Rawls Lab - Allele Registry
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZ
1
TimestampAllele numberGenotypeSynonymsBackgroundPhenotypeAllele typeAffected gene(s)
Ensembl gene Id (e.g. ENSDARG00000035859)
ChromosomeCreated byReferenceRegistered byNotes
2
nc1Tg(6xNFkB:EGFP)
Tg(6xHsa.NFKB:EGFP)nc1
TLTgN/AunknownMichelle KantherPMID 21439961Michelle Kanther
3
nc2b
Tg(in3.4angptl4-Mmu.Fos:GFP)
nc2, Tg(angptl4-Mmu.Fos:GFP)nc2b
TLTgN/AunknownGray CampPMID 24963153Gray Camp
4
nc3
Tg(in3.4angptl4-Mmu.Fos:GFP)
Tg(angptl4.1-Mmu.Fos:GFP)nc3
TLTgN/AunknownGray CampPMID 24963153Gray Camp
5
nc4
Tg(in3.4angptl4-Mmu.Fos:GFP)
Tg(angptl4.2-Mmu.Fos:GFP)nc4
TLTgN/AunknownGray CampPMID 24963153Gray Camp
6
nc5Tg(-5.2angptl4:GFP)TLTgN/AunknownGray CampPMID 24963153Gray Camp
7
nc6Tg(-5.2angptl4:GFP)
Tg(-5.2angptl4.1:GFP)nc6
TLTgN/AunknownGray CampPMID 24963153Gray Camp
8
nc7Tg(-3.5angptl4:GFP)
Tg(-3.5kbangptl4:GFP)nc7
TLTgN/AunknownGray CampPMID 24963153Gray Camp
9
nc8Tg(-3.5angptl4:GFP)
Tg(-3.5angptl4.1:GFP)nc8
TLTgN/AunknownGray CampPMID 24963153Gray Camp
10
nc9Tg(-1angptl4:GFP)TLTgN/AunknownGray CampPMID 24963153Gray Camp
11
nc10Tg(-1angptl4:GFP)
Tg(-1angptl4.1:GFP)nc10
TLTgN/AunknownGray CampPMID 24963153Gray Camp
12
nc11
Tg(in3angptl4-Mmu.Fos:GFP)
Tg(angptl4.3-Mmu.Fos:GFP)n11
TLTgN/AunknownGray CampPMID 24963153Gray Camp
13
nc12
Tg(in3angptl4-Mmu.Fos:GFP)
Tg(angptl4.4-Mmu.Fos:GFP)nc12
TLTgN/AunknownGray CampPMID 24963153Gray Camp
14
nc13
Tg(in3.1angptl4-Mmu.Fos:GFP)
Tg(angptl4.5-Mmu.Fos:GFP)nc13
TLTgN/AunknownGray CampPMID 24963153Gray Camp
15
nc14
Tg(in3.1angptl4-Mmu.Fos:GFP)
Tg(angptl4.6-Mmu.Fos:GFP)nc14
TLTgN/AunknownGray CampPMID 24963153Gray Camp
16
nc15
Tg(in3.2angptl4-Mmu.Fos:GFP)
Tg(angptl4.7-Mmu.Fos:GFP)nc15
TLTgN/AunknownGray CampPMID 24963153Gray Camp
17
nc16
Tg(in3.2angptl4-Mmu.Fos:GFP)
Tg(angptl4.8-Mmu.Fos:GFP)nc16
TLTgN/AunknownGray CampPMID 24963153Gray Camp
18
nc17
Tg(in3.2angptl4-Mmu.Fos:TdTomato)
Tg(angptl4-Mmu.Fos:TdTomato)nc17
TLTgN/AunknownGray CampPMID 24963153Gray Camp
19
nc18
Tg(in3.2angptl4-Mmu.Fos:TdTomato)
Tg(angptl4.1-Mmu.Fos:TdTomato)nc18
TLTgN/AunknownGray CampPMID 24963153Gray Camp
20
nc19
Tg(in3.3angptl4-Mmu.Fos:GFP)
Tg(angptl4.8-Mmu.Fos:GFP)nc19
TLTgN/AunknownGray CampPMID 24963153Gray Camp
21
nc20
Tg(in3.3angptl4-Mmu.Fos:GFP)
Tg(angptl4.10-Mmu.Fos:GFP)nc20
TLTgN/AunknownGray CampPMID 24963153Gray Camp
22
nc21
Tg(-1angptl4:GFP:in3.4inv)
Tg(angptl4.11:GFP)nc21
TLTgN/AunknownGray CampPMID 24963153Gray Camp
23
nc22
Tg(-1angptl4:GFP:in3.4inv)
Tg(angptl4.12:GFP)nc22
TLTgN/AunknownGray CampPMID 24963153Gray Camp
24
nc23
Tg(Ipu.in3.2angptl4-Mmu.Fos:GFP)
Tg(Ipu.Angptl4-Mmu.Fos:GFP)nc23
TLTgN/AunknownGray CampPMID 24963153Gray Camp
25
26
27
28
6/23/2015 11:37:06rdu1
Tg(Hsa.CRE17.PLXND1-Mmu.Fos:GFP)
EKTgN/AunknownPatrick WilliamsPatrick Williams
Generated using the original Shannon Fisher Tol2GWcfosGFP plasmid inserting cis-regulatory region "CRE17" from human PLXND1. Plasmid generated by Tamara Roman (Mohlke lab, UNC).
29
7/22/2015 14:27:49rdu2
Tg(Hsa.CRE17.PLXND1-Mmu.Fos:GFP)
EKTgN/AunknownPatrick WilliamsPatrick Williams
GGGGACTGTGAAGACAGGAG (Forward primer) CCTGGCCCTAATCTCCTCAT (Reverse primer)
Element Size: 888 bp
Human genome coordinates of the element on the UCSC genome browser: chr3:129342128-129343015
1 waist-hip ratio-associated variant located within CRE17. It is rs11718169.
The allele of this variant is a C.
30
7/22/2015 14:33:33rdu3
Tg(Hsa.CRE17.PLXND1-Mmu.Fos:GFP)
EKTgN/AunknownPatrick WilliamsPatrick Williams
GGGGACTGTGAAGACAGGAG (Forward primer) CCTGGCCCTAATCTCCTCAT (Reverse primer)
Element Size: 888bp
Human genome coordinates of the element on the UCSC genome browser: chr3:129342128-129343015
1 waist-hip ratio-associated variant located within CRE17. It is rs11718169.
The allele of this variant is a C
31
7/22/2015 14:37:07rdu4
Tg(Hsa.CRE17SDM.PLXND1-Mmu.Fos:GFP)
EKTgN/AunknownPatrick WilliamsPatrick Williams
GGGGACTGTGAAGACAGGAG (Forward primer) CCTGGCCCTAATCTCCTCAT (Reverse primer)
Element Size: 888bp
Human genome coordinates of the element on the UCSC genome browser: chr3:129342128-129343015
1 waist-hip ratio-associated variant located within CRE17. It is rs11718169.
The allele of this variant is a T
32
7/22/2015 14:37:51rdu5
Tg(Hsa.CRE17SDM.PLXND1-Mmu.Fos:GFP)
EKTgN/AunknownPatrick WilliamsPatrick Williams
GGGGACTGTGAAGACAGGAG (Forward primer) CCTGGCCCTAATCTCCTCAT (Reverse primer)
Element Size: 888bp
Human genome coordinates of the element on the UCSC genome browser: chr3:129342128-129343015
1 waist-hip ratio-associated variant located within CRE17. It is rs11718169.
The allele of this variant is a T
33
7/22/2015 14:38:16rdu6
Tg(Hsa.CRE17SDM.PLXND1-Mmu.Fos:GFP)
EKTgN/AunknownPatrick WilliamsPatrick Williams
GGGGACTGTGAAGACAGGAG (Forward primer) CCTGGCCCTAATCTCCTCAT (Reverse primer)
Element Size: 888bp
Human genome coordinates of the element on the UCSC genome browser: chr3:129342128-129343015
1 waist-hip ratio-associated variant located within CRE17. It is rs11718169.
The allele of this variant is a T
34
7/22/2015 14:38:45rdu7
Tg(Hsa.CRE17SDM.PLXND1-Mmu.Fos:GFP)
EKTgN/AunknownPatrick WilliamsPatrick Williams
GGGGACTGTGAAGACAGGAG (Forward primer) CCTGGCCCTAATCTCCTCAT (Reverse primer)
Element Size: 888bp
Human genome coordinates of the element on the UCSC genome browser: chr3:129342128-129343015
1 waist-hip ratio-associated variant located within CRE17. It is rs11718169.
The allele of this variant is a T
35
9/29/2015 10:09:16rdu8 [retired]hnf4a+/+25Mutanthnf4a
ENSDARG00000021494
23JMDJMD
JFR: This allele number is retired because it was accidentally assigned to a genotype instead of an allele
36
9/29/2015 10:09:58rdu9 [retired]hnf4a+25/+25Mutanthnf4a
ENSDARG00000021494
23JMDJMD
JFR: This allele number is retired because it was accidentally assigned to a genotype instead of an allele
37
9/29/2015 10:10:39rdu10 [retired]hnf4a+/-41Mutanthnf4a
ENSDARG00000021494
23JMDJMD
JFR: This allele number is retired because it was accidentally assigned to a genotype instead of an allele
38
9/29/2015 10:11:04rdu11 [retired]hnf4a-41/-41Mutanthnf4a
ENSDARG00000021494
23JMDJMD
JFR: This allele number is retired because it was accidentally assigned to a genotype instead of an allele
39
9/29/2015 10:11:35rdu12 [retired]hnf4a+25/-41Mutanthnf4a
ENSDARG00000021494
23JMDJMD
JFR: This allele number is retired because it was accidentally assigned to a genotype instead of an allele
40
2/24/2016 13:11:13rdu13rodgeEKreduced pvatMutantunknownJMJM
41
4/6/2017 14:44:10rdu14hnf4a-43Mutanthnf4a
ENSDARG00000021494
23JMDJMD
This is a -43 bp deletion in the hinge domain of the translated protein that results in a frameshift and an early stop.
42
4/6/2017 14:45:45rdu15hnf4a+25Mutanthnf4a
ENSDARG00000021494
23JMDJMD
This is a 25 bp insertion in the frame shift that results in a frameshift and an early stop codon.
43
5/4/2017 10:30:36rdu16
Tg(rbp2a-Mmu.Fos:GFP)-1
zRBP2a-1EKTgunknownCRLCRL
44
5/4/2017 10:48:35rdu17
Tg(rbp2a-Mmu.Fos:GFP)-2
zRBP2a-2EKTgunknownCRLCRL
45
5/4/2017 10:50:57rdu18
Tg(Mmu.Rbp2-Mmu.Fos:GFP)-1
mRBP2-1EKTgunknownCRLCRL
46
5/4/2017 10:52:36rdu19
Tg(Mmu.Rbp2-Mmu.Fos:GFP)-2
mRBP2-2EKTgunknownCRLCRL
47
5/4/2017 10:56:51rdu20
Tg(Hsa.RBP2-Mmu.Fos:GFP)-1
hRBP2-1EKTgunknownCRLCRL
48
5/4/2017 10:57:28rdu21
Tg(Hsa.RBP2-Mmu.Fos:GFP)-2
hRBP2-2EKTgunknownCRLCRL
49
5/4/2017 10:58:09rdu22
Tg(fabp6-Mmu.Fos:GFP)-1
zFABP6-1EKTgunknownCRLCRL
50
5/4/2017 10:58:47rdu23
Tg(fabp6-Mmu.Fos:GFP)-2
zFABP6-2EKTgUNKNOWNCRLCRL
51
5/4/2017 10:59:26rdu24
Tg(Mmu.Fabp6-Mmu.Fos:GFP)-1
mFABP6-1EKTgunknownCRLCRL
52
5/4/2017 11:11:34rdu25
Tg(Mmu.Fabp6-Mmu.Fos:GFP)-2
mFABP6-2EKTgunknownCRLCRL
53
5/4/2017 11:12:17rdu26
Tg(Mmu.Fabp6-Mmu.Fos:GFP)-3(Big)
mFABP6-3(Big)EKTgunknownCRLCRL
54
5/4/2017 11:12:54rdu27
Tg(Mmu.Fabp6-Mmu.Fos:GFP)-4(Big)
mFABP6-4(Big)EKTgunknownCRLCRL
55
5/4/2017 11:13:28rdu28
Tg(Hsa.FABP6-Mmu.Fos:GFP)-1
hFABP6-1EKTgunkownCRLCRL
56
5/4/2017 11:14:22rdu29
Tg(Hsa.FABP6-Mmu.Fos:GFP)-2
hFABP6-2EKTgunknownCRLCRL
57
5/4/2017 11:14:51rdu30
Tg(Hsa.FABP6-Mmu.Fos:GFP)-3(Big)
hFABP6-3(Big)EKTgunknownCRLCRL
58
5/4/2017 11:15:33rdu31
Tg(Hsa.FABP6-Mmu.Fos:GFP)-4(Big)
hFABP6-4(Big)EKTgunknownCRLCRL
59
5/4/2017 11:16:08rdu32Tg(jun-Mmu.Fos:GFP)-1zJUN-1EKTgunknownCRLCRL
60
5/4/2017 11:16:49rdu33Tg(jun-Mmu.Fos:GFP)-2zJUN-2EKTgunknownCRLCRL
61
5/4/2017 11:17:26rdu34
Tg(nr1d1-Mmu.Fos:GFP)-1
zNR1D1 -1EKTgunknownCRLCRL
62
5/4/2017 11:17:56rdu35
Tg(nr1d1-Mmu.Fos:GFP)-2
zNR1D1 -2EKTgunknownCRLCRL
63
5/4/2017 11:18:22rdu36
Tg(Mmu.Nr1d1-Mmu.Fos:GFP)-1
mNR1D1-1EKTgunknownCRLCRL
64
5/4/2017 11:18:58rdu37
Tg(Mmu.Nr1d1-Mmu.Fos:GFP)-2
mNR1D1-2EKTgunknownCRLCRL
65
5/4/2017 11:19:33rdu38
Tg(egr1-Mmu.Fos:GFP)-1
zEGR1-1EKTgunknownCRLCRL
66
5/4/2017 11:20:04rdu39
Tg(egr1-Mmu.Fos:GFP)-2
zEGR1-2EKTgunknownCRLCRL
67
5/4/2017 11:20:54rdu40
Tg(Mmu.Egr1-Mmu.Fos:GFP)-1
mEGR1-1EKTgunknownCRLCRL
68
5/4/2017 11:21:30rdu41
Tg(Mmu.Egr1-Mmu.Fos:GFP)-2
mEGR1-2EKTgunknownCRLCRL
69
5/4/2017 11:22:00rdu42
Tg(Hsa.EGR1-Mmu.Fos:GFP)-1
hEGR1-1EKTgunknownCRLCRL
70
5/4/2017 11:24:17rdu43
Tg(Hsa.EGR1-Mmu.Fos:GFP)-2
hEGR1-2EKTgunknownCRLCRL
71
5/4/2017 11:24:49rdu44
Tg(hes1-Mmu.Fos:GFP)-1
zHES1-1EKTgunknownCRLCRL
72
5/4/2017 11:25:32rdu45
Tg(hes1-Mmu.Fos:GFP)-2
zHES1-2EKTgunknownCRLCRL
73
5/4/2017 11:26:39rdu46
Tg(hes1-Mmu.Fos:GFP)-3
zHES1-3EKTgunknownCRLCRL
74
5/4/2017 11:27:21rdu47
Tg(hes1-Mmu.Fos:GFP)-4
zHES1-4EKTgunknownCRLCRL
75
5/4/2017 11:28:03rdu48
Tg(hes1-HNF1-Mmu.Fos:GFP)-1
zHES1-HNF1-1EKTgunknownCRLCRL
76
5/4/2017 11:30:05rdu50
Tg(hes1-RBPJ-Mmu.Fos:GFP)-1
zHES1-RBPJ-1EKTgunknownCRLCRL
77
5/4/2017 11:29:15rdu49
Tg(hes1-HNF1-Mmu.Fos:GFP)-2
zHES1-HNF1-2EKTgunknownCRLCRL
78
5/4/2017 11:30:45rdu51
Tg(hes1-RBPJ-Mmu.Fos:GFP)-2
zHES1-RBPJ-2EKTgunknownCRLCRL
79
5/4/2017 11:31:30rdu52
Tg(Hsa.HES1-Mmu.Fos:GFP)-1
hHES1-1EKTgunknownCRLCRL
80
5/4/2017 11:32:05rdu53
Tg(Hsa.HES1-Mmu.Fos:GFP)-2
hHES1-2EKTgunknownCRLCRL
81
5/4/2017 11:33:36rdu54Tg(Mmu.Fos:GFP)-1cfos-control-1EKTgunknownCRLCRL
82
5/4/2017 11:34:02rdu55Tg(Mmu.Fos:GFP)-2cfos-control-2EKTgunknownCRLCRL
83
5/4/2017 11:34:59rdu56Tg(Mmu.Fos:GFP)-3cfos-control-3EKTgunknownCRLCRL
84
5/4/2017 11:36:00rdu57Tg(Mmu.Fos:GFP)-4cfos-control-4EKTgunknownCRLCRL
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
Loading...
 
 
 
Rawls Lab Allele Registry
Backup
Original