BioE140L-Spring_2010_Oligos
Comments
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
$
%
123
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
|
 
Still loading...
ABCDEFGHIJKLMNOPQRST
1
oligoSequenceoligoDescriptioncreator
2
OJIMH011ccataGAATTCatgAGATCTGACACGTACGCGGGTGCTTAForward PCR of Part 1 of PhiC31WeiChunHsu
3
OJIMH012AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccgSOEing of Part 1 (R) of PhiC31WeiChunHsu
4
OJIMH013cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTTSOEing of Part 2 (F) of PhiC31WeiChunHsu
5
OJIMH014atcagGGATCCCGCCGCTACGTCTTCCGTReverse PCR of Part 2 of PhiC31WeiChunHsu
6
AS009-F ccataGAATTCatgAGATCTCAGATCATATATAAGGAGGTACATatgGACACGTACGCGGGTGCTTACGForward PCR of Part 1 of PhiC31 with RBSAndrewS
7
AS010-R cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTTSOEing of Part 1 of PhiC31AndrewS
8
AS011-F AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccgSOEing of Part 2 of PhiC31AndrewS
9
AS012-R atcagGGATCCCGCCGCTACGTCTTCCGTReverse PCR of Part 2 of PhiC31AndrewS
10
piggyBac01ccatagaattcatgAGATCTGGTTGCTCTCTGGACGACGAACForward PCR of part 1 of piggyBacXiaoYLiu
11
piggyBac02ACGGTATCAAAATCCTGATGatgtgcgactctggtaccaaForward SOEing part of piggyBacXiaoYLiu
12
piggyBac03ttggtaccagagtcgcacatCATCAGGATTTTGATACCGTReverse SOEing part of piggyBacXiaoYLiu
13
piggyBac04gctagGGATCCttaGAAGCAAGACTGGCACATGReverse PCR of part 2 of piggyBacXiaoYLiu
14
KRM001ccataGAATTCatgAGATCTcccggagagaatcgtaacacrbs.repCA42! (Forward)KMesa
15
KRM002ctgatGGATCCctattttccgcttttccagrbs.repCA42! (Reverse)KMesa
16
Ala6-F CCATAagatctgcTgcCgcagcagcagcaGGATCCtaaCTCGCTCCTCaggEIPCR construction of Alanine-6 partJeniL
17
KRM003ccataGAATTCatgAGATCTagaagcggttttcgggagtagtgccccaactggggtaacctttgagphiC31 attP (Forward)KMesa
18
KRM004ctgatGGATCCgtgtcatgtcggcgaccctacgcccccaactgagagaactcaaaggttaccccagttgphiC31 attP (Reverse)KMesa
19
ak11RCTGATggatccaaaattgatctcgccattgReverse BamHI for FokI- AmyKristofferson
20
ZZH001ccataGAATTCatgAGATCTagcacttcagcgcgccgtagForward oligo for cloning of oriCA42ZhenH
21
ZZh002ctgatGGATCCcggcaaaagacctactgctcReverse oligo for cloning of oriCA42ZhenH
22
ZZH003ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttggForward construction of phiC31 attB basic partZhenH
23
ZZH004ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcacReverse construction of phiC31 attB basic partZhenH
24
JG001-FccataGAATTCgtccAGATCTaaaaacgattctgacgcattttttatgJoseG
25
JG002-RCTGATGGATCCCTACTCTACAAGACCTCGTTTTttcJoseG
26
tn0001CCATAagatctGTCGACTGTCTCTTATACACATCTCAACCggatcctaaCTCGCTCCTCaggcttcPaulina
27
tn0002RCCAATAGATCTcatgaattcCACTTCAGPaulina
28
tn5001CCATAgaattcATGagatctATAACTTCTGCTCTTCATCGTGForward EcoRI and BglII for tn5JeniLee
29
tn5002CGTTCTCTTGCTaGAGGCCACCACATTCCGReverse BamHI and BglII removal for tn5JeniLee
30
tn5003CGGAATGTGGTGGCCTCtAGCAAGAGAACG(R)Removing the Xho1 site in tn5JeniLee
31
tn5004CTGATggatccGATCTTGATCCCCTGCGCC(F)Removing the Xho1 site in tn5JeniLee
32
sbb26-FccataGAATTCatgAGATCTtgaagtgaccggattagcaacgcCloning of sbb26DorothyT
33
sbb26-RctgatGGATCCcaatgtttttcggcagaatgcgaacgccgCloning of sbb26DorothyT
34
sbb25-FccataGAATTCatgAGATCTcagctgaagtgaccggattagcCloning of sbb25DorothyT
35
sbb25-RctgatGGATCCgcacgccctttgccggagatgcgaagCloning of sbb25DorothyT
36
mb0005gtcgagaattcATGagatctTGTTCGGAGCCGCTTTAACCCACTCForward construction of ZFNS target basic partMaziarB
37
mb0006gcgatggatccAGCACTTCCACAGAGTGGGTTAAAGCGGCTCCReverse construction of ZFNS target basic partMaziarB
38
mb0002gtacgGGATCCTTAaaaattgatctccccattgReverse BamHI MaziarB
39
gh1000FccagtGAATTCatgAGATCTCAGCTGGTTaaatctgaactggaggagForward for part <FokI-!Jing
40
gh1001FcgttggttccccgatcgattatggcgttatcgtggAcacaaaagcForward for part <FokI-!Jing
41
gh1001RcgccataatcgatcggggaaccaacggtataaatggcaccGTctggtttacForward for part <FokI-!Jing
42
gh1003FccatatcaccaatTgcaatggggcagtgctgagForward for part <FokI-!Jing
43
gh1003RccattgcAattggtgatatggForward for part <FokI-!Jing
44
gh1000RgcaaaGGATCCTTAaaaattgatctcgccattgttgForward for part <FokI-!Jing
45
rh01FccataAGATCTggttgagatgtgtataagagacagtcgacGGATCCtaactcgctcctcagEIPCR construction of Tn5 3'TR basic partRaffiHagopian
46
rh03FctctgGAATTCatgAGATCTctagcgcgtcgacataagccForward EcoRI for BglBricking GenRRaffiHagopian
47
rh04FcgcgtagtgagatAtatatctatgatcRemoving the BglII site from GenRRaffiHagopian
48
rh05RgatcatagatataTatctcactacgcgRemoving the BglII site from GenRRaffiHagopian
49
rh06RgcaaaGGATCCctagcgcgtcggccgggaagReverse BamHI for BglBricking GenRRaffiHagopian
50
fk0001ccaaaGAATTCatgAGATCTCAGCTGGTTaaatctgaactggaggag PaulinaT
51
fk0004ccataaaaccaatTgcaatggcgccg PaulinaT
52
fk0003cggcgccattgcAattggttttatggPaulinaT
53
fk0002gctagGGATCCaaaattgatctccccattgttgPaulinaT
54
repo99-FccaaaGAATTCatgAGATCTcctggaaggaatcgtaacacCloning of repo99JennaK
55
repCA42-FccaaaGAATTCatgAGATCTcagctgaagtgaccggattagCloning of repCA42JennaK
56
BDBn15001FCCATAgaattcATGagatctGAGGAACGGTAAGGAAGGAAAACatgAGCAAGGTAAAAATCGGForward retrieval, RBS introduction and BioBricking on Bca1455Bubbenheim
57
BDBn15001RCGCTTTTATCTTCACTGCGTTTTTTAGCTTGCCCTGAGReverse retrieval and SOE-site introduciton on Bca1455Bubbenheim
58
BDBn15002FCTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCGForward retrieval and SOE-site introduciton on Bca1485Bubbenheim
59
BDBn15002RCTGATggatccttaGCTGTAGTACGTTTCCCATGCGGReverse retrieval and BioBricking on Bca1485Bubbenheim
60
MNF11-FccagtGAATTCatgAGATCTAGCAAGGTAAAAATCGGTGAGTTGForward oligo for {<N15 Pretelomerase!}Michel
61
sbb32FccataGAATTCatgAGATCTagcgcctcagcgcgccgtagForward oligo for cloning of sbb32CarolynKwok
62
sbb32RctgatGGATCCaccaaacgccaacagctcaaReverse oligo for cloning of sbb32CarolynKwok
63
sbb24FccataGAATTCatgAGATCTacgattctgacgcattttttatgForward oligo for cloning of sbb24CarolynKwok
64
sbb24RctgatGGATCCacgtcaaaaaccagccagaactgcgReverse oligo for cloning of sbb24CarolynKwok
65
DS001CCATAgaattcATGagatctGGTAAATCTAAAGAAATCTCTCAGGACForward oligo for cloning of <SB100x!DanielSedor
66
DS002ctgatGGATCCttaGTATTTGGTAGCGTTACCTTReverse oligo for cloning of <SB100x!DanielSedor
67
68
69
Loading...
 
 
 
Sheet1