29090.57650.571300000000.5662000.561100.55620000.55130.81630.27090000.53720000.53270.52820.523800000.51950.51531.50880.4990000000.495000.491200.4874000000.9599000.9455000
28
27Heeyyy
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5087176
GGAUAGAUAGAUAGAUAGAUAGAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUGAUCCUUCGGGAUCACAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.381
medium
91.90.1031.1350.6190.1813-0.12880.86670.64340.63690.31691.14081.22040.20270.47390.59671.07530.2290.28971.23081.35150.7310.36341.07170.70650.52540.86371.01971.97551.29011.0310.86050.311400.30980.15450.15420.15380.02590.60770.452500-0.127200.3002000.37311.24350.57980.28860.1440.14360.1590.99670.27960.27840.55190.74980.87380.40070.13330.1330.13270.13252.72484.19942.69840.337200.09780.22320.20711.25121.12210.52980.31630.08450.1049-0.04130.82550.30810.10250.40740.67951.08710.53191.33741.21790.27980.37090
29
28Warped
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5087193
GGAAGAAGAAAGAAGAAGAAGAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGCCGCCUUCGGGCGGCCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.478weak73.700.80.4-0.360801.47641.44260.71320.705200.35060.34870001.364601.33571.307901.28141.2558000.62171.81161.7610.581601.14210000000.56591.11190.5511000000000000000.54630001.0740.53250.5280.523600.519301.52031.48460.49100000.48720.48350.95230.938200000.465600.9177000.4555000.89810.445900
30
29Code Break
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5087381
GGAGGAGGAGAGGAAGAGGCGGCGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAUAUUCUUCGGAGUAUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.527
medium
89.90.0931.020.5560.09420.3570.20260.27430.26760.26650.26530.52620.13510.19610.45430.25850.32150.25620.63520.68910.43550.18610.30860.15380.09210.30560.66531.27061.19071.16861.09240.11180.05590.22270.16660.221300.26890.51860.54490.05390.05390.1880.8472-0.00810.1580.15760.30461.31810.50660.75090.10.09980.1991.17160.24320.08480.27710.95061.02860.76990.1840.22920.13720.12952.45455.47212.82330.16770.18210.1660.20260.5951.14361.22630.35530.17720.22220.17590.43660.65650.12980.24780.59220.9561.02041.17231.12481.32720.3670.03410.093
31
30Code Break
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5087391
GGAGGAGGAGAGGAAGAGGCGGCGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAUAGUCUUCGGAUUAUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.279
medium
87.90.0650.8250.4450.08330.33660.28160.02860.08090.0570.11390.08530.25480.61680.27290.16690.32530.81070.43320.69620.21350.29220.13250.0530.21120.26280.26180.88151.13821.02021.0040.03630.01190.0362-0.15910.29110.26580.05950.2880.50010.11880.04750.35420.52390.04680.0324-0.07510.18610.82640.36510.677300.07440.35841.05720.24130.10950.21830.71530.9990.75390.06480.04180.24960.29112.46164.17281.57240.05920.01160.08310.14290.49611.33531.34080.40470.14170.01440.24070.05390.4740.17630.36410.32410.40040.85531.27251.45551.1570.41240.20550.2188
32
31Code Break
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5087399
GGAGGAGGAGAGGAAGAGGCGGCGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAAUUACUUCGGUGAUUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.502
medium
88.90.0910.9970.5440.0660.25676.00E-040.06370.12720.1270.18990.31490.25090.74390.4310.60970.60390.41580.41220.58920.23480.17560.17510.4060.28260.40120.5680.88750.99110.80551.328900.1591-0.01030.15850.10550.10530.49640.56960.57750.23050.15250.27840.82430.03670.09960.03650.38140.92430.09710.86230.14340.14310.09521.15130.21620.27770.16790.90910.52271.1060.20170.0945-0.03360.11562.71165.57062.86730.2170.1542-0.10340.2150.81371.18041.41310.49280.13410.20060.10010.05320.39610.33220.20380.40840.48471.36681.10881.61630.99060.20370.17140.434
33
32chop1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5087407
GGAUAAUAAUAAUAAAUAAUAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCACACACUUCGGUGUGUGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.388
medium
94.90.1051.150.6270.39890.98430.67060.0778-0.03350.33170.87240.86051.47080.41740.8241.01340.99740.78790.96971.3290.93521.10261.08370.80241.30960.37521.02221.25240.8240.97351.0373000.15920.15880.15840.31520.31360.46690.463500.15410.15371.05820.15080.15620.29880.66510.367300.1466000.29181.14610.14290.42590.55831.37341.21230.390900.133300.1332.65313.39611.97540.46140.28710.20030.22760.67540.77831.19970.43330.18130.21480.21410.31950.5280.31520.27580.51761.11851.0991.27261.24741.590.27940.37030.1351
34
33Waterfall Sunrise
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5087585
GGGAAAGAACAAAGGACAACAAACAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGACCUUUUCGAAGGUCCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.61
medium
980.0890.9840.5370.04950.07170.10130.35550.35350.58820.74560.51380.84490.4280.49060.2650.32950.32780.2430.83650.53230.40170.81250.61880.6321.15971.25270.57410.83241.04440.72540.222400.05560.08320.08310.05540.27560.3290.65120.1083-0.04130.02710.93360.10650.1063-0.04130.42250.73080.46630.46290.01020.0770.20461.27820.19990.19920.19860.63891.01550.76430.1430.04760.18990.19532.26054.22911.85580.24650.20470.08180.12240.52611.23010.62860.27380.11710.11470.19410.15490.57260.19120.19060.52920.59910.66680.73231.46640.88160.17580.24520.2379
35
34One RNA to Rule Them All
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5087593
GGAGAGAGAAUUUUAUUUUAUUUUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCGCUCUCUUCGGAGAGCGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.294
medium
90.90.0530.6480.350.2518-0.24610.2220.33130.110200.21970.65220.53890.23970.21370.3190.211900.21120.21050.20980.41680.31110.33030.30760.25530.35530.80190.49720.78560.30870.097400.097300.09710.0970.09680.28920.85590.095000.84310000.09350.64810.18460.367100.09160.09150.634100.18070.09020.44780.35620.70440.175600.08770.17491.2432.58931.68020.07990.0390.27680.15840.47170.54550.617400.07710.0770-0.00460.22980.52560.22680.15080.37480.66761.02160.9240.85010.21180.21110.1404
36
35the little RNA that could
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5087657
GGCAGAGAGAAGAGAAGAAGAGAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCAGACGUUCGCGUCUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.398
medium
88.90.0971.0690.5831.01420.20220.20150.28590.3980.14110.14050.6670.58050.19290.38351.67970.91951.08451.41350.17621.039700.68560.67830.58791.71580.96541.10661.23981.51261.18730000.14810.294700.07361.22680.57210.1427000.4252000.14140.28160.55820.34690.61830.40960.13620.4060.53680.13390.26670.26560.9161.29320.89330.25080.125100.49663.18293.02991.843700.21670.10820.20950.32121.0430.9320.51360.20480.3056-0.113-0.0110.50450.20120.20050.49740.68870.58480.89450.71120.54450.55810.18550.1849
37
36May the Force be with Thou
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5089503
GGAACAACAAAACAAAACAAAACAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUUCUUCUUCGGGAGGAGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.972
medium
960.1121.2270.6690.73450.6820.61940.32640.6461.27031.04920.72981.05741.29461.01731.55981.07550.82441.04711.54861.48010.825610.83261.38731.77951.36680.79180.28151.43070.86830.27020.0540.01750.10770.18790.08040.15070.50380.59370.36540.10420.17140.71890.30660.09110.12720.32910.55210.71940.24710.17250.07380.14731.20430.29910.19110.31990.69150.97080.69480.13680.18190.23530.09442.59594.31532.15760.08030.11620.1160.19950.49621.05090.81510.4780.14770.21940.07330.25450.6090.35530.21280.73610.72590.88761.49641.32081.10540.25530.19090.2377
38
37May the Force be with Thou
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5089505
GGAAGAAGAAAAGAAAAGAAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUGCUUCUUCGGGAGUACAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.106
medium
94.90.0921.0160.5540.14130.20920.104400.10430.43990.20610.30770.47020.70420.55940.44520.92610.82690.71290.51850.56061.24310.76861.62960.61061.07562.19340.65440.92691.1090.85860.15570.15610.15480.03870.11580.2690.19160.19080.379500.075800.82290.03650.33450.11130.29540.2940.61860.46960.14420.0720.10780.81580.10330.24680.17580.93090.7480.67160.09670.06740.06730.26812.44784.00131.77710.05850.11680.29060.25120.23060.87090.91320.681100.18250.21970.23550.46640.32370.2150.33620.38680.98731.37181.31030.84830.2940.19540.1948
39
38May the Force be with Thou
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5089507
GGAAGAAGAAAAGAAAAGAAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUGGUGGUUCGCUACUACAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
3.391
medium
91.90.0771.0290.553-0.09680.36090.51020.3540.99540.14990.24890.34390.53580.31540.50470.42940.68410.42180.60340.71130.83771.39271.06380.85820.63710.65161.37030.65070.8151.01411.38440.0267-0.04730.0770.03850.15360.11050.2670.34140.52670.09390.0750.03750.37280.14880.14840.07410.34480.56040.25450.58840.0360.1680.08380.95190.03520.28060.10510.72690.62740.48620.20010.13510.2690.06041.77823.31952.38270.13080.05920.13020.13250.51670.93971.00440.33770.1170.11210.08850.15290.69330.30170.31390.45420.68930.78521.3081.67471.25820.24550.43880.2912
40
39Uno
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5090942
GGAAAUAAAAUAAAAUAAAUAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCUAUACUUCGGUAUAGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.023
medium
94.90.0821.1860.6340.1470.12510.21870.43431.48440.8221.16250.18880.38961.12830.72621.05211.2610.87051.61110.95350.82340.52492.00360.77981.09461.41322.85661.20090.29880.78690.5019000.194300.20740.19280.24010.33440.84820.37470.09350.09340.55550.10210.18410.22930.410.89810.66650.572400.08790.26270.948800.17201.26430.83180.98260.081800.08170.24412.71634.27572.5720.0694-0.0130.1530.13780.43761.20730.84320.6540.04860.06520.06510.64470.44810.44490.04510.44090.75731.06911.3161.31781.62610.45320.03150.3375
41
40it works..
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5092949
GGAAAGAGAGAGAAGAAGAAGAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUGUGGAUUCGUUUAUAGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.617
medium
87.90.0590.8780.4680.23150.74740.14690.182100.06060.06060.56430.41720.41450.3240.57680.46320.11560.76330.60620.80810.5250.71040.54170.64350.57511.12140.56860.61420.50770.15190.2019-0.02070.05040.10070.15060.20020.24920.64140.77970.14590.09710.04850.62430.1560.09560.23810.22530.58730.53580.25520.01090.36880.05660.81770.11340.11320.18051.10860.52770.60970.0870.17350.08660.39471.82223.97271.37770.07630.0028-0.03250.07610.4930.6351.02970.32880.07420.03640.09260.34390.67950.19640.26610.52780.40120.87810.84931.21610.80590.29210.0980.2279
42
41AsmtryGap0-I
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5092999
GGAAAACAAAAGAAAAGAAAACCAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAUUAAAUUCGUUUAAUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.081
medium
87.90.1131.4870.80.80631.36810.95591.31051.01591.26180.36120.35540.70291.11920.85021.97651.13231.57711.53860.68482.04490.90990.78490.84481.106601.22090.80350.26671.66351.0831-0.04340.210500.12670.37770.18830.25010.43460.73630.122500.12220.48520000.77871.11790.52510.52080.1155001.35640.11280.11260.55820.7940.65360.85960.21420.10690.10670.09293.03464.76872.38080.35730.18070.35380.26420.61061.02971.58920.66210.41110.15970.40690.63810.24040.47720.62990.77760.90921.04181.32461.78751.19250.27930.38180.1235
43
42AsmtryGap0-II
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5093003
GGAAAACAAAAGAAAAGAAAACCAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCAUAAGUUCGCUUAUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.977
medium
980.11.0970.598-0.00810.23491.02610.83940.62990.75830.24820.7131.14561.12521.12831.75090.72810.5460.91990.96251.1841.14470.50310.64190.68780.52471.08290.68860.5061.0320.9420.19530.0975-0.03730.14590.24220.21720.37040.31020.49710.04730.04730.28240.60590.09310.13930.18520.48250.65930.31670.35990.05260.04490.1271.07750.04390.04390.39280.90341.02020.9580.08760.04150.16570.20651.99944.25131.98650.10820.14390.2850.14280.2491.1180.89230.44430.10240.17020.13580.05820.63310.36250.32720.55330.76131.19191.14821.04281.25490.55830.20030.17
44
43AsmtryGap0-III
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5093005
GGAAAACAAAAGAAAAGAAAACCAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCACGAGUUCGCUCGUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.177
medium
960.081.0190.550.1233-0.11250.62340.61730.51031.29940.39730.59040.96880.6711.0371.24751.40051.41331.04240.77230.88831.040.53620.77411.12050.39761.01720.69640.37710.32060.939600.07510.07500.22420.027600.80951.08480.359500.28630.70780.07070.14110.10560.21060.72850.41350.41080.068400.27240.80680.06720.03360.23410.6291.2680.7050.19170.25720.25330.06332.57833.08091.68310.1679-0.004600.11160.49830.87361.12610.32010.07990.12550.10610.13230.34210.36630.31240.15580.30111.01630.85211.18050.52440.09730.14560
45
44ia01
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5095862
GGCAAGAAUAAGAAGAACAAUAACAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUAUAUCUUCGGAUGUAGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.868
medium
93.90.1251.370.7471.18281.48550.43030.42730.96822.03331.58572.29210.68370.83671.45320.54030.17960.53421.05061.20231.6721.30590.96481.41481.6831.56661.7411.3241.5880.54760.52840.2700.134700.40150.13360.39810.78630.39070.388300.38591.2608000.125800.49930.6180.36860.122600.12241.43540.23830.11890.70570.87821.79790.66710.25050.22040.21960.27342.56985.8143.07520.27020.08990.23210.1420.71161.37791.10.669800.16940.24920.29090.77470.32410.24220.75590.97691.45362.00021.6590.91370.07090.07080.0612
46
45GGUAUCC
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5096919
GGAAAAGAAAAUAAAAUAAAACCAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGUAUCCUUCGGGAUACCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.913
medium
960.0951.1180.6060.3930.70890.7590.88440.77280.26720.79161.41860.890.40531.3791.16841.35811.04520.85911.61840.6730.76240.64681.07071.24260.30911.01641.18980.58930.87181.42020.09450.09440.094300.28150.46570.13940.46130.67660.091000.97550.26720.17760.26530.25410.26270.07720.26090.08690.08670.25911.26960.04230.21080.16820.58310.80580.97010.16130.160900.24042.73424.80691.8220.1368-0.028600.06820.80841.18971.35810.32170.12840.38290.06380.15720.46970.18820.18770.49650.7360.78740.74031.2880.95720.31460.17110.0854
47
461st pass
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5098791
GGAAGAAGAAAGAAAGAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCAUUGGUUCGCUAGUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
3.585
medium
91.90.0941.0340.5640.0150.42020.41790.41480.68550.60240.26990.40230.59770.59210.30080.1740.85810.78070.54580.78781.11.21410.37280.33111.2760.63161.03540.90911.00421.01750.55660.177300.03540.10620.28180.15170.14020.52150.59560.06880.13720.10280.84490.10120.20180.00960.38420.50610.39510.37630.16320.07380.13860.80230.12810.12780.20680.75490.99070.61310.15290.1830.03050.12171.97664.10662.35970.08190.18450.1840.18350.33891.0511.00990.27610.02750.07510.05120.34830.49360.14770.1970.29350.52091.1981.10711.05291.36530.23280.15420.1775
48
47??????? ? 1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5101578
GGUAAAAUAAAAUAAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGGCGGGUUCGCCCGCCCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.877weak79.801.4250.7130.71691.442600.71320.705201.37950.3431.01250000.66781.94181.26850.62791.231301.20772.60510.85662.73150.5416001.5840.52361.0301000000.76321.7320.491000.48720.4835000.24080.23990.476200.47260000.4691000.46561.36660.89810.8855000.439601.50213.82941.186500000.3930.39060.771700.383500.75770.37660.37440.74000.73141.42960.35542.06251.3457000
49
48??????? ? 2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5101580
GGUAAAAUAAAAUAAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGGCGCGUUCGCGCGCCCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.559weak74.700.9890.4940.91980.51610.76481.24940.4958000000.97630.48440.95410.47350.46990.46650.4630.45970.90610.89330.4435-0.63490.4404000.437300000000.43430.8569-0.6285000000.425500.42270.41990.20920.20850000.4144000000.4116000001.60471.181000000.77760.3864000000000.38411.49970.37270.73670.36620.36410.36200
50
49??????? ? 3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5101582
GGUAAAAUAAAAUAAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGGCCCGUUCGCGGGCCCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.523weak68.701.4720.7360.50481.41031.37951.3499002.58903.658201.196302.3052.22371.092601.074003.065301.97940000.9744000000001.89040.93120000.9177000000.9045000000000.891701.73440.8554-0.7836002.46592.37310.78120000.771702.233000-0.038400000.727200.71890.71080.702800.6951000
51
50Heirloom Apples
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5105474
GGAAAAGAAAGAAAGAAAGAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGUUCUCUUCGGAGGACCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.92
medium
960.1171.3380.7281.23541.38191.15390.6660.75210.46651.0961.94911.04550.25430.68561.65771.22561.43720.94381.08221.65590.44840.35321.451.62451.04193.29181.09970.82990.78930.899500.123700.1234000.15430.60880.72220.239800.23891.17230.233600.34840.23140.40240.39990.67810.021300.11261.12360.220100.32850.86390.85221.15050.11730.20780.10370.21863.09195.18022.6330.30070.16570.34040.32510.58551.23010.80950.56160.2398-0.0107-0.01070.1590.38320.39220.69810.4620.98532.1241.85352.41621.72790.45930.43090.065
52
51ALR-FS w/ gap 0--2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5134381
GGAAGAAGAAAGAAAGAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCGGAGCUUCGGCUCCGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.185
medium
89.900.8840.4420.00310.2369-0.11710.2360.70020.69250.6850.22750.67521.75060.43460.21660.85450.84310.62610.41460.81850.60790.602100.98780.85570.95780.1910.56780.18870.92960000.18540.732900.36430.36220.180600.18010.17960.53410.177500.1770.26440.61110.43350.2590.1722001.01660-0.11670.3370.33530.49890.33090000.1651.60793.20492.77210000.14560.43371.13570.56280.41930000.13940.13910.27710.02170.54810.27290.55860.53530.62631.73310.255700.1276
53
52ALR-FS w/ gap 0--3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5134388
GGAAGAAGAAAGAAAGAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCCGGGCUUCGGCCCGGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.11
medium
86.900.8820.4411.386200.16690.27481.34480.53340.790.41340.5181.2690.25280.50150.49761.45820.48240.95020.82060.58070.68930.68180.78740.6650.44022.1270.2120.42111.238600.410200000.60930.60350.79450.3948000.9717000.19370.48070.3822-0.01310.3793000.189100.188500.1880.187400.55730.36930.184100.18361.95682.39581.33990000.1670.166601.59380.562300.1603000.477100.15860.47240.04890.15670.46651.221.63410.148200.1479
54
53Meechl LEL0 Asym Gap 0
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5134567
GGAAAAGACAAAACAAAACAAAACAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUUACUCUUCGGAGUAACAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.995
medium
980.0961.1180.6070.36260.67430.99970.7060.90470.48340.46520.94411.05210.49310.9711.94480.86621.03460.84070.67121.61960.98310.93971.09941.25121.43141.54810.77771.10090.76021.18550.19180.07180.02390.09560.14310.07820.33770.31810.74340.36950.09220.20690.70460.04540.09520.13570.35980.49430.44280.52690.11260.0250.1310.77630.08610.10750.36520.88450.74910.63850.34830.2040.16280.32372.16014.0172.18560.12310.1054-0.01080.16940.62321.08881.05390.31620.23220.05890.23090.26280.38390.45360.46630.68390.90570.98151.4771.28041.08720.3450.22920.1429
55
54D003
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5152679
GGCUACUAGAUCCUCCUAACUACGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCAAUGGCUUCGGCUGUUGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.498
medium
89.90.0650.7130.389-0.1173-0.04010.113-0.06010.27470.24860.44460.18150.19870.33690.305600.08720.34680.04330.02170.34460.7890.16960.40020.48070.66180.29040.81230.68160.6740.7809-6.00E-040.2530.2520.07740.26990.07580.05640.55230.37460.075500.09430.65320.0746-0.04180.14870.14830.67860.59950.42930.21560.10760.21450.80710.08810.15810.27990.55481.05690.66850.16810.12820.16110.12731.9853.40531.64760.22190.08860.18620.1760.22370.92111.10540.46290.19580.19520.08850.04420.37870.110.08650.35460.44820.9990.63310.56780.79110.1664-0.02640.0768
56
55Asymmetry gap 0 sub 2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5171946
GGAAGAAGAAAAGAAAAGAAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCAUCUCUUCGGAGAUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.988
medium
94.90.0811.060.5710.63850.26620.26510.20950.26290.52140.89940.76160.62840.32041.2250.2440.66410.41980.47610.88021.65711.45150.93471.13181.06021.49691.89420.59510.97640.91420.80750.04070.18910.094400.094300.14110.42050.55570.18470.09220.09210.8180.36150.09020.22480.13460.66580.44080.48120.08740.08720.3470.8558000.11660.84210.74891.06350.56750.0810.08090.10732.55714.49722.27960.34350.06860.17110.30650.4061.03171.04730.551500.06480.10780.28960.54230.60030.12610.25130.92841.33830.65881.11781.04140.402400.0574
57
56Simple g
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5177151
GGAAGAAAGAAAAGAAAAGAAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCACUAUCUUCGGAUAGUGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.681
medium
970.1011.1080.6040.67660.170.25390.63050.37650.3310.41390.44841.08170.79121.08860.72870.19031.71240.58440.72820.68431.02741.44811.18791.39391.3881.02121.40410.77050.7220.65340.240.29860.11920.07980.11880.17760.20660.28380.2340.29110.05820.1740.46070.17230.11460.11440.34150.73130.39130.88190.055100.16481.34390.21430.24020.23930.68370.57321.07570.20420.06280.15260.42932.47474.90031.82820.34550.05120.04710.3850.42490.92111.55180.64670.20150.16070.08130.19990.3620.23690.35250.52430.48180.91031.5371.60251.09870.17670.42130.2061
58
57L&0
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5179066
GGAGAAGAAGAAGAAAGAAAAGAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCCUCGCUUCGGCGAGGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.845weak92.900.6450.32300.25100.7440.2470.73250.24320.24230.12090.83520.70780.46840.46490.916301.1251.10521.19280.53750.63851.04650.68910.41040.20460.40650.60390.20060.20000.19940-0.03730.09940.1981000.19750.78020-0.272500.387700.4810.28730.1909000.940400.373900.37170.36950.184200.1837000.90532.93471.35140.16850.3352000.33340.16630.82050.326500.1628000.484700.16120.34380.31820.47380.77991.07320.75740.301500.1644
59
58LEL0-GS0-V1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5180545
GGAACAAACAAAACAAACAAACACAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.308
medium
91.90.0691.0680.5690.28830.8970.49060.67940.76780.42750.21340.83991.030.36460.63170.37780.88350.97250.5050.63851.14080.38250.69451.56221.25521.33481.70950.58741.29460.67691.2880.208200.069300.20730.0690.13770.34240.3406-0.001200.13580.06630.06770.33660.40130.33270.59320.3930.5840.12950.06470.12910.69620.1590.15860.5660.49910.86150.35880.061100.0610.18252.73464.39161.65830.13130.18330.05230.36430.51611.16511.22130.34540.04930.029700.24520.41790.04860.33850.57510.45420.98250.9221.70450.92810.39530.26240.2613
60
59GGCCGAC
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5185815
GGAAAGAAAAGAAAAGAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGGCCGACUUCGGUCGGCCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.844weak84.800.8770.4380.37580.3711000.38481.50241.1070.36681.081701.06340.35251.37911.34960.66770.660701.60950.32030.31861.24930.61851.50930.892800.29621.16290000000.28940.85640.28420.2829000.56080000.13990.4169-0.20890.13860.1383000.548600.273100.54150.26960.26840.26730001.30883.22861.2178000000.72231.181300.2354000.234500.465500.23190.46040.22940.68070.67340.22370-0.20820
61
60GUCCGAC
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5185818
GGAAAGAAAAGAAAAGAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUCCGACUUCGGUCGGACAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.483
medium
90.90.0951.1140.6040.03080.42470.2116000.15990.52120.51690.52750.80851.38380.58750.58211.69930.74630.3711.09361.51211.21940.81590.80430.50450.66551.38331.04031.86381.515800000.151200.3010.15010.888200.14770.2940.43790.059300.14530.1450.57460.49880.63480.2809-0.08630.14010.4176000.13890.95750.7240.6680.6610.26330-0.0861.72853.56351.875300.1170.23310.40530.51692.42950.89250.43190.10780.107600.34170.33890.1060.10580.21090.45551.12781.35441.18141.06460.14480.09640.3833
62
61Fisker D1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5191430
GGAAAUAAAUAAAUAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUCAUGCUUCGGCAUGAGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.509
medium
90.90.0850.9340.510.29160.99040.402600.1549-0.09060.265600.39590.58820.32510.73730.88390.81020.24831.16591.3685-0.2220.47240.36390.92241.46411.32050.32850.53720.58940.950.15790.1051-0.1143000.20920.10440.20810.51610.308100.20480.50780.30320.10090.10070.49970.69190.34410.536100.09730.09720.86260.17680.19020.28410.74850.37210.27780.09250.16690-0.21772.39153.03511.8018-0.02690.0817-0.02690.08150.72491.26281.16210.30840.30690.22930.07630.0440.42050.22580.3740.37180.44311.01711.48961.18331.16150.60890.1350.1347
63
62Fisker D2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5191439
GGAAAUAAAUAAAUAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUCAUGGUUCGCCAUGAGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.787
medium
91.90.0921.0120.5520.32930.59220.48740.32620.3610.55770.11890.25750.27570.69610.57480.45650.69231.3240.65510.33730.37721.05971.09341.57380.25281.19061.45220.38480.76030.51840.78220.1850000.092400.32170.2290.80680.1800.17950.97210.08820.1760.08790.34960.94690.68120.67390.08410.25140.16711.14860.081900.40710.62850.8730.55070.07860.23480.15620.23342.04623.75452.07790.27130.0402-0.02740.17440.03960.99191.04060.579900.16210.19190.12960.63020.6240.37220.85660.57591.21881.0810.80760.93770.170.16960.1872
64
63Fiskers D3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5191526
GGAAAUAAAUAAAUAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCUCAUGGUUCGCCGUGAGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.528
medium
960.0981.0810.590.62950.6690.39330.14270.18110.93090.60880.30290.12010.47070.5930.69640.63580.64590.49840.56450.90410.41460.93320.80571.12111.11220.91150.93870.47480.91731.02270.20990.1794000.17890.26710.23660.15980.52560.40620.0580.28850.6850.1140.00870.2870.5051.10270.60070.38140.270.270.05491.05470.05270.10520.36611.02720.70950.89810.1994-0.00230.14910.3892.66834.08442.27370.15980.20120.02270.41820.5391.11.39440.63110.07880.10540.11770.17670.90890.28680.36120.53240.8250.98651.16691.57191.36490.44050.15140.4361
65
64Mat - Asymmetry Frozen - D1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5193129
GGAAAUAAAUAAAUAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCGCAUGCUUCGGCAUGCGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.904weak84.800.9620.4810.69010.7382-0.203500-0.2028-0.20220.33590.13250.131400.65770.97140.322100.32050.634600.229-0.08420.3111.221.4890.97130.3820.57390.8493000.28180000.28060.83060.35240.27330.541800.53720.2675000.26630.52820.3937-0.064900.260801.52710.25350.25250.25150.25050.4970.97860.243700.24280.24183.32175.33810.618700.20560.40850.203601.58751.92380.19180.19120.19060.37900.7490.37230.37010.1845-0.01010.53391.42191.56010.85500.17050.3392
66
65Mat - Asymmetry Frozen - D2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5193133
GGAAAUAAAUAAAUAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCGAUGCUUCGGCAUCGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.882weak81.800.9480.4740.66480.33070.32890.65110.32390.32220.63790000.31740.47250.99740.45980.30510.60430.89360.59020.29370.29230.2911.69890.60121.63290.53960.26870.5328000000.26530.7859000000.26090-0.1182-0.11800.259800.76990001.25760.12550.1253000.49710.73690000.12261.0853.40591.979400000.21920.43530.21690.21620.2154000.21470.426500.21250.21181.65010.81440.20291.58281.16520.38600.1924
67
66Mat - Asymmetry Frozen - D3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5193137
GGAAAUAAAUAAAUAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGAGAUGCUUCGGCAUCUCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.496
medium
88.901.0630.5310.23351.58720.3680.18350.36480.72120.53630.35550.57170.86680.77060.67760.91810.49690.81740.64721.11260.78480.31240.69510.17621.13211.62990.86831.48371.17860.68580.273100.1363000.40620.00450.93220.52680.39270.130600.90130000.38390.88320.37630.37400.248400.73640.24450.3647-0.25960.83960.6990.93290000.10311.7864.05791.605700.60650.07360.30090.49750.97951.24810.47640.190.250.09430.06050.43180.37050.55090.54610.73221.31591.20471.05571.4035-0.043700.2464
68
67Rigebius
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5193750
GGAAAAUAAAAGAAAAGAAAUAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCCGAGGCUUCGGCCUUGGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.043
medium
990.0971.30.6990.94080.8361.24020.48540.89490.64420.95171.24390.30951.51020.32270.64741.06930.76730.84730.42081.4571.98480.82171.06121.86361.33761.79662.72661.07091.31.32570.2114000.105500.36720.46860.72061.01280.502400.20030.88870.39250.0980.0490.24380.48390.57540.570200.09490.28341.11350.27860.27550.45591.16341.0561.03860.17260.08190.2572-0.00462.5245.39463.13290.21290.14160.22320.41870.69022.29451.84010.44870.06400.35030.50990.43850.380500.40380.64170.90031.20452.10261.5520.44030.0550.4369
69
68Ceusbira
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5193783
GGAAAAGAAAUAAAAGAAAAGAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCCUGGUCUUCGGACCAGGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.456
medium
990.1341.4860.810.94352.59821.09420.72110.7130.7051.27040.5130.84350.99621.19231.16621.85560.30781.50213.41011.38951.62452.09410.77562.00261.59672.01040.81981.36141.11441.09510.218300.433500.21600.53381.66540.4136000.20611.01410000.4030.69750.68990.58580.19470.3870.28891.22750.18830.187701.10650.54850.72290.53750.5330.17720.52712.36734.83943.5365-0.10740.1470.330700.43491.55552.0520.40780.298100.02790.13450.55850.52770.13170.52230.79441.01310.78472.5131.28940.46540.4620
70
69Dirabe
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5193806
GGAAAAUAAAUAAAAGAAACAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGUCAGGCUUCGGCCUGGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
2.074
medium
94.90.1021.1260.6140.37941.04931.15880.44930.94351.77281.13790.770.52860.63570.56691.23910.66870.98740.65140.79560.78410.7730.8740.61091.24761.17542.17510.85561.23231.07670.797300.30850.0440.0880.11450.08760.14010.3470.54080.25670.25570.02440.42270.16860.08420.33510.25031.06630.40740.7250.32060.15990.11971.13610.17350.15570.15530.46260.98670.98440.14890.14860.07420.11112.25824.44331.928700.38340.13070.12720.62940.74640.97970.12220.36450.12140.0605-0.12030.24030.23890.35660.76140.63391.19021.00640.82761.03120.3240.37570.2672
71
70Starry Asymmetry 0 Gap Size 0
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5198841
GGAAAUAAGAAUAAAGAAAUAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCAUCAGCUUCGGCUGAUGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.793
medium
94.90.1171.2830.71.2130.8551.66481.5351.09570.797100.96710.95251.30581.09981.25750.71040.61580.43591.6952.60011.58420.47171.08181.36081.54861.37071.46160.83331.49150.80320.3991-0.08640.52760.13160.1314-0.04320.13240.77520.63950.38140.12690.06340.47920.0394000.37380.86030.48780.243000.31091.64380.11720.1170.37890.68910.68160.89590.22320.02590.33240.22082.79644.55792.89130.55470.09910.81880.40680.40421.23281.46230.17160.17110.34030.16970.08470.67070.32910.41320.41050.89031.03491.24852.02681.09930.6590.21890.0729
72
71read red
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5205941
GGGAAGAAGAAGAAAGAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCGGCCCGUUCGCGGGCCGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.821weak83.800.8170.4090.13170.34510.343200.17110.1707-0.214501.33640.3323000.33061.29521.26910.31570.62510.6190.6130.3050.90190.29920.29781.02531.57111.12230.55620.276900-0.2138000.54890.27330.32880.2698000.79900.26520.13230.13210.2630.261900000.77610000.76660.75740.7484000.49501.68633.41761.11900.2230001.31020.64840.4293-0.21230000.6375000.21180.21110.83310.41380.41110.61070.604800.4007
73
72glorius green
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5205949
GGCUACAACAACAAACAAACAAACAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCGCCCGGUUCGCCGGGCGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.319
medium
93.90.1171.2870.7020.38210.65110.48462.3332-0.13310.30960.30810.30661.20281.18031.72211.54351.36661.07471.05670.78271.2781.49720.91620.90122.10421.14770.9050.75990.87971.91920.57820-0.13140000.72790.51570.20560.81180.2023000.79890.396900.39450.29450.67970.67241.0392000.05720.5601000.37120.73380.36481.4690.17730.52730.34960.34772.18183.03521.70960.1550.15470.15430.45950.30481.04911.32060.29210.1457-0.13060.14540.28940.71540.14270.14240.283601.65671.35262.33671.39640.25290.25190.1257
74
73blue blush
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5205961
GGGUACAACAAUAAAUAAAUAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCCGCCGGGUUCGCCCGGCGAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
0.848weak84.800.8790.4390.4320.3432-0.170700.33950.33770.33590.33410.9866001.60250.37960.31570.31410.92850.6130.90621.18561.44790.288301.40910.83430.55130.81630000000.27090.26980.5349000000.266300.13290.13260.13230.39450.26190001.0305000.25660.25550.25451.4910000.49311.79652.63930.904800.22540.22460.22380.88271.29681.270600000.21110.21040.20970.2090.82490.20561.20970.69781.07790.32850.193600
75
74ChP AL Gap0 18-9-1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5208940
GGAUAUACAAAUAGAAGAACAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCGGGCCUUCGGGCCUGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.745
medium
970.0811.1870.6341.13010.37550.76470.4661.5581.08770.79150.95251.20660.51291.66451.04230.7271.11091.09170.99762.36371.30211.13660.46161.00521.15433.03750.76610.75690.93211.869300.06020.18020.11990.23890.05970.64961.04540.58810.114700.11450.34160.226900.11320.56110.88520.43950.10970.1095-0.10110.10931.07450.10730.00620.21340.73830.62650.82450.20540.204800.10332.87344.64662.512300.08650.08640.34370.42670.75881.46160.40850.1630.08140.16230.14210.32180.4790.23860.21620.52660.8120.65051.27481.14950.21970.07320.2187
76
75Frozen Yogurt Shape GapZero v3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 0
5223899
GGAUAAAUAAUAAAUAAUAAUAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCGCUAUUGUUCGCAAUAGCAAAAGAAACAACAACAACAAC
...........................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))(((((((....))))))).....................
1.752
medium
86.90.1071.1780.6420.88961.4511.68341.31850.78820.72281.10460.82751.30740.15141.30110.11660.14710.4383000.72210.85480.70441.51251.20291.38051.91241.73571.09641.09110.7090.3525-0.10390.11730.117100.34930.11620.23161.690200.11250.11230.44590.229000.54960.65270.53930.537000.10660.52850.21070.10520.41791.07810.45871.09650.09610.198700.14441.76972.79891.65320.35540.17720.17670.2640.43691.36780.82380.50140.24970.33120.08270.14450.46890.40540.24230.32150.79351.16821.04481.31810.92740.29270.1096-0.0937
77
76JR_AsymLvl0Gap4_Sub1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5077405
GGAAAGAAACAAAACAAACAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGACUUACUUCGGUAAGUCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
3.837
medium
970.0780.8680.4730.35180.35940.54260.2970.16450.24820.5470.46210.42670.30280.3320.35630.75520.8470.42820.83320.85731.99651.1440.67930.35840.74920.60710.0270.0270.0331-0.03120.15080.08050.08640.5180.46150.09220.06580.06570.58580.0520.07790.05190.11660.78050.23410.50560.07580.10080.1760.92890.17290.09870.15140.4310.50870.55220.16760.14340.09540.17251.81273.41792.12980.18940.0630.0420.16740.34330.88210.67980.3230.06050.080.14070.01820.49770.3160.17670.21430.61051.24920.67721.05460.85170.20030.23330.09060.3960.29280.18190.3197
78
77JR_AsymLvl0Gap4_Sub2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5077407
GGAAAGAAAGAAAAGAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGACAAACUUCGGUUUGUCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
2.377
medium
970.0981.0910.5950.2130.8871.06790.58020.22550.41010.70970.99780.4951.40870.38451.40961.06590.90991.3361.13690.99030.93232.71370.32250.71740.67041.50130.230100.15300.15270.19030.34061.11541.02410.218700.18170.6830.07180.14330.4270.1290.6320.45310.17380.0694-0.04190.1040.85490.06830.44090.37090.66720.88810.52190.09770.17580.06480.12932.1853.70212.32060.1130.11280.1830.05610.33511.04360.7060.645-0.04180.02390-0.02970.4260.10630.17030.42110.80870.51430.621.27880.97040.09780.31640.22510.48090.24590.2860.3847
79
78JR_AsymLvl0Gap4_Sub3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5077411
GGAAAUAAAUAAAAUAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGACAUACUUCGGUGUGUCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
2.072
medium
960.0881.1310.61-0.42181.40191.00360.8050.43050.28190.84450.35990.82871.04771.2550.67720.91480.71380.83510.8541.15281.94391.59390.68360.77170.76241.03110.18690-0.07530.09320.10160.27750.09240.64630.45320.09050.1026-0.07731.2352000.08810.0880.95320.64330.80440.1689000.91540.24870.24770.24670.28230.68650.48090.39820.079500.23331.80673.91312.08860.20820.06930.20730.20660.34241.63441.12740.45470.06490.2585000.76610.317600.2330.9341.10120.64281.12841.62020.45950.34280.31460.08720.2290.7230.4966
80
79Gap 4 Frozen 1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5078060
GGAAAAUAAAAUAAAAUAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGUAUAUCUUCGGAUAUACAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.618
medium
94.90.1051.1550.631.04091.03650.94450.37560.55841.45460.36161.24060.87380.91750.68020.50611.77910.80471.33891.79621.41851.84031.41441.38340.95370.1360.93750000.13360.19980.06650.2650.26390.78200.25960.25851.26660.502600.125400.62090.37030.4899-0.112800.06120.90460.24030.23940.3570.58950.8720.633100.229400.22852.20542.53992.32900.20280.19040.40110.29941.27121.33990.3805-0.01720.18940.28280.28160.37320.16670.09280.55160.81671.41930.84911.25581.00910.25130.08360.46880.57480.61930.40320.7963
81
80Gap 4 Frozen 2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5078066
GGAAAAUAAAAGAAAUAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGUGGGUCUUCGGAUUUACAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.792
medium
88.90.0551.2270.6410.5830.91910.38831.14361.30661.10041.43380.70881.21650.68760.84791.00140.7460.73261.58681.46881.50910.59791.02931.01281.48340.76761.4214000.13590.13570-0.03860.36580.66680.6598000.05460.52240.130300.13010.2591.20690.37880.23720.25030.1872-0.01450.739200.1230.12270.60771.07510.82530.234900.11720.1171.70783.97171.45710.20750.10360.309200.61230.7791.13680.49040.09790.097800.2920.42560.57340.28540.83060.70980.82141.08850.91591.71140.9274-0.06710.42560.50390.67180.33570.6538
82
81Gap 4 Frozen 3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5078070
GGAAAUAAAAUGAAAUAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGUGCGUCUUCGGAUGUACAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
2.401
medium
93.90.1041.1440.6240.29821.39320.37261.35261.12410.85380.69720.75250.4611.33540.46781.4331.35691.06711.59311.43870.71121.35110.80831.2150.75480.98511.24290-0.05220.15030.14990.07490.07480.46711.05750.43810.07220.07210.21570.56990.1422-0.0520.19580.28190.80030.20810.4818-0.00910.11130.03430.97880.26890.13410.26720.29910.92970.93480.07680.12840.14020.09592.13053.82822.132-0.03870.2780.16640.16590.49391.07871.00840.31680.05390.10530.20980.1590.10420.31110.10380.51250.65831.60210.61091.42840.79180.0940.14060.34250.22710.64560.26240.6528
83
82AsymLab4b
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5078081
GGAAAAUAAAACAAAAGAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGGAGGGCUUCGGUUUUUCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.686
medium
88.90.0081.0420.5250.60570.80421.09580.58460.49711.1391.09951.00870.92611.21110.51210.94481.30.28760.85110.97750.82690.7490.9390.20060.53040.32980.5880.1304-0.087400.38880.12930.12910.25710.82460.44090000.25090.12520.24950.12450.37120.85450.7240.597600.11930.23771.0518000.02930.57790.34480.6822000.02630.13912.28883.69371.79430.19870.19810.30680.09830.48760.77070.66720.095200.0950.008-0.12580.24360.48090.27880.27750.73571.34050.9680.69621.52850-0.0860.08480.49960.85630.93380.9595
84
83A civilized design.
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5079180
GGAAAACAAAACAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGGGUUUAUUCGUGGAUUUAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.152
medium
87.901.2020.6010.08480.92730.35870.70920.87431.2007-0.15451.17820.83051.14730.80740.16540.63110.31401.07851.79460.88470.71990.42411.1320.28171.64620.273200.27200.27080.269700.26850.5325000.26510.78550000.51941.02190.25440.50480.25140.250400.49680000.4930.33730.243600.24270.48170.08841.97544.22792.698000.05570.4110.20481.4021.37150.389400.19410.1935-0.21420.08430.60690.37550.9251.79730.8860.87371.21940.843400.02030.33470.4980.34650.49030.5797
85
84A civilized design.
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5079184
GGAAAACAAAACAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGGGCUUUUUCGAGGGUUUAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.206
medium
86.90.021.0230.5210.58720.712.18850.54240.92660.720.192400.77690.76740.2548-0.13921.49240.73750.24490.96450.71521.39860.46280.547700.45451.3345-0.138600.221600.2209000.43860.7269000.42970.6380000.63160.41830.41550.41280.30810.10250.40751.58880.19800.19740.77961.33550.567200.18850.37480.18681.85222.60192.49880.16610.1657-0.137700.65590.56881.03890.475900.315700.020.1570.31250.15590.31020.15471.65731.04561.01811.28240.14220.14180.14150.69980.27870.68910.6772
86
85A civilized design.
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5079192
GGAAAACAAAACAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGAGCUUAUUCGUGGGUUUAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.843
medium
89.90.1241.3650.7450.10790.9920.94380.19651.15750.78290.66751.10671.08760.89351.39790.94791.67310.90490.32770.48771.42991.09290.9230.60941.04870.14951.602300.14530.14500.14470.14430.50111.05591.57850.1370.068400.54250.20280.06750.20190.33480.66250.91410.260100.129800.64230.12820.12790.25480.37990.50250.989300.12340.24590.16182.58384.27011.93090.21130.41970.72610.41220.77230.5631.48890.29330.19490.29110.096900.57590.2990.28490.84330.19731.09991.16950.79940.62020.26240.0050.17420.43250.43260.59690.5079
87
86Along
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5079444
GGAAAAUAAUAAAAUAAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGAUAAAGUUCGCUUUAUCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.821
medium
88.90.1141.2530.684-0.2081.08060.2280.83520.82431.27651.30370.77560.88920.82580.81510.94880.5410.8551.39351.7610.67010.53161.80721.14072.08350.18331.13990.35790.11910.11890.11860.05930.23620.17660.70470.57590.115000.569600.11370.22660.11310.8920.00260.22540.22030.219500.65170.324200.69470.58241.24550.50850.30680.102100.10192.73094.12291.72570.08840.17630.22240.08740.17431.53061.00420.74420.08260.22120.1639-0.02540.48720.32310.04040.83651.24931.22510.49961.15390.55870.29280.29140.36220.39650.39270.35440.4225
88
87
The Hurricane - Jieux - Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5082665
GGAAAUAAAUAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGACUGCCUUCGGGCAGUCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
0.817weak85.900.9010.450.71740.47820.69760.689900.05451.34310.21241.14480.64740.64080.63441.8474-0.2860.30641.20232.0361.42151.644500.54640.92251.183300000.13120.1309000.26080000.77280.256500.255501.0057000000.9899-0.282100.73380.24360.24270.481700.2399000.71171.78431.34730.223800.2230.222201.51780.64390.42630.21240.21170.21100.4192000.20890.20822.40360.98580.97070.67630.3801000.5650.18780.37330.1861
89
88
The Ramos Gin Fizz - Jieux - Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5082667
GGAAAUAAAUAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGACUGGCUUCGGCCAGUCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
0.864weak76.800.9360.4680.28330.57430.30080.5960.29660.27180.8694000.28850.8537-0.31430.251300.83480.55170.54691.33821.31040.2610.517700.257800000.5114-0.056501.00250.249600.24860.24770.246700000.48960.2438000000000.483900.24100.240100.23921.17383.12373.17820.211200.21050.20980.41680.82261.01180.2017000.20110.59750.086200.19730.97130.57741.13410.74710.18620.91750.1830-0.12570.54260.715300.5319
90
89
The Brandy Milk Punch - Jieux - Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5082669
GGAAAUAAAUAAAUAAAAUAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGCUGUGCUUCGGCACAGCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
0.813weak84.801.0470.5230.31440.8817000.72490.42680.84621.04030.20741.61650.7980.39650.78310.38921.887501.83271.43281.05661.713100.34080.674300000.33530000.704200.32840.48870.48500.07320.318400.9410.31210.61810000.30750.30600.304600.15190.4525000.3002-0.28210.59483.60671.60750.2683-0.2772000.5321.55670.51460.762600.25320.50230.74460.4925000.73021.1940.4740.49931.92071.32730.4393-0.05470.218100.86070.2144-0.0587
91
90Asymmetry Gap 4 -1
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5083206
GGAAAAGAAAAGAAAGAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAACGACUACUUCGGUAGUCGAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.714
medium
94.90.1251.370.747-0.17151.15810.45670.58330.89080.44231.51080.85161.25211.02641.60060.89061.34911.77610.37181.4531.93660.69641.02761.82931.30291.58760.99820.31050.3090.15410.15370.05960-0.0340.88560.7244000.36950.36730.146600.21910.21830.43370.64390.77730.42110.41830.41561.39480.13500.40231.05490.90970.51560.03570.41760.12730.12712.90925.1742.30480.320.42380.02610.31520.41741.47780.85450.39960.00730.113500.10590.30150.29360.09770.67680.85831.1241.7751.72641.21560.4250.25730.25620.50840.42080.74850.9017
92
91Asymmetry Gap 4 -2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5083219
GGAAAAGAAAACAAGAAAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAACAUCUACUUCGGUAGAUGAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
2.333
medium
970.11.0960.5981.01951.17821.44751.36170.80661.00541.74871.11010.84490.83440.19570.76791.13731.11711.63231.24451.30580.77391.46031.55520.80810.91580.50230.1967-0.0502-0.050200.1570.03920.14530.26110.61640.15370.07680.15320.53160.151500.07570.18860.85580.42990.25740.146800.24211.14730.14310.14280.02130.84420.55780.62130.0190.13760.29230.12082.52263.70052.31690.11860.11840.11810.58530.63731.30491.11470.22210.05550.11080.11060.00540.54760.33560.38240.37950.5351.04530.9271.6060.69430.19780.24620.14740.14640.53420.33660.477
93
92Asymmetry Gap 4 -3
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5083226
GGAAAAUAAAAUAAGAAAAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAACGUCUACUUCGGUAGACGAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.452
medium
990.111.2080.6590.3016-0.48460.67860.10870.32771.1051.09410.64971.06461.04691.29351.37670.59270.85371.65010.9941.44891.06821.05040.52091.77181.40241.292900.1612000.160800.47870.31750.938400.311300.30970.15450.15410.15370.64140.89830.59321.30710.14490.28850.0720.5002000.14260.42490.2820.83480.13880.138500.15811.62594.7151.69050.47840.11940.59130.1180.58471.26071.12560.3359-0.00530.11160.11140.21550.64940.10170.21740.43170.41891.25861.7341.28031.17460.58190.17380.19250.38260.28570.28440.8417
94
93Gears
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5087234
GGAAUAAAUAAAUAAUAAUUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAACAUAAUGUUCGCAUUAUGAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
2.29
medium
970.0640.9780.5210.32870.96680.61680.54610.54140.70020.95190.73910.35450.5120.50791.07520.45750.55711.18410.89780.97770.88261.24590.75230.90990.69990.789800.0051000.06570.0984-0.02280.51950.6427000.06420.69850.25540.06570.0630.18840.77540.40060.610400.12180.15190.80990.17950.11940.11920.50250.73050.75060.1727-0.12060.05750.11492.48243.39271.62720.40420.2415-0.070.04030.58540.68751.28570.45180.14250.14220.05720.12870.51380.32520.27760.59570.90331.0220.56811.33241.08010.2940.31350.11050.39560.26990.39010.2255
95
94chop 2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5087448
GGAUAAAUAAAUAUAAUAAUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAACUCUCUCUUCGGAGAGAGAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.375
medium
94.90.0911.0060.5482.25561.53191.28631.87211.12371.00521.56840.871.13910.93521.10260.54651.42441.89961.01941.8151.2930.16121.10860.47160.92920.84040.68020.1508000.3002000.22430.06941.170000.29110.145200.144901.13830.28330.282000.07040.21060.14010.139800.75940.47960.87830.06750.134700.06731.86493.33062.14490.23740-0.15340.23650.35281.33971.2382-0.040200.112200.22350.66350.330.21930.54340.32441.16741.65341.11660.84680.19920.099400.29690.29550.29410.3897
96
95Code Break 2
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5087466
GGAAUGAGGAUAUAAUAUAGAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGCUUCUCUUCGGAGAAGCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
1.812
medium
970.0880.9870.537-0.05990.53350.5290.52460.13090.39020.25910.2580.89031.12430.60860.73211.19710.71010.75180.68441.73980.81951.19431.43240.36920.83270.82190.10260.10240.05120.051100.10210.25410.65390.990200.098900.973400.19410.09690.24130.62120.380.2837-0.0658-0.03690.2821.108200.09220.36670.81450.87050.57420.17620.17570.08770.08762.11663.74291.930.08850.23020.22940.22850.67820.6711.24240.50750.14470.006800.18010.32250.14890.07130.21330.87640.65910.62361.57090.43150.46137.00E-040.06580.19670.32580.5490.3532
97
96One RNA to Find Them
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5087638
GGUAUUUAAUUUAUUUUAUUAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAACACUCUCUUCGGAGAGUGAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
0.953weak87.900.8810.441-0.69041.48151.27761.44960.16071.4135-0.20550.92850.6130.3050.15211.04722.02710.8570.64070.35450.8270.88020.53722.328200.64020.883700000.5009000.24950.24850000.97860.0409000.24280.95630.11930.5910.46930.23380.46410.460700.22950.22870.4540.33870.559500.444400.44131.71724.94541.9180.19120.19060.37900.18890.74680.7380.729500.362600.1584-0.021700.15660.35550.87640.49311.35690.33741.08470.6521000.32440.16180.32190.4792
98
97circles CIRCLES!
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5087651
GGAAGAAAGAAAAGAAAAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGUGUACGUUCGCGUACACAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
2.592
medium
960.0760.9790.5280.30970.44090.25170.3950.54010.70641.00890.62360.95530.33930.52351.25170.55511.05940.53191.39970.58550.93021.59690.41130.6110.94570.95950.05640.0157000.14050.04360.31480.47830.67150.109400.08190.56820.05410.0540.24220.34790.63580.4210.31420.15670.05220.31161.19730.07630.10160.30340.27690.64770.28160.0990.09880.04940.01762.17134.17511.83280.08610.0860.21430.25610.33970.92040.82580.32860.0410.32680.08150.16280.12160.34230.34050.15930.76910.45030.54170.72870.680.07570.03540.11070.22560.05090.24290.4971
99
98the RNAtor
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5087676
GGAAGAAGGAGAGAGAGAGAAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGGUACUAUUCGUAGUACCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
3.405
medium
89.90.0690.7580.4130.0320.36640.38370.28360.50970.39170.47120.11690.02470.030700.03070.13770.03060.1830.31860.84640.62221.73550.40060.24230.43840.79610.1115-0.02130.02790.08350.08340.08330.13850.41280.280.19110.02730.08180.67410.00570.10760.05380.36620.51680.15860.42010.05250.05740.17470.9980.1070.10240.3310.49460.74160.59310.24620.08040.14710.10761.87563.27081.61010.10930.06550.10960.13050.30350.62150.84570.64870.10410.12470.06240.13460.34070.26730.18380.34570.68290.77150.46360.95210.88860.11270.09340.09320.18770.22690.26130.4461
100
99Default title
Lab Entry Level 0 - The Asymmetry lab revisited - Frozen shape with gap size 4
5089514
GGAAAACAAAACAAAACAACAAAGCAUAGCAAGAGGCAGGAAACUGGCUCAAAGUACAAAGUAGGAAACUACGGUACAAAAGCUAUGCAAAAGUAGAUAUUCGUGUUUGCAAAAGAAACAACAACAACAAC
.......................(((((((..(((.(((....))).)))...((((...((((....)))).))))....)))))))....(((((((....))))))).....................
2.302
medium
91.90.0691.2450.6570.54160.43650.58870.64070.41370.35260.89450.74260.62210.81920.55270.79920.8570.70621.04320.72190.31570.9081.34530.54910.29130.3381.64580.4667-0.0721-0.07210.09320.23220.04640.09270.36850.27520.091600.09150.36370.181300.09050.55550.57730.70260.39270.34720.34530.10030.42750.085400.01350.75820.33520.50940.16560.2474002.80175.16732.22640.1390.13870.06930.06920.24121.31570.73360.39760.1323-0.00540.131800.32790.25480.25990.51550.7010.87020.55031.63461.22020.11820.02310.11760.23430.38140.5050.3866
Loading...