R74 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79X80X81X82E1E2E3E4E5E6
2
1Starrys AUsA-U Closing Base Pairs 23015122
GGAAAGAAUGUCAGCUAAAGAUGAAGAAAUUCAUCAAAGAUCUUGAAAAAGAUCAAAAGCUGACAAAAGUCGAUCUUCGGAUCGACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.137
medium
94.70.0610.6690.3650.98251.36681.1990.94370.98150.87571.08611.26020.302300.09290.02320.023200.09640.53750.68811.11250.63430.07450.0670.04470.0670.10560.17190.38350.57880.4450.77620.16220.0216-0.02870.014500.15080.86031.03120.48880.10460.06270.06270.06960.18050.30450.5740.7670.43710.41470.36270.12070.11050.08030.05020.34970.47951.03370.95970.55860.1730.07680.019200.02670.17010.48530.96460.88291.01960.38410.09140.07300.16860.18170.27771.11770.41820.23690.37320000.32510.26040.24930.18370.18550.1763
3
2StarlightA-U Closing Base Pairs 23015192
GGAAAGAAUAGAACAUAAAGUGCAAGAAAUUGCACAAAGUCCUUGGAAAAGGACAAAAUGUUCUAAAAGCUCUACUUCGGUAGAGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.546
medium
93.30.0850.9340.510.77091.1261.28051.37810.85151.13711.04771.27110.42160.1464-0.03650.22820.0273-0.12720.34430.56431.21220.83071.09330.08670.06930.10380.03460.09140.23480.29940.86420.48120.62960.18390.08350.03340.06670.050.08031.09871.38851.10740.19120.06370.0159-0.00440.1860.32691.04951.89290.76590.9060.56540.17820.00840.1186-0.01460.26141.21441.14291.32570.69380.15970.06640.05350.03140.18790.35621.05651.10321.06661.29430.24560.06870.05230.18270.16930.1330.93431.5640.59870.68451.140000.29880.21730.21060.18660.1920.1832
4
3StarbrightA-U Closing Base Pairs 23015194
GGAAAGAAUGGUACCUAAAGUGCAAGAAAUUGCACAAAGUCCUUGGAAAAGGACAAAAGGUACCAAAAGCUCAACUUCGGUUGAGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.481
medium
94.70.0670.7410.4040.71861.0651.36121.00621.0480.70071.01340.96860.18180.090300.0612000.02110.4591.02860.81610.81760.10110.02890.04330.02890.10090.24440.28620.78080.7110.57350.2580.05570.0418-0.0150.02780.11010.98381.10340.86740.11160.0580.01340.05350.10250.28390.91961.8790.63180.61060.39630.072100.02520.06110.34330.6181.14151.28090.5040.08390.0599-0.00940.02640.03360.06450.6461.06060.97881.09350.4420.18090.14080.11270.16880.11750.38390.630.30230.3360.80230000.24180.1920.19240.16350.17540.123
5
4First I seen tonightA-U Closing Base Pairs 23015201
GGAAAGAAUGGUAGCUAAAGUGCAAGAAAUUGCACAAAGUGCUUGGAAAAGCACAAAAGCUACCAAAAGCUGUACUUCGGUACAGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.691
medium
960.0780.8560.4670.53361.25411.50710.8511.5330.64031.30831.09920.27870.039400.08430.03930.02250.11490.63490.97471.21740.9980.09650.080300.03210.01720.22240.50710.51120.60190.85260.13710.10850.09290.03480.02450.19180.99341.41820.99950.18490.14770.04430.06640.23290.29321.10991.78070.8980.9140.45370.24120.03370.09620.09260.2160.88331.24370.89520.72250.23440.05210.03430.11210.05050.1020.76920.89671.41521.28940.29060.08850.10980.07910.26090.04230.25811.01840.47940.53620.43470000.27120.20080.19510.17660.19360.1401
6
5A-U Closing 2 V.1A-U Closing Base Pairs 23015215
GGAAAGAAUGCAACGUAAACAUCAAGAAAUUGAUGAAACAUGUUGGAAAACAUGAAAACGUUGCAAAACAUCAUCUUCGGAUGAUGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
6.377good94.70.0780.8630.4710.69311.02291.47581.10540.96530.89571.02451.17350.36140.050.0150.09490.010.03990.14450.50621.24791.13060.41710.13490.0480.01910.02870.11130.14940.3950.95580.58650.70070.32190.046-0.00140.07340.11860.41431.51711.32640.54940.2130.03360.03930.08280.10880.29941.631.09521.04821.16530.7240.18840.13030.02350.09680.64871.26941.10931.22690.46480.13690.0228-0.01640.02220.05010.0430.56060.87091.36410.85340.22880.27080.15070.09320.10030.14540.45081.32590.38810.34590.72630000.20750.14610.14810.12880.1180.1271
7
6A-U Closings Z1A-U Closing Base Pairs 23015461
GGAAAGAAUGCAUGUUAAAGCCGAAGAAAUUUGGUAAGAGCAUUGGAAAAUGCUAAGAACGUGCAAAAGCAGCUAUUCGUAGCUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
6.522good90.70.0921.0150.5540.7930.87551.22130.9830.92830.60670.95571.36160.24130.00290.05750.13010.16080.18670.39450.9621.04880.92290.84040.2360.03540.02170.1650.22650.22590.3080.84150.95490.45220.31170.32090.13440.08470.08640.71521.36561.07541.00660.44280.14670.03890.07780.17650.41720.87571.92491.49960.79110.66590.24210.20110.09780.09610.57961.77521.00031.44190.66480.21970.12530.15440.09180.09160.06230.73171.17431.41641.5310.41420.25290.10850.03870.08970.14670.70561.44630.46860.70721.01260000.20040.14220.14940.13450.13410.1093
8
7first cutA-U Closing Base Pairs 23015482
GGAAAGAAUCACUAGUAAACAUGAAGAAAUUCAUGAAAGUACUUGAGAAAGUACAAAACUAGUGAAAAGAUCAUCUUCGGAUGAUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.852
medium
94.70.0740.810.4420.80211.3241.03641.16330.74640.95061.11870.89530.17180.0279-7.00E-0400.02860.04290.07610.38661.0711.06030.73520.1317-0.00180.02740.06840.02740.15030.28140.61510.44110.63760.27650.01990.03720.01330.10610.27471.11461.28561.09260.13280.04990.07580.10960.15520.47141.66460.65980.57670.81310.51690.16640.0653-0.0040.0830.17211.36251.36411.22070.24790.14630.016-0.03720.072-0.06140.2570.58391.22691.32531.41030.42310.11030.14660.07320.13580.13560.61451.07740.40720.35130.81320000.26740.17240.16070.15990.13820.1493
9
8A-U Closings Z2A-U Closing Base Pairs 23015515
GGAAAGAAUGCAUGAUAAAACCUAAGAAAUUAGGUAAGAGCAUUGGAAAAUGCUAAGAUCAUGCAAAAGCACGUAUUCGUACGUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.718
medium
920.0910.9970.5440.84231.06251.4191.18630.94190.80891.07321.40640.38760.0468-0.01140.08010.040.05520.32190.57831.19211.07920.97520.23680.02840.075700.15110.0630.24140.73580.74540.48840.14670.09160.02360.07310.10570.54431.04771.01311.09490.47420.0780.05540.05880.02760.34430.92491.69921.44151.14280.79970.26110.08690.04790.15921.06952.01881.15141.54030.48840.20670.10320.02640.12750.2310.3210.60531.1951.74361.64120.39120.1630.04070.04070.06780.21650.54671.25440.4740.81690.81390000.2720.23970.21390.19240.18250.1535
10
9A-U Closings ZA-U Closing Base Pairs 23015527
GGAAAGAAUGCAUAGUAAAGACGAAGAAAUUCGUCAAGGUCAUUGGAAAAUGACAAGACUAUGCAAAAGCUACGAUUCGUCGUAGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
7.292good960.0850.9370.5110.69511.23821.55381.08771.02911.11231.13311.51330.33090.08270.03040.07340.07330.0160.12290.88751.34761.21320.9920.07920.05190.071-0.00680.06230.17840.26970.9580.61510.64680.20140.05830.01670.02750.01790.14391.32930.61450.74140.25690.04150.03340.05670.18440.32550.70942.01431.19691.09190.63520.18090.07670.09540.08150.14611.47721.01891.64480.38440.10510.03410.07980.20620.18750.28620.84821.02591.5751.55960.40570.09080.01910.08410.0430.09460.49431.00080.36851.03031.0910000.19240.13120.13910.11770.12140.1198
11
10eugen merzbacherA-U Closing Base Pairs 23015685
GGAAAAGAUGUAUGGUAAACUAGAAGAAAUUCUAGAAAGUACUUGAACAAGUACAAAACCAUACAAAACAAUCACUUCGGUGAUUGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.465
medium
94.70.0710.7830.4271.09150.86231.28311.2410.94420.42280.80670.93530.339400.0840.002900.03360.13690.37781.17540.83770.46970.04860.01620.01620.01620.1050.27380.36750.6630.31970.89950.3360.04690.04680.0318-0.04570.21521.20821.08440.85810.13960.05980.04410.10440.22520.49221.47762.35540.78391.06440.46260.16340.11640.06530.1230.33241.03281.17051.27430.67320.06440.04310.04310.01210.07280.12870.84121.07851.11760.78090.24580.16540.07330.04880.09760.02440.12810.68210.37260.23970.50060000.24760.18050.19880.17790.16690.1072
12
11eugene merzbacherA-U Closing Base Pairs 23015692
GGAAAAGAUGUAUCGUAAACAUGAAGAAAUUCAUGAAAGUACUUGAACAAGUACAAAACGAUACAAAACAAGCACUUCGGUGCUUGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.786
medium
93.30.0810.8890.4851.05140.971.61141.11690.89220.60580.87580.88770.408400.0680.09060.04530.02260.14310.51651.26151.2860.72310.2438-0.01150.0860.02150.08590.29630.38350.80220.51410.86760.32070.062-0.00470.0207-0.00950.5131.32771.55191.06610.13020.08780.0975-0.03330.16730.46681.37612.12450.8920.99930.52790.11280.06560.02070.1460.18651.16751.16381.08780.37510.11920.08510.102-0.02310.09010.08680.711.04141.0781.26020.70290.31720.37890.26950.26840.07830.22390.88650.45890.53530.47910000.37010.22070.22570.22310.19520.1494
13
12Prof. MerzbacherA-U Closing Base Pairs 23015696
GGAAAAGAUGUGUCGUAAACAUGAAGAAAUUCAUGAAAGUACUUGAAGAAGUACAAAACGACACAAAAGAAGCAGUUCGCUGCUUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.17good94.70.0780.8530.4650.51821.15161.11161.17131.00360.62530.83481.22540.31310.01810.08130.02710.02710.02710.1640.52341.09981.10970.73670.08150.02590.01290.06460.06450.23170.28160.65340.44110.65770.11580.04930.03580.01250.0170.44571.3381.50811.05620.08890.05120.12420.05320.37390.80531.13081.25250.49961.31660.54020.17120.04480.11770.0250.32651.17071.64211.19770.21290.09340.07790.01080.08310.05730.13920.76371.20731.37840.78270.27210.26590.05210.09690.09680.12570.31151.0810.2970.85890.79440000.26360.18250.15180.16380.15460.1104
14
13OnlabianA-U Closing Base Pairs 23015947
GGAAAAGAUAUAUAAUAAAGAGCAAGACAUUGCUCCAGGGCCUUGUUAAAGGCCAAAAUUAUAUAGAAGGGUCCGUUCGCGGACCCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.398
medium
90.70.1161.2750.6951.2531.27682.13581.67581.00940.6668-0.01251.06330.30280.15110.02340.10050.10030.15020.08630.5181.7031.2470.33440.23820.01580.14250.09490.14210.49452.00551.95760.87232.20690.51790.21420.04280.04280.12820.20611.27230.80370.35190.20650.12370.04120.16460.28710.76563.12873.10131.47352.27340.7690.14880.04410.07130.04750.18951.6161.98081.31171.09240.36260.29840.19650.22870.35790.32410.85591.12951.74891.32160.85840.30020.26930.2090.11920.19330.90761.50250.44071.3581.11720000.46490.39420.39630.35440.33210.2447
15
14Stack StrengthA-U Closing Base Pairs 23016133
GGAAAGAAUCUCGAGUAAAGUCGAAGAAAUUCGGCAAACGAGUUGGAAAACUCGAAAACUCGAGAAAAGACAGUCUUCGGACUGUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.644
medium
960.070.7670.4190.53941.19061.20661.04030.48121.05591.11320.7120.26230.04630.015400.0770.13840.15660.53080.84310.67031.11930.132900.08850.02980.10790.26660.30710.75620.68020.3580.24280.04220.04280.01430.04280.20620.64211.20.4330.15590.01240.06750.05510.19260.32711.62830.78091.21331.06510.65190.19680.064100.12170.15690.83151.27581.23120.33560.08080.07310.01220.14130.06220.24580.741.07661.33961.22840.34880.25080.01680.05690.07960.07390.40550.79780.27550.50490.40190000.24550.17710.17490.14860.14370.1701
16
15JR_AUClose_Rnd1_Sub1A-U Closing Base Pairs 23016293
GGAAAUAAUGUACAGUACACUACAAUUCGUUGUAGACAGAUCUUUUCGAAGAUCACAACUGUACAAAACAGAGUCUUCGGACUCUGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
6.33good90.70.0750.820.4470.80841.36271.30871.22671.31220.90080.69661.08830.49810.06890.07840.030.1160.08690.12210.51190.81020.63910.380.0612-0.02580.07480.0750.21420.49090.77410.31020.73830.97750.39710.08690.05290.10680.06170.26391.24691.14210.8550.22960.09620.05090.0890.1861.32551.61470.57330.55351.07890.71340.09930.04920.1180.09430.49360.91430.97841.33830.37020.10820.01860.05220.0530.17090.19340.50110.88971.05770.79890.2410.13090.05590.11330.0880.07070.33090.91510.32530.47950.72750000.2110.14960.14150.13460.13970.112
17
16Mat - A-U Closing Base Pairs 2 - D1A-U Closing Base Pairs 23016770
GGAAAUAAUGCAUAGUAAAGUACAAGAAAUUGUACAAAGAUCUUGAAAAAGAUCAAAACUAUGCAAAAGCUAUCGUUCGCGAUAGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.876
medium
960.0660.7290.3980.60721.04271.40881.11411.12560.75290.69760.91790.35890.03780.05660.03780.01890.07540.18810.63411.08771.1240.84630.10790.08980.0359-0.00420.10750.18780.40050.77620.52610.71310.20820.0520.08660.05190.05770.24731.38851.5880.370.08340.0220.01650.04130.19790.26650.7490.83780.47810.57230.33030.07920.04750.09490.0790.29920.71841.19410.98140.2730.15140.0153-0.00750.08310.03020.07530.41990.58090.93451.03720.45570.0289-0.00870.11550.0490.18710.3440.9240.50020.92390.650000.25190.21070.20540.20440.19580.1726
18
17Mat - A-U Closing Base Pairs 2 - D2A-U Closing Base Pairs 23016772
GGAAAUAAUGCAUGCUAAAGUACAAGAAAUUGUACAAAGAUCUUGAAAAAGAUCAAAAGCAUGCAAAAGCUUUCGUUCGCGAAAGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.26
medium
93.30.0630.690.3760.32880.80491.01761.05061.06170.81310.73960.92930.26260.06560.04370.06550.0218-0.0470.08730.49890.68431.08880.68450.12620.0420.042-0.0049-0.04690.30.16890.7930.51410.53140.24460.06110.14230.08130.10150.15930.95861.32820.56480.08450.08760.05840.05830.09390.26790.4490.63690.40260.52660.25120.11290.13150.04730.13120.32980.70611.04230.95970.37790.1437-0.02850.05390.03590.07170.23250.43590.64461.01770.89520.51410.14180.22170.17020.18690.14580.44410.77440.39931.18390.53790000.30130.21510.21590.20420.18360.1641
19
18Mat - A-U Closing Base Pairs 2 - D3A-U Closing Base Pairs 23016779
GGAAAUAAUGCAUACUAAAGGACAAGAAAUUGUCCAAAGCUCUUGAAAAAGAGCAAAAGUAUGCAAAAGCAAUCGUUCGCGAUUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.754
medium
960.0640.7060.3851.14241.0541.04971.09231.16490.55511.10240.8650.17620.01960.05870.06040.05860.04550.03580.5681.07140.99540.30120.0940.03760.07513.00E-040.00940.27750.36020.9370.41280.97950.28930.0260.08120.0180.0180.12610.53421.1340.6780.03870.0350.104900.22390.41380.59211.00860.6290.38190.23160.08390.10890.04190.03350.18380.64691.17811.16240.35370.11240.12830.05890.05370.11180.12760.36320.60641.23071.04490.35260.21280.10630.18180.07570.09070.44421.26690.48630.8680.31980000.26780.23440.19610.21240.21490.1492
20
19wisdave AU - 2A-U Closing Base Pairs 23018495
GGAAAGAAUGUGGACUAAAGUAGAAGAAAUUCUACAAAGUACUUGGAAAAGUACAAAAGUCCACAAAAGUUUAUGUUCGCAUAAACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.761
medium
94.70.0760.8310.4540.83691.28611.24960.72190.64771.36761.13951.01580.40550.0810.048600.01620.0201-0.00680.63530.98770.98041.07130.08250.07730.04880.05010.01930.14760.28360.63020.59990.59130.13060.07480.0150.01660.02990.19390.92431.31530.87660.08610.10040.1289-0.01390.23320.38151.65540.68671.03380.81830.52290.21450.0670.07220.07060.1570.90811.10980.96430.54940.25210.05090.01010.04820.07350.17110.6791.18081.19661.31360.17610.17370.13760.1910.22620.17820.24881.42170.27881.14090.58060000.2390.17870.17530.14930.14380.1703
21
20A-U Closing 2 V.2A-U Closing Base Pairs 23020582
GGAAAGAAUCUGCAGUAAAGAGCAAGUGAUUGCUCAAAGCUCUUGGAAAAGAGCAAAACUGCAGAAAAGAUACUCUUCGGAGUAUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.098good97.30.0750.8210.4480.75871.07991.46971.34480.77911.01621.13821.1460.19890.02840.04260.0142-0.0120.04250.04250.42650.95120.98520.88570.04080.04080.06790.06790.06780.28390.84130.32240.86290.96230.40310.12980.0260.05190.03890.17011.02321.13960.68120.14350.02380.03740.04930.18580.32060.91091.48631.41790.56370.3920.12460.0642-0.00530.11380.14570.89171.3081.15980.28570.0890.08510.011100.1730.11940.86741.26041.51811.24090.51580.12350.11310.1130.13330.12290.21420.78860.34090.64250.58330000.27410.15910.16680.1590.15140.1583
22
21A-U Closing 2 V.3A-U Closing Base Pairs 23020812
GGAAAGAAUCAUGUGUAAAUACCAAGAAAUUGGUAGAAUCUGUUGGAAAACAGAAAGACAUAUGAAAAGAUACUCUUCGGAGUGUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
6.55good94.70.070.7740.4220.87311.12511.37420.81410.6511.08491.03980.95890.13470.07710.04350.0350.0630.03770.03070.43341.1350.98261.37270.27690.07170.03180.03580.05430.14550.34270.79530.61480.5450.18150.07320.06160.02950.0590.20830.74371.10230.85740.24390.02910.04440.05910.10290.29841.3830.86961.02530.92570.49410.20110.08830.06810.12810.47070.76790.57160.9170.32450.16890.16390.03920.26040.22560.21090.84791.14251.19920.90690.23650.12780.08110.09340.06880.05160.38330.78860.35770.51040.47120000.16980.12280.13040.09480.09050.1131
23
22Crazy ClosingsA-U Closing Base Pairs 23021362
GGAAAGAAUAUAUAAUAAAGUAUAAGAAAUUAUAUAAAGUAAUUGAGAAAUUAUAAAAUUAUAUAAAAGUUAUUAUUCGUAAUAAUAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
2.474
medium
82.70.1511.6570.9040.6291.00111.14711.77211.58170.5241-0.12181.340.30810.10260.09160.55930.75610.50120.8780.68820.97221.19851.08891.58050.73750.91220.20530.81040.11180.75681.35851.4370.54350.17030.25470.59040.75250.68620.98170.93881.27421.17840.93270.38690.91870.60820.30311.04792.71941.29781.33652.26121.73050.89260.52371.13971.09331.32991.95881.17761.71181.3180.48670.69530.40370.28740.62980.17551.83290.54852.32791.96170.66010.6680.17170.17890.35630.70690.41871.63021.03810.85281.18670000.66810.45920.53230.55540.52630.3577
24
23Closer ClosingsA-U Closing Base Pairs 23021373
GGAAAGAAUGCUACCUAAAGUACAAGAAAUUGUACAAAGUGCUUGAGAAAGCACAAAAGGUAGCAAAAGAUUAUCUUCGGAUAAUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.777
medium
97.30.0750.8290.4521.06780.94771.32690.9160.81220.77831.24741.36750.40330.03310.01650.00640.049500.12090.39941.14461.13881.24850.1780.02040.12540.08290.0990.12230.26650.95940.74520.62620.24930.14330.03770.03010.00850.17720.7351.1541.06450.10630.0580.04340.00240.13240.37991.94151.11160.2560.99420.60010.12660.08130.01410.10870.41780.7471.20151.28740.32630.16750.06440.11570.11380.12630.19070.77091.26841.50441.14550.34160.09610.0720.13180.16490.05970.13120.79210.40690.37560.33630000.26550.18540.18060.17120.15390.1511
25
24A-U 1A-U Closing Base Pairs 23021517
GGAAAGAGUGUGGACUGAAGGAGAAGAAAUUCUCCAAAGGACUUGGAAAAGUCCGAAAGUCCACAAAAGUGUCUGUUCGCAGACACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.124
medium
94.70.0710.7790.4250.66660.95230.99150.90290.83350.931.20921.03390.1660.04320.017500.017500.01750.01690.63281.19020.47520.0510.034-0.00160.03240.03080.22850.31560.78820.65590.71080.13540.03420.0164-0.06540.00870.02510.49481.39940.44430.07170.030.04770.03180.11270.15391.72360.91421.07790.90590.72860.25530.0510.05340.03610.0860.27821.13231.1440.4410.18460.056800.18420.10650.19010.96481.38531.32361.40280.26860.05720.1230.10530.13580.09620.53471.31620.61471.00730.55520000.23710.1570.18880.15170.1460.1751
26
25A-U 2A-U Closing Base Pairs 23021522
GGAAAGAGUCUGGACUGAAGGAGAAGAAAUUCUCCAAAGGACUUGGAAAAGUCCGAAAGUCCAGAAAAGUCUCUGUUCGCAGAGACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.674
medium
93.30.0650.7220.3930.55480.80381.14390.86280.67190.72010.78520.79840.2348-0.03810.0420.0210.0420.0630.0210.20940.56480.84950.42980.04090.02050-0.03520.08450.20370.25050.77170.5070.5780.158700.019800.01980.0990.56191.23150.47230.01930.04820.03850.02890.15370.39852.01380.72231.07920.86920.56560.13170.07070.14330.0358-0.040.3921.21231.24690.4480.13760.048-0.02070.03080.06150.14550.70591.0971.07451.07670.27650.24330.04860.06480.08630.19360.42761.43590.29881.46880.54690000.28670.1960.22970.16360.14740.1508
27
26Stack Strength 2A-U Closing Base Pairs 23021694
GGAAAGAAUCUCGAGUAAAGUCGAAGAAAUUCGGCAAAGUGGUUGGAAAACCGCAAAACUCGAGAAAAGAGUGACUUCGGUCACUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.852
medium
94.70.070.7740.4220.65411.17341.29480.86580.42921.15480.92230.95070.13160.01330.007-0.01250.02980.02820.07730.35480.72390.83351.02290.13330.03390.00110.01520.10140.2090.25320.94170.70320.13150.1970.0524-0.02660.01310.07210.03930.69251.14340.82010.19430.1770.06320.06310.13870.25770.68241.78581.29960.87360.50460.17810.0354-0.05830.08570.20340.63111.2350.97610.26770.12050.04140.01130.11450.1030.16450.71590.99571.20761.17640.31450.08580.07440.09550.19060.17960.61551.13550.56680.6381.23290000.25450.16930.16930.13990.13610.1545
28
27Mod of HoglahooA-U Closing Base Pairs 23021739
GGAAAGAAUGAGCUCUAAAGUGCAAGAAAUUGCACAAAGUGCUUGGAAAAGCACAAAAGAGCUCAAAAGCACAACUUCGGUUGUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.407
medium
93.30.0820.8970.4891.1091.17571.19911.03370.61071.04360.84611.02160.35490.08380.03870.03860.03860.07720.11960.73261.20460.69350.82270.08310.129100.07370.0760.25390.4280.88830.59930.62920.26630.10640.01770.05410.03890.24771.15021.33781.00330.14380.08450.06760.04360.23710.35251.6061.1470.89260.80710.42040.24710.04990.01160.00210.14931.14131.73091.2490.55970.1880.03060.05910.03970.02520.1180.93131.30231.65081.37690.56350.21270.05480.15040.08210.14990.62681.3090.43310.51340.80860000.31960.20740.2330.18540.16890.188
29
28JR_AUClose_Rnd1_Sub2A-U Closing Base Pairs 23021750
GGAAAUAAUGUCGACUACACUAGAAUACGUUCUAGACACUACUUUACGAAGUAGACAAGUCGACAAAACUGAGUCUUCGGACUCAGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.418
medium
90.70.0670.7330.40.6451.02611.19640.94261.00970.64060.80450.81430.48430.07140.09510.02380.03180.0830.16180.26740.82580.59480.69060.20670.04590.04590.11460.06360.47790.63240.31490.51051.1220.58830.09850.17480.08730.11630.25720.69730.82240.21310.10640.14870.10610.1090.22191.09541.51720.55510.53481.2850.6730.17610.0920.07880.05430.26630.66641.22311.06750.57110.17360.0375-0.0017-0.02370.07320.22410.55430.51130.61360.77210.18050.10820.1080.0720.06880.08970.29781.10510.42730.38050.46930000.3110.22680.20270.18250.18650.1725
30
29Mather AFBA-U Closing Base Pairs 23021789
GGAAAGAAUGCUAGGUAAAGUGCAAGAAAUUGCACAAAGCACUUGAACAAGUGCAAAACCUAGCAAAAGCAAUGCUUCGGCAUUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.16good94.70.0810.890.4861.19631.37891.00191.03691.08040.75011.03471.34880.41150.01960.044-0.014200.01470.07370.50.96150.96520.9420.18250.05610.0841-8.00E-040.08320.23730.46390.80440.52460.61730.230.10810.01350.07430.02970.11231.05131.09310.89430.09090.03340.05180.10680.43140.57141.50252.05831.00920.96260.41880.21210.04660.10580.14610.2740.81991.26841.25680.58950.06750.05620.08680.03770.08230.16740.74121.18621.40870.9450.35370.21070.09780.07360.18880.17790.32841.61170.53270.60060.69730000.24840.19090.16640.14530.1630.1367
31
30Fort DouglasA-U Closing Base Pairs 23021813
GGAAAGAAUGCUAGGUAAAGUGCAACAAGUUGCACAAAGCACUUGAACAAGUGCAAAACCUAGCAGAAGCAAUACUUCGGUAUUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
6.505good960.0880.9690.5290.92961.00791.2590.98770.74030.92931.09331.02490.18830.02570.0221-0.0372-0.00750.02210.10660.29810.8870.91760.85170.20840.12750.02920.1220.40950.78890.83161.76221.62811.38290.60670.28060.13870.10480.31480.27071.05671.53380.82940.15520.08230.00870.04580.33740.36621.47832.21551.12631.02340.51170.39520.26420.0560.01810.19950.6371.02141.29180.45250.09570.03190.0876-0.01220.03730.09790.11640.61641.32320.7910.24310.0520.0610.11680.15350.16930.57241.83850.250.43811.33630000.20960.15310.14540.1320.13330.1211
32
31AU Closing BP 2A-U Closing Base Pairs 23026565
GGAAAGAAUCAUGUGUAACGUACAAGAAAUUGUACAACGUACUUGGAAAAGUACAAAACACAUGAAAAGCGACACUUCGGUGUCGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.382
medium
93.30.0690.7630.4160.36450.95720.82740.89350.55531.11550.96681.02890.21990.07320.02440.024400.02440.05690.5131.01010.61450.48490.09450.00580.02360.00580.07070.14120.17780.72180.64710.77530.23260.09690.10820.13070.05520.23780.97420.35030.39870.11060.13250.08830.0470.22990.39021.62110.51230.90130.90680.4650.12510.15940.06620.08270.10320.91931.23711.51310.56990.1492-0.00370.03340.07610.03510.17280.84651.26321.16011.62460.60810.19470.07240.10840.10830.07210.35611.00870.45930.2990.43740000.32910.23630.21030.21390.170.1967
33
32Attempt 1A-U Closing Base Pairs 23026791
GGAAAUAAUUAUAUAUAAAAUAUAAGAAAUUAUAUAAAAUAAUUGAUAAAUUAUAGAAUAUAUAAAUAGAAUUAUUUCGAUAAUUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
1.686
medium
89.30.1361.5010.8191.57551.57890.67151.15950.98260.60950.32330.641800.7950.23780.47310.39250.46840.72561.16841.00430.69741.17950.58580.29190.43570.1450.37520.71421.26691.65710.62040.81310.13530.3380.46811.12231.85220.30041.10190.92260.78951.83080.2860.12120.60180.2006-0.19813.70113.44491.05011.63431.80910.73170.3087-0.0860.61090.40540.80541.86270.39040.67790.19330.48050.38270.47571.03421.29671.45722.21891.90991.02950.68090.67570.42030.16780.16750.25050.66280.9830.65050.64571.50690000.96040.71520.54270.63680.60.6622
34
33Attempt 2A-U Closing Base Pairs 23026799
GGAAAUAAUUAUAUGUAAAACAUAAGAAAUUAUGUAAAACAAUUGAUAAAUUGUAGAACAUAUAAAUAGUAUUAUUUCGAUAAUACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.498
medium
920.1121.2270.6691.33451.16261.31051.21610.82411.02421.31411.0970.39610.18020.06150.03940.10070.15720.17840.73821.13131.05370.93520.37270.32180.14830.05560.03080.27070.41460.8981.01260.67670.21320.08530.21230.12010.25820.89531.55051.59491.12690.42330.09560.1860.17470.36980.71192.87822.39761.95621.48271.14790.15990.04410.17130.0960.66010.7381.86271.37580.37360.34230.15730.05070.28880.46790.82140.9161.35461.59291.44410.45550.26680.2660.08940.24080.11280.64411.53710.41950.76241.17460000.42720.34680.31980.27380.28980.2523
35
34Attempt 3A-U Closing Base Pairs 23026804
GGAAAUAAUUAUAUGUAAAGCAUAAGAAAUUAUGUAAAGCAAUUGAUAAAUUGUAGAACAUAUAAAUAGUAUAAUUUCGAUUAUACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.874
medium
920.1091.20.6540.56091.15941.0560.9951.48651.63470.88851.12280.27320.26410.2387-0.11130.03290.09860.29480.64471.02271.01090.67740.20330.04610.03140.03040.18650.09370.55850.9210.48840.90630.3310.04230.0901-0.03570.17170.44251.47351.02110.94660.43550.12290.12920.09190.32540.63122.29593.13082.08181.74051.1260.39350.09830.09960.08450.73810.6891.68151.41870.71220.08740.34240.15770.24980.20180.60450.78311.61241.52161.88790.67640.12470.1660.16560.28890.18530.55251.44880.18670.68881.44730000.33250.31340.23520.24710.30280.2743
36
35Fiskers A-U closing base pairs 2 D1A-U Closing Base Pairs 23027766
GGAAAUAAUGUACUGUAAAGUCGAAAAAAUUCGACAAAGAUGUUAAAAAACAUCAAAACAGUACAAAAGUCAGUCUUCGGACUGACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.137
medium
89.30.11.1030.6010.62641.19050.99610.94891.1130.76380.7711.13460.17950.08280.1240.12380.082500.12350.49120.68170.88241.27280.03950.03950.11820.09630.74031.59371.61122.47141.73731.49511.22740.344500.06880.03440.11170.68651.33840.6390.19870.06620.03310.10681.54380.57262.70651.62341.2541.27520.86130.2780.0828-0.2170.08760.19310.88121.26360.870.26680.22310.08360.08350.07030.18080.01460.7410.89391.44041.45570.32010.23420.0260.00980.08750.23290.48891.11760.61230.21370.18810000.42510.35130.33430.28970.27030.2332
37
36Fiskers A-U closing basepair 2 D2A-U Closing Base Pairs 23027795
GGAAAUAAUGUACUGUAAAGUCGAAGAAAUUCGACAAAGAUGUUGAAAAACAUCAAAACAGUACAAAAGUCUCACUUCGGUGAGACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.299
medium
94.70.0660.7270.3960.69241.15850.93330.94561.0650.8370.58631.02690.23280.04650.01430.0310.04650.07740.1390.44570.83990.84971.20870.16280.02960.01480.01480.04440.19510.35440.77910.51570.50790.172400.0430.0430.04290.14770.91561.31730.55270.20680.06890.09630.08250.07320.26450.57790.83720.3870.45210.51520.19810.14250.04460.0920.26640.8781.56971.20910.53640.08020.03040.04980.10480.07280.24740.40620.70510.92951.14370.27310.09490.0830.05920.12190.07090.30951.13810.62260.58980.80190000.26350.17960.17120.16410.18220.1562
38
37Fiskers A-U closing basepair 2 D3A-U Closing Base Pairs 23027798
GGAAAUAAUCUACUGUAAAGAGCAAGAAAUUGCUCAAAGUAGUUGAAAAACUACAAAACAGUAGAAAAGUCUGUCUUCGGACAGACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.651
medium
94.70.0680.7450.4060.00131.27051.08540.95371.31670.9820.80810.87760.1317-0.05430.0376-0.00840.01460.03340.14990.73430.70021.19830.55050.12620.090.10790.0090.06890.2270.35990.82780.88070.56210.12220.06930.08660.0519-0.01120.14390.89921.22210.93240.182800.07470.04150.18210.37920.77340.64610.56130.60810.47480.13240.0310.03170.06340.18990.91421.33061.05440.31820.18150.01510.07550.09050.0890.05970.38740.67830.99891.14480.4640.09080.03340.05730.12610.16140.54240.87950.65820.86750.55150000.33610.24560.1940.18520.21610.1973
39
38AU changes of Base Pairs 3A-U Closing Base Pairs 23031788
GGAAAAUCUGAUAUAUACAAUAUAAUAUAUUAUAUAAAUAUAUUAAAUAAUAUAACAAUAUAUCAAAACAUGGCGUUCGCGUUAUGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
2.264
medium
74.70.1131.2440.6791.0121.3151.13650.72670.48191.12470.33610.1210.11140.148300.14810.07400.33160.54910.7980.79080.58781.05660.49030.98140.61800.27380.13670.06830.1364-0.05680.30551.40272.58191.23541.49681.77961.47950.29610.35910.23870.23810.29030.34720.2350.51760.8091.10312.09120.92611.32741.66080.95671.87881.19991.7371.61931.10320.71360.52020.14160.28240.2347-0.04110.0640.09320.9831.33111.14461.19090.56970.47940.21730.260.43130.47180.47891.21830.49970.66450.3280000.56170.52630.5060.33670.38450.3864
40
39AUCBP2 - 1A-U Closing Base Pairs 23033176
GGAAAGAAUCGAUAGUAACGUAGAAGAAAUUCUACAAACUAGUUGGAAAACUAGAAAACUAUCGAAAAGAAUUACUUCGGUAAUUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.173
medium
97.30.0720.7930.4330.22941.47311.3240.98470.72341.29810.92120.91040.08270.05510.05510.02750.027500.10990.35491.13180.46960.6237-0.05530.079800.05320.02660.15920.21171.05090.45050.65360.27890.02570.05140.15380.02560.04721.19491.47250.4280.049400.02470.02470.09860.16391.49060.77861.06851.25130.80.2610.12870.09180.27650.38531.52611.27191.87740.32070.1920.0305-0.1027-0.05720.13630.28520.43621.11921.41190.90850.28290.22030.08570.19940.17910.07950.17860.68910.25520.23490.48670000.33750.26750.27010.20550.2550.2265
41
40kcab - AU Closing Base Pairs V2.1A-U Closing Base Pairs 23035609
GGAAAGAAUGCAACGUAAAGUGCAAGAAAUUGCACAAAGUGCUUGAGAAAGCACAAAACGUUGCAAAAGCACGUGUUCGCACGUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.13good97.30.080.8780.4790.87610.99691.39210.96670.5521.09560.99961.13220.35240.0150.05250.01770.05990.05980.1990.36891.07360.89220.85660.18640.0430.0430.0014-0.01140.23450.28920.780.76850.61050.30420.11050.05980.01880.03680.10131.04441.47391.10720.1710.06570.01310.03940.18130.43032.28681.10470.48360.76960.47280.08480.05720.05310.12630.19520.78581.66811.24970.30250.15870.01940.0348-0.04220.11570.0250.5450.91911.37851.39030.27970.12030.06560.06620.180.21720.67871.62190.60791.23840.7720000.25760.17360.18280.16250.14850.1626
42
41kcab - AU Closing Base Pairs V2.2A-U Closing Base Pairs 23035617
GGAAAGAAUGCAACGUAAGACGCAAGAAAUUGCGUAAGACGCUUGAGAAAGCGUAAGACGUUGCAAAAGCAUCAGUUCGCUGAUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
7.831good920.0870.9560.5210.96931.18861.74481.32440.97750.94410.99921.46250.38160.04350.00210.04360.0580.01040.09510.71751.05870.72551.24410.22370.01710.01710.07880.09050.25510.47731.11890.6370.63730.33510.08190.02770.04780.15560.73691.47480.88951.19170.31130.02820.01410.06390.22510.38162.31571.30210.71161.04080.68930.20720.04390.05790.09450.59981.59071.00941.24650.52420.12930.03690.06160.20010.12830.06730.62031.11241.17581.1230.22090.09580.05520.07130.04550.12910.37451.42920.49730.98120.83730000.19250.13420.14090.12660.12130.0996
43
42kcab - AU Closing Base Pairs V2.3A-U Closing Base Pairs 23035625
GGAAAGAAUGCAACGUAAAACGCAAGAAAUUGCGUAAAACGCUUGAGAAAGCGUAAAACGUUGCAAAAGCAUGUGUUCGCACAUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
8.105good920.0790.8680.4740.95831.0821.42431.09350.67851.00371.18051.0620.35980.00720.04750.00720.02710.02040.12120.60690.83370.92040.84920.18010.03440.01290.02120.09310.29340.36630.85090.42180.56120.2070.07540.02510.03770.180.55840.98870.91010.93450.23820.0720.0240.02170.11280.46032.16741.21660.49160.85060.60950.23580.03080.04640.13910.52341.07431.13931.0560.28050.10260.02320.0819-0.00720.0980.22610.5321.08271.25981.1530.28580.08180.04250.1580.14210.16780.68151.92990.46310.64251.0950000.16590.11420.11770.10550.09430.0993
44
43fast and looseA-U Closing Base Pairs 23036452
GGAAAGAAUUUAUGGUAAACGAUAAGAAAUUAUUGAAACGUAUUGGAAAAUAUGAAAACUAUAGAAAACUAUAGCUUCGGUUAUGGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.163good82.70.131.4340.7821.27860.89631.12680.93980.780.84721.31611.41070.78670.5530.74810.7810.28810.4180.88930.67871.02851.15390.3020.26630.33030.74310.34850.55240.6470.79171.15170.99761.10730.79970.46660.60040.79790.60050.47751.14051.20780.49160.32210.52180.42630.62430.61190.43011.25491.1541.34871.25160.78570.930.69360.98870.99380.83841.29241.31851.60341.04080.30030.33780.63280.58130.60351.19761.58041.42411.28081.22240.33380.14260.05950.06090.21050.2170.9531.55480.37450.6561.01970000.31380.21980.22140.19580.18160.2023
45
44Nanny Pairs 2A-U Closing Base Pairs 23037278
GGAAAGAAUGUAGUGUAAAGUGGAAGAAAUUCCACAAAGUAGUUGGAAAACUACAAAACACUACAAAAGAGAGACUUCGGUCUCUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.233
medium
94.70.0750.8240.450.48991.00381.35530.71440.69020.903710.9440.21850.00120.03880.00240.04540.01140.16320.4510.91030.87671.08970.13060.008700.00969.00E-040.32980.38510.97750.53080.44660.18500.03360.05040.05880.12280.80781.04951.06240.3090.11810.09650.04820.16220.23981.5370.5031.01350.87510.80590.14070.02260.04940.11650.28060.69921.54851.0110.37210.204-0.01930.0520.16950.20740.31570.82191.10911.00680.74870.18840.06720.04030.05370.32110.07360.61041.70010.47180.55871.50820000.23430.18610.19490.13990.1520.1525
46
45TeenonA-U Closing Base Pairs 23037396
GGAAAAUAUAUACGCUAAACAUCAAUGAUUUGAUGGACCUACUUGAAGAAGUAGAAGAGCGUAUAAAACUUUGGGUUCGCCCGAAGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.804good920.0971.0690.5831.11420.99921.37751.39670.40961.29890.48051.46860.27210.20760.0460.079700.01590.05480.5381.35910.95060.56640.09630.0762-0.00950.01140.36381.35261.79383.29572.37272.0571.0860.28180.10770.04070.07110.06090.89560.84010.10220.05110.01360.0510.07650.1450.81081.05611.26270.46951.9090.58460.24770.13210.0240.06130.37231.1071.38141.76210.51360.16980.16950.14190.11990.15540.2710.92851.43291.14130.96710.15270.17380.10850.14270.10810.05090.17260.94460.28520.71040.71330000.27520.18410.17890.17180.12040.176
47
46SpandaA-U Closing Base Pairs 23038282
GGAAAAGAUAUAUAUUAAAAUAUAAGAAAUUAUAUAAAUAUAUUAAAGAAUAUAAUAAAUAUAUAAAAUUGUGACUUCGGUUACGGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
1.848
medium
800.1531.6780.9160.45221.12811.87291.20850.41061.40090.15540.6171-0.037700.15370.3064-0.03830.20340.69011.67862.51731.55411.25320.55350.08540.41180.40990.61050.87310.46762.150.77490.6728-0.03010.15960.28630.56730.50170.86920.86070.79190.4846-0.07570.24080.24011.06740.82242.62092.86541.19571.41221.5891.50081.73750.72890.7880.82931.39221.87222.49861.38590.79740.86440.95231.94680.92120.97131.19741.75320.54962.4121.31730.92820.94910.14570.1810.79060.64210.5671.73670.3460.55010.88480000.7150.74010.78190.68030.52780.6516
48
47Changes in kcalA-U Closing Base Pairs 23040918
GGAAAGCGUGAUAUAUGCAAUACAAUAUAUUGUGUAAAUAUGUUAAAUAAUAUAACGAUAUAUCAAAAGUUAACGUUCGCGUUAACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.509
medium
70.70.1131.2460.6791.09310.74131.18980.71541.18910.28990.35660.39730.33680.58361.58240.20620.7510.62120.51540.50070.81210.44430.79011.36111.07891.04581.03420.14690.40240.58520.2270.11230.16150.11170.47050.42920.55311.26941.28880.84220.59390.41090.35930.53560.56180.75231.17591.340.94921.3421.3340.94940.99871.39891.2951.01940.86970.81020.62650.29010.40870.54620.45230.46590.2180.41720.62060.75951.00241.05581.25081.6020.39240.24820.11660.18010.09270.06180.44510.87960.46810.71920.44710000.32110.18790.20670.18370.20410.1184
49
48Mod of nihilnoves V. 2A-U Closing Base Pairs 23041036
GGAAAUAAUCUGCAGUAACGAGCAAGAAAUUGCUCAACGCUCUUGGAAAAGAGCAAAACUGCAGAAACGCGACUCUUCGGAGUCGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
2.697
medium
960.0620.6780.371.13830.98251.02951.15981.28850.99760.90150.8510.241-0.05790.080300.0267-0.05780.00890.58821.09150.24960.33740.0519-0.00570-0.03440.07480.30940.44890.79630.65170.58460.22980.18690.0498000.1910.81190.56220.34090.12160.02430.02430.12130.0880.15720.95681.5161.01060.57650.32170.16050.0916-0.3079-0.1590.25080.77591.23281.14530.58890.15240.087-0.01330.06520.030.04340.46080.90290.73580.82680.27130.02680.10410.12470.22810.06220.18611.06210.32560.2840.62430000.38450.30250.2670.21740.30250.2015
50
49Mod of Hyphemas Stack StrengthA-U Closing Base Pairs 23041067
GGAAAUAAUCUCGAGUAACGUCGAAGAAAUUCGGCAACGUGGUUGGAAAACCGCAAAACUCGAGAAACGCGUCUCUUCGGAGACGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
2.791
medium
960.050.5530.3020.9150.70561.24670.9110.66740.5210.8640.94190.13760.0229000.09160.02290.04580.29270.71560.21570.38770.0299000.0672-0.04630.2010.32260.69160.59640.25850.21790.04360.02860.0313-0.02440.1130.37130.50090.55460.14910.21240.10610.02120.04950.24620.58071.54290.94930.78770.56190.12020.03010.040.07390.17340.47610.81821.0670.61640.09620.0961-0.02680.05760.03080.07670.34370.66320.54610.57990.29830.05590.20440.11140.11120.12960.1540.62980.37140.36380.13560000.26290.26620.22110.1980.19340.1419
51
50AU CPB2A-U Closing Base Pairs 23042577
GGAAAUAAUCUGUACUAAAGAUGAAGAGAUUCAUCAAAGCAGUUGUGAAACUGCAAAAGUACAGAAAAGACGUUCUUCGGAACGUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.328
medium
94.70.0640.7020.3830.51940.92930.97491.0611.03710.88720.80430.80820.15370.030700.00770.0601-0.00130.04830.56611.04370.86410.56190.05430.04430.04420.07370.10430.10650.50390.39260.65830.67280.29960.09970.0427-0.02690.04270.11370.70380.98270.85620.09190.01440.04130.08940.07890.5992.1130.66050.76381.04720.49150.11860.0299-0.06570.04270.21720.86661.35130.75840.49670.12630.0955-0.00460.01520.06610.12770.37630.69640.79680.78030.15830.17590.07030.03510.09040.10520.30850.8170.22990.51430.60150000.230.16330.14490.16370.1840.1519
52
51AU CPB2 no.2A-U Closing Base Pairs 23042607
GGAAAUAAUCUGUACUAAAGAUGAAGCGAUUCAUCAAAGCAGUUUAAUAACUGCAAAAGUACAGAAAAGUGCUACUUCGGUAGCGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.565good93.30.0740.810.4420.36051.09571.10230.89981.39070.70640.80561.04470.18790.0040.0121-0.02020.028200.11280.48840.94921.00230.66110.04960.05430.0233-0.01710.01940.17310.22740.10410.47060.36570.25070.13650.06820.0480.04540.06060.70140.99140.86890.18110.03290.04390.04380.31761.12852.69141.75421.08181.28810.55480.15720.0390.01930.09750.12380.7921.3911.11180.27140.13950.03510.02690.01630.13640.16650.34580.87321.11761.12590.47510.21260.07750.07960.15880.13660.3180.92640.35180.41880.80950000.20050.15090.14460.13860.16290.1192
53
52AU sub 1A-U Closing Base Pairs 23043123
GGAAAGAAUACAGCAUAAAUAGCAAGAAAUUGCUAAAGAUCAUUGAAAAAUGAUAAAAUGCUGUAAAAGUGGCACUUCGGUGCCACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
2.851
medium
90.70.0870.9520.5190.44911.24181.42741.36190.75860.84191.29221.47520.56990.20310.081200.04060.04050.24261.06491.0130.89841.02520.51130.15310.07650.15270.11440.11420.64261.08250.77690.51490.32980.10980.07310.1460.21850.48881.29590.7660.84610.32550.13930.1061-0.06760.05210.1930.46581.1870.58260.72230.18760.14380.1491-0.06810.19570.50641.4341.1721.00480.61850.21270.0310.0310.08810.21120.30770.74741.18141.2621.25110.52060.25950.23010.18180.5230.0950.91971.6490.90070.38180.82040000.42960.31710.3020.29390.30760.2743
54
53sign me upA-U Closing Base Pairs 23046297
GGAAAUAAUCGCCCGUAAAGCGGAAGAAAUUCCGCGAAGGCGUUGGAAAACGCCAAGACGGGCGAAAAGCGGGCCUUCGGGCCCGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
2.048
medium
960.0650.7130.3890.28430.99410.79131.02141.04861.45741.09470.88650.09080.06810.04540000.04230.27090.62291.29391.40330.144400000.43110.25790.7670.52010.31620.23120.021000.0210.10490.45231.26870.62640.0816-0.09330.040800.08150.31141.35931.39651.00450.68160.77110.12090-0.01690.11430.12680.84150.8520.90470.20130-0.019500.20030.01440.03240.98270.38060.92861.14580.35750.27550.13750.137300.10280.06850.68940.38140.26930.70120000.43330.36720.26160.28490.28580.3209
55
54sign me up 2A-U Closing Base Pairs 23046301
GGAAAUAAUCGCGCGUAAAGCGCAAGAAAUUGCGCGAAGCGCUUGGAAAAGCGCAAGACGCGCGAAAAGGCGCGCUUCGGCGCGCCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
2.062
medium
93.30.0640.6990.3810.9540.9981.44991.28561.46070.86220.71720.60270.109400.05470.0547000.05460.19981.05861.25561.48230.10410.10400.10380.10370.310.36020.68920.53280.35370.05050.1009000.1511-0.03040.50040.68810.83510.17160.14680.097800.19510.40461.26011.421.00050.41680.58270.13780.06120.10690.06110.22840.6350.3350.84850.488500.04440.0887-0.0722-0.06370.06040.40240.83141.70181.42290.705700.04150.08290.20680.041300.57490.24570.20430.44710000.49720.37540.35730.3380.35210.2863
56
55DibiatceA-U Closing Base Pairs 23047253
GGAAAACAUAUAUAUUAACUAGCAACGACUUGCUAAAACGCCUUGGAAAAGGCGCAAAAUAUAUAAAACUUAUCCUUCGGGAUAAGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.175good90.70.1031.1280.6151.34781.01981.3861.66751.70281.18890.17950.13070.00610.04070.10520.0060.21250.07620.32090.69191.77480.59180.49010.30930.19820.03960.10880.59040.97771.3893.35721.15161.09540.99230.2080.07050.14080.25690.73021.43641.49580.23470.10050.05860.03340.00560.08070.38811.66361.88541.09211.10090.57370.13870.02310.05770.09090.52350.54121.5841.40810.27960.26220.23540.34680.14610.35210.59891.09421.65961.39271.1840.14690.02530.01050.10510.14470.22540.42212.04540.33240.34211.1460000.32130.21210.20070.23190.23540.1862
57
56Default titleA-U Closing Base Pairs 23048969
GGAAAACAUAUCUCAUAAAGCGUAAGAAAUUACGCAAAGUGCUUGAGAAAGCACAAAAUGAGAUAAAAGAUACUGUUCGCAGUAUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.666
medium
97.30.0810.8870.4840.45931.16811.56431.2951.25350.69810.64210.99120.31140.23070.07270.07090.05310.07080.29380.48620.91320.99420.8990.03390.0169-0.0164-0.03330.05920.20250.34460.89550.67320.6280.21240.07980.03260.01630.01630.01630.74431.37840.77550.12560.01570.04710.0940.10950.48252.21070.99430.58321.01060.33050.04390.05860.0690.04180.13521.05111.7441.32150.44190.19290.00230.05140.21940.37620.30661.74661.48021.26441.09110.41770.18950.11810.12590.0880.07990.30461.49280.32630.68380.71110000.27230.20480.19410.19590.1850.1588
58
57mod of Janets mod of Hyphemas stack strengthA-U Closing Base Pairs 23050254
GGAAAUAAUCUCGAGUAACGUCGAAGAAAUUCGGCAACGUGGUUGGAAAACCGCAAAACUCGAGAAACGGGUCUCUUCGGAGACCCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.494
medium
94.70.0520.5730.3130.23630.78111.1780.82120.75090.65651.04410.9130.15190-0.031604.00E-049.00E-040.03190.37620.56310.37980.5233-3.00E-04-0.01590.06240.07790.04670.12440.24820.60080.56520.25930.18270.0147-0.03290.06080.03040.15170.56960.3850.45930.07770.05530.08910.04450.10370.2340.54411.24111.00050.93090.52710.1870.0327-0.06110.22830.12920.61961.28491.08630.45080.06690.0268-0.00670.11340.04880.02880.25440.80550.6990.4680.31640.00760.01290.07740.06440.05150.25010.81280.27690.610.35010000.26920.17080.17890.15020.20350.1379
59
58mod of rnjensenA-U Closing Base Pairs 23050340
GGAAAGAAUGCUAGGUAAAGUGCAAGAAAUUGCACAAAGCACUUGAACAAGUGCAAAACCUAGCAAAAGGAAUCCUUCGGGAUUCCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.709
medium
960.0750.830.4530.81880.96461.46360.92631.16860.9280.80361.32850.32730.01720.04650.03610.05160.08240.12860.43760.72130.68070.95490.07510.01490.074400.08180.14890.43570.93750.60450.72110.22950.05680.0430.06380.06430.11360.80271.0170.83140.07820.05520.04140.07650.2290.36031.93961.75910.86090.89890.34990.18890.02820.06360.07620.16740.96921.5021.13610.47130.08450.0664-0.0158-0.1109-0.00250.11020.73171.1381.42241.14790.26060.21480.09540.14650.16870.08670.1811.23410.62860.78170.16260000.24720.17850.18370.17680.18760.1582
60
59second cutA-U Closing Base Pairs 23050554
GGAAAGAAUCACAUGUAAAGAUCAAGAAAUUGAUCAAACUAGUUGAGAAACUAGAAAACAUGUGAAAACUACGACUUCGGUCGUAGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.197
medium
960.0720.7950.4330.6551.06130.87581.02350.49061.10640.96491.00380.1690.04970.0338-0.0719-9.00E-04-0.01770.09260.51031.21861.0460.46150.03240.097-0.018400.08080.11290.28690.86970.61560.5440.27380.04690.03130.09370.03640.21971.11211.11470.47970.0452-0.03440.09030.06010.07510.2921.80360.78470.65620.9160.48510.15850.04250.05660.04420.36761.25831.18430.86940.41410.24640.13340.0515-0.00930.09310.13840.99820.7791.20491.43450.4070.26220.12470.08720.16480.10250.41041.33310.47940.18291.07380000.29590.19570.16450.16260.16350.1726
61
60third time is a charmA-U Closing Base Pairs 23050564
GGAAAGAAUGACUAGUAAACAUGAAGAAAUUCAUGAAAGUACUUAAAGAAGUACAAAACUAGUCAAAACUACGUCUUCGGACGUAGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.163
medium
94.70.0971.070.5841.10441.17281.53551.22710.81370.8831.29351.36560.33310.08320.0554-0.0141-0.041800.16590.44460.76771.15420.39520.393-0.0417-0.0151-0.015100.28280.46590.82730.64820.74550.14750.10240.02560.02560.03510.26771.08661.78821.07660.06480.12130.07960.23750.7843.44262.96251.81141.06271.85380.83760.42370.19590.10270.26680.26541.0891.68261.3610.40440.17410.1737-0.06590.09630.1510.15350.63481.31141.77171.06180.3420.06180.17930.04860.17880.07150.20841.19480.35580.42370.45610000.36670.22290.27690.2230.18760.2093
62
61A bit different 2A-U Closing Base Pairs 23058500
GGAAAGAGUGUCGCAUAAAGCGAAAGAAAUUUCGUAAGAGUCUUGAAAAAGGCUAAAAUGUGACAAAAUGACACAUUCGUGUGUCGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
6.554good93.30.0790.8740.4770.34761.06321.24310.78760.63470.64650.93470.64870.32420.11770.01960.03920.02940.05880.21950.5471.15320.80630.89150.21520.04680.03740.05610.11990.2620.38720.64740.80640.42550.24280.16160.0990.0360.19120.44791.22741.04950.61190.32330.11020.13690.05280.08120.34730.98890.85320.43210.61740.45260.1020.09790.03260.09230.78171.75871.72751.24510.41840.250.11020.11330.06560.18820.27010.87531.0981.5021.41610.66050.20330.09720.19210.08190.09660.61220.86940.36130.98810.92820000.19650.14320.12970.10750.09870.099
63
62A-UClosing_01A-U Closing Base Pairs 23061991
GGAAAGAAUUAUAUAUAAAAUUUAAGAAAUUGGGUAGAAGUGUUGAAGAAUAUUGAAAUGUGUGAGAAAGGGUUAUUCGUAAUUUUAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.06good66.70.2322.5551.3941.53261.15711.2741.45070.97721.21961.23291.42770.33781.15810.46481.45112.26591.34772.75621.64372.0031.58241.66231.72640.77781.75882.35511.99621.01791.83921.90461.88310.51491.26170.53070.57171.5061.6231.92111.04921.81891.71981.41551.20450.38560.49110.38160.15890.56712.1751.41831.76332.92361.81791.34442.1882.34330.9291.76921.6251.23931.58521.10541.50991.43831.71181.03741.67051.20461.08342.19781.55680.62620.7281.22441.79781.77670.90891.64391.45290.58150.83381.3980000.49740.3930.36080.38410.34120.3455
64
63Rule Violations 1A-U Closing Base Pairs 23065780
GGAAAUAAUCAGCAGUAAAGCGCAAGAAAUUGCGCAAAGGGGUUGAAAAACCCCAAAACUGCUGAAAAGCAUUAGUUCGCUAAUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.098good93.30.0590.6520.3560.65961.21291.17610.96710.99051.06470.77230.80580.15730.04240.06350.03180.02120.04230.15310.41270.55440.80270.52740.0240.03080.0079-0.02290.0820.18760.2050.82720.50250.29550.1820.06490.00710.01330.05320.12280.6591.04660.45920.048500.0194-0.00680.06950.13280.56860.76570.51650.54460.42050.05910.056-0.01030.05280.14170.78711.07911.05650.33150.0448-7.00E-040.05370.03980.03490.13280.4530.73441.21741.32330.40020.09310.10160.16590.22440.25890.35821.33990.33740.74130.74630000.20440.15010.14390.13390.14190.1278
65
64Rule Violations 2A-U Closing Base Pairs 23065803
GGAAAUAAUCUAUAGUAAAGCGCAAGAAAUUGCGCAAAGGGGUUGAAAAACCCCAAAACUAUAGAAAAGCAUAAGUUCGCUUAUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.306
medium
960.0680.7450.4070.99851.09841.05521.04641.56880.77060.82491.15420.26760.02420.04960.09660.04830.04820.07340.61040.9810.5390.99620.0463-0.04690.02320.02310.05780.25370.24051.03370.51570.30010.17590.033700.02240.04490.22380.92981.02090.45660.043500-0.00340.12660.34550.65360.84880.7330.67510.3190.12460.04150.02080.06720.04640.58621.2071.27920.43750.1192-0.03390.03970.01280.04530.12670.73431.10631.35511.57480.28770.16670.10150.18460.20250.24790.34751.16380.33250.66460.67190000.28420.25380.22910.19520.29040.1699
66
65Rule Violations 3A-U Closing Base Pairs 23065812
GGAAAUAAUCUAUAGUAAAGCGCAAGAAAUUGCGCAAACCCCUUGAAAAAGGGGAAAACUAUAGAAAAGCAUGAGUUCGCUCAUGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.492
medium
94.70.0540.5890.3210.61490.97441.09270.97051.11050.79040.88650.95660.16490.03470.08530.01730.08650.01660.08140.47410.77650.63320.5960.08390.01680.016800.05030.14780.26970.72460.51220.42790.07630.0490.0326-0.0359-0.03590.14670.72720.89570.07990.03190.0160.0160.03190.00130.38650.57330.60070.60180.45930.2470.06170.02580.02570.08040.30460.85730.87570.7680.3110.06040.08870.07380.0380.05490.02320.46190.81191.03460.9450.28230.13340.04930.03520.08430.11230.22870.79550.38320.66980.48350000.25690.19570.17780.16960.16320.1662
67
66The CloserA-U Closing Base Pairs 23066081
GGAAAGAAUCGAUCGUAAAGCAGAAGAAAUUCUGCAAAGCUCUUGAGAAAGAGCAAAACGAUCGAAAAGGAGAUCUUCGGAUCUCCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.768
medium
960.0740.8140.4440.82451.12251.31770.95750.76820.93190.84690.9620.11890.007400.0891000.17780.28790.96360.81360.82930.1500.02140.050.09270.32680.28320.81370.57840.7530.16520.02070.04130.02070.00680.16130.60940.95620.58030.09020.060100.090.21450.43981.73390.97420.39861.04280.41610.1158-0.02640.03370.08430.17760.97970.97781.12750.11010.0360.0539-0.20580.19660.32060.37290.72581.06381.89811.22130.66320.14110.13220.19780.25480.25111.02511.36590.55380.59540.73980000.31250.21870.20430.19490.21950.1737
68
67coinutah Changes in Kcal Mod A-U Closing Base Pairs 23066348
GGAAAAAAUGAGAUGUAAAGCACAAGAAAUUGUGCAAGACUCUUGAAAAAGAGUAAGACAUCUCAAAAGUGGACGUUCGCGUCCACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.452
medium
94.70.070.7730.4221.73850.61041.59241.02060.77141.00650.83840.66880.24490.09810.00480.04660.1086-0.01670.18050.42831.4151.03450.89070.05950.04430.0443-0.00520.08310.1960.48480.7630.55430.63360.22810.0570.05690.02850.05690.15381.16960.85491.2750.33970.0680.0272-0.01110.01490.44320.71350.79240.83250.65490.36280.08450.12060.04340.02830.56831.02340.84061.66420.30190.07340.06110.0170.0610.10970.07770.40870.94630.95530.79130.27270.08560.07390.06990.09310.09610.46831.26320.4080.92420.97470000.23560.14140.19110.16060.16060.146
69
68BequsoveA-U Closing Base Pairs 23067289
GGAAAAAAUCUAUUUUAAAACCCAAAAAAUUGGGUAAAUUUUUUAAAAAAAAAAAAAAAAAUAGAAAAGUUAUGUUUCGACAUAACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
1.666
medium
880.0941.0290.5610.66831.18412.74260.93720.78221.15771.09550.89570.09420.1880.28100.0936-0.0940.55440.73040.90750.63070.62610.17850.089200.44360.35340.61422.76122.1142.06392.09341.245900.15550.23260.27050.32591.23750.69970.59370.35680.48940.2440.24330.60420.1327-0.01610.02410.09620.09610.0720.0720.07190.07180.07180.28620.28520.51981.21150.37120.34660.34520.34390.20580.40980.4260.53921.66321.26771.43850.19140.13430.01420.25240.06310.0630.56341.95830.36561.14271.52760000.88430.48960.65040.44440.41880.4699
70
69DiesisraA-U Closing Base Pairs 23067296
GGAAAAAAUCUAUUUUAAAACCCAAAAAAUUGGGUAAAUUUUUUAAAAAAAAAAAAAAAAAUAGAAAAGUUCUGUUUCGACAGAACAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
1.973
medium
880.1061.1630.6341.66750.57881.35561.40681.97141.06371.2581.52130.37870.09460.18870.14190.18770.18730.140.92360.95460.81320.71690.3570.089200.26660.311.25472.86572.97152.63181.23241.4040.1910.07640.07630.27880.62281.61170.81360.9620.1450.41470.41270.57050.60210.28240.28150.21060.07010.07010.140.06990.06990.06970.06960.34680.20760.82261.34970.53660.20080.39970.06660.33150.32250.2631.00751.17341.94041.63950.30550.0611-0.07750.12190.12170.18220.78231.30410.47160.64370.92640000.84640.47380.61640.50010.560.4442
71
70All Done!!A-U Closing Base Pairs 23067300
GGAAAAAAUCUAUUCUAAAACCCAAAAAAUUGGGUAAAUUUUUUAAAAAAAAAAAAAAGAAUAGAAAAGUUCUGUUUCGACAGAGCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
2.515
medium
85.30.0921.0130.5521.01010.68541.37081.19770.27470.78110.75130.74490.05320.159200.0530.1060.05290.10581.14820.74220.93751.1420.31810.05020.05020.08220.48971.29191.77042.21722.27351.7831.160.19050.04390.14250.38211.00361.69490.84450.83640.21860.34990.16190.72220.49870.12710.12070.12060.12040.12020.04010.080.15980.17480.91990.66420.88950.84261.17130.51640.21530.18660.17660.09240.36940.33920.51881.36541.01220.87890.43720.3484-0.01380.03480.00360.22540.44521.51820.34820.25260.96270000.45140.34570.38140.32340.34910.3196
72
71Spanda finalA-U Closing Base Pairs 23068000
GGAAAAGAUCUGUGGUAAAGCGGAAGAAAUUUUGCAAACGGGUUAAAGAACUUGGAAACUAUGGAAAAUUGGUUCUUCGGAAUCGGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
7.682good82.70.1271.4020.7650.87991.11791.23010.80140.90090.36990.54820.54220.44520.17070.19090.46430.25410.76731.24560.94861.24720.78491.21360.6660.10120.4570.36610.47660.72350.40830.84251.01860.57620.54990.42910.56030.72490.33340.24880.76491.7560.4985-0.01080.12250.32850.43580.45551.69062.07861.7420.81411.51171.28230.52420.36340.74120.38370.58061.08231.71691.75230.80580.58521.47151.76670.69011.04551.33821.43621.42281.3531.15611.16970.45340.58470.49190.49090.15580.09130.51980.21410.37510.54150000.17650.14760.14650.12820.13470.0884
73
72A-U CBP 2.2 - Brourd - Lab A-U Closing base pairs 2 R1 - Sub 2 (Flip 2)A-U Closing Base Pairs 23070295
GGAAAUAAUGUCGAGUAAAGUCCAAGAAAUUGGACAAAGCUCUUGAAAAAGAGCAAAACUCGACAAAACAGAUGCUUCGGCAUCUGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.57
medium
93.30.0510.5610.3061.03220.89860.84141.00770.93420.68490.66340.57470.35390.11930.01560.01560.02080.05190.00490.40780.8770.65130.53520.02910.03020.01510.01510.04410.10420.23260.6160.44240.43280.0884-0.00180.029500.04420.12250.81310.87430.38740.07170.028700.00930.10250.35430.42820.81290.38990.36560.30940.10840.0484-0.0520.00680.05850.70360.97780.8160.2970.10670.01330.02670.10170.09920.08160.42620.77270.87190.95760.16570.06540.15240.06350.12680.08860.23990.87510.53390.62860.4350000.22960.17480.15790.14760.17990.1378
74
73A-U CBP 2.1 - Brourd - Lab A-U Closing base pairs 2 R1 - Sub 1 (Flip 1)A-U Closing Base Pairs 23070299
GGAAAUAAUCUCGACUAAAGUCGAAGAAAUUCGACAAAGCUGUUGAAAAACAGCAAAAGUCGAGAAAACUGAUGCUUCGGCAUCAGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.023
medium
93.30.0540.5890.3210.82670.91211.20211.04091.07210.8540.69970.67190.22490.06590.034900.0465-0.01710.09280.51880.9240.73520.84020.02680.0448-0.01790.02240.08940.22280.1890.5890.31180.39040.17480.04370-0.04030.02180.06550.41860.77660.55530.0214-0.01880.08530.04260.12060.35330.42540.45430.27170.6020.22890.04140.05170.05160.04130.21380.60991.03680.73080.35890.11910.06960.03980.1290.07890.11820.33430.76170.77430.71030.13420.11490.01740.13370.09160.3040.44421.5250.40630.38610.92770000.30830.19660.21530.20320.23030.1709
75
74Oh Pair!A-U Closing Base Pairs 23070737
GGAAAGAAUCUCGAGUAAAGUCGAAGAAAUUCGGCAAAGGAGUUGGAAAACUCCAAGACUCGAGAAAAGAGGCUCUUCGGAGCCUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.889
medium
920.0690.7580.4140.60821.15361.22110.99310.56541.07350.71710.83360.15150.02060.02060.0206-0.01340.00710.08230.41620.90630.76541.0370.12530.05930.03950.04500.20190.20150.95740.43170.4010.19840.05760.01920.05750.00640.12130.48551.01680.35250.0747-0.03620.11190.01280.08690.3831.19341.18830.94010.89450.74560.19760.0127-0.02680.04060.03690.56720.7511.2210.50350.184200.03350.11640.14970.05760.63541.04961.2471.52710.42820.20840.16120.10910.03110.06230.69992.02170.34680.50351.090000.25690.21660.20630.18320.16870.1747
76
75-55.8 kcalA-U Closing Base Pairs 23077262
GGAAAGAGUCGCGCGUAACGCGCAAGAAAUUGCGCAACGCGCUUGGAAAAGCGCAAGACGCGCGAAAAGGCCGCCUUCGGGCGGUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
1.641
medium
94.70.0570.630.3430.08210.99191.05661.10130.63290.59290.53011.00590.11160.11150.11130.11120.05560.05550.13860.22120.96280.70430.1140.108000.00580.21510.21960.16040.84740.57870.57490.26050.10410.052-0.101800.0780.46520.69220.40780.10180.1525000.16910.14290.89051.51850.97080.55470.18450.32760.08780.04790.09560.09550.91380.81171.21590.2762-0.0093-0.05510.27490.1372-0.05530.36420.4420.67340.93260.83570.3369-0.0132-0.01320.13080.34750.21660.12980.85680.7060.42240.16860000.5670.3880.32450.32720.26880.3667
77
76ArtheiqtA-U Closing Base Pairs 23080380
GGAAAAAAUCAGAGCUAAAGUGUAAGAAAUUACACAAAGUGCUUGAAAAAGCACAAAAGCUCUGAAAACUUAGAGUUCGCUCUAAGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.883
medium
94.70.0690.7580.4130.99180.80871.68441.61681.12710.92840.84760.97450.20790.07660.02010.04020.060200.10020.47751.12131.07831.25420.05510.03820.03820.05730.06680.36110.34730.96360.68780.3850.22090.05150.03680.16510.12820.04411.03641.07931.06540.12310.03520.06150.09650.12260.43311.10970.56830.3440.64210.28070.08740.05030.06710.01560.33940.84841.23021.14130.45530.09580.07980.01590.04780.01590.1670.42180.91051.13570.68190.22720.06670.04580.12180.09130.18750.40781.35680.41410.80210.51690000.32610.18940.23780.210.19470.1641
78
77GhainturA-U Closing Base Pairs 23080388
GGAAAACAUCAGAGCUAAAGUGUAAGAAAUUACACAAAGUGCUUGGAAAAGCACAAAAGCUCUGAAAACUUAGUGUUCGCACUAAGAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
5.41good94.70.0680.7510.4090.91130.77781.25441.18521.23550.52220.38320.74130.03870.04390.03430.04580.080.02290.07230.44680.85790.77331.0820.13530.0475-0.00770.02190.1950.31420.30620.98010.64270.53160.22040.14750.03160.05530.0040.16870.99231.14730.81030.15510.07880.05050.05050.06890.31812.0760.69941.09130.90260.4380.12870.03770.09080.06720.15930.85551.11520.86680.60830.13490.04070.01370.07180.04530.20140.61691.16560.91411.07780.19190.03240.0680.06790.05940.12710.2311.28510.29320.47870.59830000.21930.1480.14330.14720.14040.1016
79
78AU Closing 1A-U Closing Base Pairs 23085673
GGAAAGAAUCUAGACUGAAGUUCAAGAAAUUGAACACAGACGUUGAGAAACGUCAUAAGUCUAGAAAAGACAGUAUUCGUACUGUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
4.656
medium
94.70.0680.7510.410.43790.97781.14480.98370.94481.18930.88081.02760.1386-0.00260.013900.01390.04150.02770.12440.39220.54070.86920.13510.06750.04050.05390.10770.1680.27240.74160.61760.6480.2740.07820.0130.03910.03330.1350.7780.45890.55240.06010.06970.038-0.01750.07380.24731.73510.64380.46350.76970.57650.11190.03380.05770.11160.1290.89781.00750.70030.33870.07350.0460.04030.1020.15030.29670.81741.33861.27241.18310.41990.21030.18850.10150.11390.19450.6211.45610.32750.69541.58650000.25610.1640.15860.15630.14620.1647
80
79A-U ClosingA-U Closing Base Pairs 23095443
GGAAAUAGUUUAAUCUAAAAUACAAGAGAUUGUAUAAAGGUAUUGAGAAAUAUCAAGAGAUUGGAAAAGAAAGGAUUCGUUUUUUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
3.671
medium
81.30.1071.1750.6410.54460.77961.37111.08370.99541.27461.05110.93320.76581.18071.16490.89860.82290.35730.18350.54710.73340.45740.87331.0860.13540.1590.01980.12690.25310.65940.46850.63041.05170.57460.09110.12140.19830.33150.30040.57760.5740.49510.20570.11720.10260.17510.11660.44391.82450.45930.76660.80260.7110.40960.37160.45080.10950.26920.67950.76631.01850.93011.7470.62840.23880.23771.01110.95620.84950.6121.02020.91510.58630.5530.57990.50820.59690.85010.95141.45730.43271.80120.72840000.33430.25610.28360.26870.25970.2701
81
80A-U CBP 2 V2A-U Closing Base Pairs 23100971
GGAAAGAAUCUGGACUAAAGUGCAAGAAAUUGCACAAAGGAGUUGGAAAACUCCAAGAGUCCAGAAAAGAGCCUCUUCGGAGGCUCAAAAGAAACAACAACAACAAC
........((((((((...((((((....))))))...((((((....))))))...))))))))...(((((((....))))))).....................
2.06
medium
90.70.0740.8110.4420.75581.33761.35370.63970.69360.80510.71110.76360.14330.05850.05850.05850.116800.17480.7510.99930.23511.14040.04670.0560.11190.05590.05590.16730.19480.92670.62790.56960.24340.1350.0540.161600.12440.88371.33830.79420.103500.10330.10320.10310.15441.22740.50390.9881.08240.58640.17880.03150.24280.07950.07260.95791.18120.65650.790.55410.0922000.23160.22920.6371.23351.1291.0030.47480.34610.17270.08630.17220.0860.44931.7530.97320.52710.61250000.53470.40550.45270.32750.33250.3434
82
81MultiTetraTetraloops and 0-0-0-0 Multiloop Phase 13015161
GGAAAGACAGUGCUGCAGGAAACUGCAGGACCUGGAAACAGGUCGCUGACGAAAGUCAGCCACUGUCAGAUAUGCUUCGGCAUAUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
2.483
medium
94.70.0270.3020.1651.06590.39320.85180.49550.37230.11880.04950.01980.03960.01480.02470.05930.009900-0.00130.00990.17590.83541.82370.65590.19270.03520.00940.0189-0.0309000.03770.03770.01890.0377-0.0617-0.00260.16190.67620.3530.40680.03390.0092000.0092-0.0123-0.0308-0.0216-0.0287-0.4750.1740.10550.12810.99020.54920.35740.0699-0.0310.0089-0.01250.01780.00530.01340.04010.00890.04450.03190.04440.12430.45110.20730.05320.11450.10520.04850.14720.30810.92370.27630.30530.45480000.24080.12450.13680.12830.09580.054
83
82FritosTetraloops and 0-0-0-0 Multiloop Phase 13015173
GGAAAGUGCUAGGAAGACAAAAGUCUUCGGAUAGAAAACUAUCCCUACUGAAAACAGUAGCUAGCACAGUAGCACUUCGGUGCUACAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
2.698
medium
97.30.0650.7510.4080.88791.34881.20340.95850.30770.15360.038400.03840.038300.03830.038300.0383-0.02680.11470.28711.73822.16211.54772.23870.46120.03460.03460.06910-0.03040.00410-0.0648-0.0949-0.12480.32611.31281.24410.80340.91480.13050.06520.09770.09760.065000.0487-0.04644.00E-040.20470.21961.72553.30992.07850.79430.37870.023300.17430.08710.02900.05190.05790.02890.05780.05160.25921.15710.31120.1620.1690.22470.13240.13531.07341.62580.47510.76350.60940000.44180.27830.26390.240.1610.1323
84
83Tetra Ph1 V.1Tetraloops and 0-0-0-0 Multiloop Phase 13015341
GGAAAGCUUACCGGUGACUACGGUCACCGCAUGUGAGAGCAUGCGCAUCAGAAAUGAUGCGGUAAGCAGGUACUCUUCGGAGUACCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
1.17
medium
93.30.0340.3770.2051.00320.59250.60090.47580.4290.1090.03630.03630.0363-0.0802000.02860.03620.07230.072300.07220.32370.0360.28670.392400.0713-0.00930.03560-0.0804000.035600.03550.79241.36930.51510.59250.62220.16940.03390.10150.06760.03380.06750.0675-0.1157-0.081800.03370.14580.32960.9230.73440.54460.32560.0325-0.19790.0650.09740.09730.03240.03240.03240.06480.19380.06460.09670.42970.25560.09570.15930.19070.1270.12680.37341.29260.73370.76290.43110000.57120.32390.3070.2050.29290.1531
85
84Tetra Z1Tetraloops and 0-0-0-0 Multiloop Phase 13015564
GGAAAGCUAUUCGUAUUGGAAACGGUACGCUACUGAGAGGUGGCGCAAGCGAAAGCUUGCGAAUGGCAGAUGUAUUUCGAUACAUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
4.605
medium
93.30.0410.4460.2440.86590.34751.03630.66240.62360.09940.01370.0870.09770.12820.11690.04760.13850.08380.15270.23920.22890.25690.35650.70840.54830.21170.15850.08090.11950.10120.0701-0.058500.0070.06310.0910.16420.65751.98760.49440.58680.29980.44080.10680.02250.05950.05950.00830.01980.0153-0.006-0.10040.08260.05910.13450.5910.5420.29360.13730.03860.02570.08210.05260.07050.07170.08960.22440.17830.21160.13510.31340.54640.22980.16850.07550.09960.15740.17970.34011.65280.22420.53020.97440000.1820.09140.10290.09450.08870.0517
86
85Tetra Z1Tetraloops and 0-0-0-0 Multiloop Phase 13015590
GGAAAGCUAUUCGUAUUGGAAACGGUACGCUACUGAGAGGUGGCGCUUGCGAAAGCGGGCGGAUGGCAGAUGUAUUUCGAUGCGUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
5.934good82.70.0480.5330.2910.84060.3320.83980.49230.51590.04480.07270.06040.10240.06630.04130.01220.03650.0540.20540.43940.23770.36020.4290.65220.33350.24070.09150.09560.13530.17210.11650.0640.03490.00580.05810.12650.27770.81592.08610.60950.70610.31470.42050.12710.04870.08160.08130.0380.04340.06770.2960.3150.17160.10410.20280.72250.56880.42470.09760.0060.01860.12520.07070.05210.16370.1220.17890.03960.13880.07680.06520.31080.4990.49570.49180.4390.9490.69410.72981.3750.24560.34810.7450000.14440.06970.08730.07460.06360.026
87
86Tetra Z3Tetraloops and 0-0-0-0 Multiloop Phase 13015616
GGAAAGCUGUACGUCUAGGAAACUAGACGCUACUGAGAGGUAGCGCGUGCGAAAGCAUGCGUAUAGCAGCUGCAUUUCGAUGCAGCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
3.375
medium
94.70.0410.4460.2431.02710.72121.10260.670.65810.07320.01330.01330.01330.05310.01330.02650.09270.01320.01320.0202-0.01510.14970.7550.82610.75560.37720.05530.02550.02550.01280.03820.02550.02550.11450.02540.01270.17460.78391.90460.67740.51320.35630.4240.0960.0660.05990.05190.03990.0160.02390.0239-0.07040.03590.08360.15610.87080.48090.40470.08940.06990.05820.0140.04650.03490.01160.10450.13910.04860.15030.04620.1270.56690.10480.10280.0072-0.01170.11150.24380.63032.12430.17790.30541.4650000.27520.17480.13940.12050.11930.0696
88
87madnessTetraloops and 0-0-0-0 Multiloop Phase 13015638
GGAAACAUCAUCCACUAGGAAACUAGUGCUAUAGGAAACUAUAGGUGUAGGAAACUACACGAUGAUGAGAGAGUAUUCGUACUCUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
1.71
medium
960.0290.3140.172-0.16250.64380.84590.36010.18860.0032-0.00290.0546-0.02110.03640-0.1149-0.11470.01820.0182-0.03920.03630.09070.24421.77770.62160.19020.05260.05260.017500.01750.05250.01750.0350-0.04450.06990.03490.16930.74270.34960.46130.0283-0.06280.0171-0.0570.01710.06820.05110.03410.034-0.04050.05090.0170.19190.92710.54670.16740.0498-0.023600.01660.0497-0.03460.05520.0150.03310.08260.06610.0330.11540.44290.14740.17980.06530.0490.26045.00E-040.37221.14190.5790.67690.9290000.41020.21220.15430.17850.14340.1533
89
88headTetraloops and 0-0-0-0 Multiloop Phase 13015643
GGAAACAGCAUCCACUAGGAAACUAGUGCAUAAGGAAACUUAUGGUGUAGGAAACUACACGAUGUUGAGAGUGUAUUCGUACACUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
3.367
medium
97.30.030.330.180.02480.75750.67090.21870.20010.09660.02810.02970.02890.0140.01480.0370.03700.0111-0.06530.00740.01320.32431.40240.54260.32170.0430.01430.01080.01080.02150.0537-0.01220.01430.0067-0.2109-0.11760.04860.14150.63960.40870.44090.10490.05940.03140.02790.0140.04190.0140.0349-0.01230.16260.08330.05180.2511.50020.50970.22740.03370.0176-0.00930.058-0.0346-0.0160.11150.1340.06430.06020.0802-0.00930.19330.30330.05750.1230.06620.04630.03110.0990.45291.19120.42990.72521.15840000.2050.11590.09190.05310.06670.0413
90
89rebelsTetraloops and 0-0-0-0 Multiloop Phase 13015654
GGAAACAGCAUCCACUAGGAAACUAGUGCAGCAGGAAACUGUUGGUGUAGGAAACUACACGAUGUUGAGAUGGUAUUCGUACCAUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
4.465
medium
98.70.0320.3470.190.50170.74490.72490.30120.14940.01020.05190.01950.01150.04210.01940.00650.00650.02590.013-0.0511-0.05290.0970.20971.91270.49850.2470.03330.01360.00620.012500.03330.00830.0520.00620.0411-0.02160.03480.19680.72350.44530.36920.04270.02447.00E-040.04870.00610.03720.04260.03040.02640.11870.04820.06970.29821.42810.5130.17210.07190.01790.04120.03550.02350.01760.0880.07910.02640.02340.06440.0760.18650.31350.10440.06350.13880.08670.17260.12930.67111.43530.40240.52031.21970000.15510.09580.07740.06290.04160.0487
91
90JR_TetraP1V1_Rnd1_Sub1Tetraloops and 0-0-0-0 Multiloop Phase 13016264
GGAAACAUGUACGAUCACUACGGUGAUCCAUGUCUACGGACAUGCAUGACUACGGUCAUGGUACAUGAGAGUCUCUUCGGAGACUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
2.141
medium
90.70.0230.2510.1370.64870.63280.6840.48220.43580.05990.09440.01350.06740.02690.1172-0.0241-0.02410.04480.0448-0.0129-0.00390.06710.37410.2930.2480.25150.1190.0660.05280.01320.02640.01320.02640.01320-0.0351-0.00440.17750.19030.18330.28710.21480.1170.04070.02120.0130.0260.07780.03890.008200.0970.06080.04780.40140.24630.27110.3830.18520.10140.0380.05070.0020.02530.03790.06320.0136-0.0529-0.016-0.00530.1950.73060.61890.44340.17830.08590.08580.07350.18950.78140.28340.52660.16750000.26270.13430.13680.12440.11160.0919
92
91Mat - Tetraloops 0-0-0-0 phase 1 - D1Tetraloops and 0-0-0-0 Multiloop Phase 13016787
GGAAAGCGUAGGCGUAUGGAAACAUAUGGGAUACGAAAGUAUCCGCUUACGAAAGUAAGCCCUACGCAGCAUACGUUCGCGUAUGCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
2.392
medium
97.30.0290.3160.1721.18130.47170.66760.56160.51310.07650.0362000.01210.00980.024100.0402-0.03440.02810.03610.15620.54741.12970.45780.13710.04060.06220.05050.02330.02330.05820.0116-0.026700.01160.02330.01750.180.75570.34390.26280.07990.034200.01140.011400.0114-0.015500.0114-0.04640.06550.17140.6170.26510.31440.07780.08890.050.03880.0444-0.0695-0.02680.02220.01750.02210.07740.07740.14340.4780.21390.0764-0.02690.08210.11460.06520.9981.55120.36761.06320.60450000.23690.11980.10970.12430.13390.0573
93
92Mat - Tetraloops 0-0-0-0 phase 1 - D2Tetraloops and 0-0-0-0 Multiloop Phase 13016791
GGAAAGCGUAGCGCUAUGGAAACAUAGCCCAUACGAAAGUAUGGCAGUACGAAAGUACUGGCUACGCAGCAUUCGUUCGCGAAUGCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
2.144
medium
960.0290.3220.1761.4590.29390.75220.58690.46020.07770.07760.0310.07750.01550.01550.0155000.04640.01550.0155-0.0280.1111.92580.74130.2390.09210.01490.04470.02980.02980.01980.0050.03470-0.13-0.01230.06980.11910.45190.34540.41270.02920.04860.00490.0340.02910.04370.01460-0.04320.04410.05290.03430.18220.96240.4680.45450.17880.04940.028200.04230.042300.01410.05630.08440.02730.11230.15410.48340.25920.1093-0.00140.11040.06750.13770.66930.99920.4540.90660.25130000.26590.14780.15460.11970.16280.0665
94
93Mat - Tetraloops 0-0-0-0 phase 1 - D3Tetraloops and 0-0-0-0 Multiloop Phase 13016801
GGAAAGCAUACGGCUAUGGAAACAUAGCGCAUACGAAAGUAUGCCAGUACGAAAGUACUGCGUAUGCAGCAUACGUUCGCGUGUGCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
3.497
medium
98.70.0310.3450.1880.87480.52420.81810.73770.73060.07520.04880.02630.06160.015400.061500.0077-0.032-0.02430.00380.11130.22631.47790.37810.17550.02470.03730.02980.01740.01740.0397-0.00130.00740.0516-0.106-0.050.06310.17560.66950.38230.4220.05840.0087-0.01480.00110.010.00730.020.02180.0145-0.01960.12360.13690.20961.2780.55770.43590.10710.06980.0070.02090.12540.05570.04870.04170.06950.17340.10130.04150.07080.7670.18370.11470.09610.15610.15280.08840.42881.33970.38050.68250.57760000.22710.10570.12520.09710.08610.0592
95
94wisdave tetraloops - 1Tetraloops and 0-0-0-0 Multiloop Phase 13018483
GGAAAGUGUACCGGUCAGGAAACUGACCGCUCAGGAAACUGAGCGCUCAGGAAACUGAGCGGUACACAGAUUAUGUUCGCAUAAUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
1.389
medium
920.0360.3910.2130.61190.57540.84620.84770.78290.03260.032600.03260000.01630.90380.1289-0.0929-0.06060.06440.44840.30571.51110.352900.03110000.03110.015600.03110.03110.03110.07760.15540.56690.39580.48510.01520.06060.07570.0303000.06050.06040.0403-0.11440.11040.10020.45870.46711.45820.52180.08690.029-0.06240.14450.173-0.03360.028800.028800.05260.05750.08610.46510.40530.16360.3660.04980.50310.29890.29581.27510.36240.68650.52320000.50040.2620.28110.2210.30780.1136
96
95TAQ0M BTetraloops and 0-0-0-0 Multiloop Phase 13019552
GGAAAGUACAUGGAUCACGAAAGUGAUCGUCUACGAAAGUAGACCUAGAGGAAACUCUAGCAUGUACAGAUGCAGUUCGCUGUAUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
2.376
medium
93.30.0290.3190.1740.53040.64040.7210.54050.65380.07420.08650.0370.160200.04930.0369-0.024800.0123-0.17320.02460.02460.10850.88420.48130.42560.060.0240-0.00100.0160.0280.0280-0.038-0.08290.03990.02590.60530.35530.40350.03360.03750.07420.03910.05850.0468-0.00170.02340.04680.03630.09130.1520.2231.4830.87410.63290.18790.01120.06690.04460.07790.00790.03340.03010.02220.08880.11120.12540.0190.31220.30710.26250.12010.120.14150.11960.17450.84640.31540.46780.53940000.27310.1530.15330.12250.10890.0566
97
960-0-0-0 1Tetraloops and 0-0-0-0 Multiloop Phase 13021549
GGAAACGUGUACGAUCACUACGGUGAUCCAUGUCUACGGACAUGCAUGACUACGGUCAUGGUACACGAGUGUCUCUUCGGAGACACAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
1.816
medium
85.30.0210.2360.1280.35850.52080.94180.72340.31740.06990.06450.01610.03220.0161-0.008200.032200.03220.02390.01610.12840.31920.17370.31730.17420.17380.04740.047400.06310.03150.11020.015700.04720.03150.07760.2650.17190.1560.24880.06850.0466-0.02470.03100.062-0.00920.00520.02070.02690.03870.13910.43820.19940.34380.25140.19760.10630.01520.0910.01520.07570.04540.01510.04540.0354-0.06510.15090.29050.7660.37840.14130.19130.21280.40180.0730.22210.82180.19330.14970.10940000.31860.17240.14610.13080.09660.064
98
97JR_TetraP1V1_Rnd1_Sub2Tetraloops and 0-0-0-0 Multiloop Phase 13021734
GGAAACAUGAUCCAUCACUACGGUGAUGCAUGUCUACGGACAUGGAUGACUACGGUCAUCGAUCAUGAGAGUGUCUUCGGACGCUCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
3.323
medium
89.30.0250.2780.151-0.02040.84981.05410.62510.18080.09540.03860.00770.06950.05650.07710.03850.00250.02310.04620.08460.04090.08160.42050.23430.25080.39080.14320.05520.04010.04010.02260.0451-0.00550.0250.01750.0120.0150.17980.2930.20110.14380.19040.2860.0616-0.01470.03940.01890.08110.03110.02950.01320.06310.03730.1190.36320.36160.25880.28560.30260.10180.02990.05030.01550.04310.03590.06450.05730.08690.06540.08570.19960.87890.22050.37630.09560.06570.1710.13490.30870.94230.46990.37930.55870000.2280.11240.11590.08870.06270.0763
99
98TetrasaurusTetraloops and 0-0-0-0 Multiloop Phase 13021850
GGAAAGCUAUCGGCAUGCGAAAGCAUGCGCCACGGAAACGUGGCCCUAGCGAAAGCUAGGCGAUAGCACCUAUAGUUCGCUAUAGGAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
1.299
medium
880.0280.3030.1650.94520.33590.92630.41370.5520.06050.05470.031200.023400.04680.070200-0.0880.03510.08170.22130.74680.46330.31290.0762000.02290.02290.04570.04570.0228000.04560.18220.11370.81850.50020.264200.05580.022300.02230.02230.04460.02230-0.0656-0.04320.17780.08880.85720.32690.39120.13020.02170.043400.065-0.06580.06490.04330.0216-9.00E-040.10790.08620.19360.42390.33810.27550.29570.33670.14070.26810.35351.00160.17950.46830.66040000.50190.25190.19330.15090.16320.1944
100
99Strong CoreTetraloops and 0-0-0-0 Multiloop Phase 13021877
GGAAAGUCGAUCGCGUACGAAAGUAUGCCCUAUCGAAAGAUAGGCGACUCGAAAGAGUCGGAUCGACAGGAAUGCUUCGGCAUUCCAAAAGAAACAACAACAACAAC
.....(((((((((((((....))))))((((((....))))))((((((....))))))))))))).(((((((....))))))).....................
1.998
medium
90.70.0290.3170.1730.81570.54490.76750.87990.65210.11880.04650-0.04480.0310.04640.0619-0.058600.030900.0155-0.00870.19010.85990.24860.27820.05050.03030.03030.030300.07570.01510.01510.0454-0.5461-0.05850.03020.04620.39090.00560.16410.05960.0298-0.01430.0447-0.01370.014900.04460.07520.10370.05924.00E-040.24010.56720.27360.31530.07260.0653-4.00E-0400.01450.10130.05790.12940.014400.28770.05680.08610.75270.85910.13890.11060.16620.23730.3730.68221.21630.63060.70890.86960000.29510.15920.13380.14040.17570.0736
Loading...
Main menu