The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

OJIMH012AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccgSOEing of Part 1 (R) of PhiC31WeiChunHsu
OJIMH013cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTTSOEing of Part 2 (F) of PhiC31WeiChunHsu
OJIMH014atcagGGATCCCGCCGCTACGTCTTCCGTReverse PCR of Part 2 of PhiC31WeiChunHsu
AS010-R cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTTSOEing of Part 1 of PhiC31AndrewS
AS011-F AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccgSOEing of Part 2 of PhiC31AndrewS
AS012-R atcagGGATCCCGCCGCTACGTCTTCCGTReverse PCR of Part 2 of PhiC31AndrewS
piggyBac01ccatagaattcatgAGATCTGGTTGCTCTCTGGACGACGAACForward PCR of part 1 of piggyBacXiaoYLiu
piggyBac02ACGGTATCAAAATCCTGATGatgtgcgactctggtaccaaForward SOEing part of piggyBacXiaoYLiu
piggyBac03ttggtaccagagtcgcacatCATCAGGATTTTGATACCGTReverse SOEing part of piggyBacXiaoYLiu
piggyBac04gctagGGATCCttaGAAGCAAGACTGGCACATGReverse PCR of part 2 of piggyBacXiaoYLiu
KRM001ccataGAATTCatgAGATCTcccggagagaatcgtaacacrbs.repCA42! (Forward)KMesa
KRM002ctgatGGATCCctattttccgcttttccagrbs.repCA42! (Reverse)KMesa
Ala6-F CCATAagatctgcTgcCgcagcagcagcaGGATCCtaaCTCGCTCCTCaggEIPCR construction of Alanine-6 partJeniL
KRM003ccataGAATTCatgAGATCTagaagcggttttcgggagtagtgccccaactggggtaacctttgagphiC31 attP (Forward)KMesa
KRM004ctgatGGATCCgtgtcatgtcggcgaccctacgcccccaactgagagaactcaaaggttaccccagttgphiC31 attP (Reverse)KMesa
ak11RCTGATggatccaaaattgatctcgccattgReverse BamHI for FokI- AmyKristofferson
ZZH001ccataGAATTCatgAGATCTagcacttcagcgcgccgtagForward oligo for cloning of oriCA42ZhenH
ZZh002ctgatGGATCCcggcaaaagacctactgctcReverse oligo for cloning of oriCA42ZhenH
ZZH003ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttggForward construction of phiC31 attB basic partZhenH
ZZH004ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcacReverse construction of phiC31 attB basic partZhenH
tn5001CCATAgaattcATGagatctATAACTTCTGCTCTTCATCGTGForward EcoRI and BglII for tn5JeniLee
tn5002CGTTCTCTTGCTaGAGGCCACCACATTCCGReverse BamHI and BglII removal for tn5JeniLee
tn5003CGGAATGTGGTGGCCTCtAGCAAGAGAACG(R)Removing the Xho1 site in tn5JeniLee
tn5004CTGATggatccGATCTTGATCCCCTGCGCC(F)Removing the Xho1 site in tn5JeniLee
sbb26-FccataGAATTCatgAGATCTtgaagtgaccggattagcaacgcCloning of sbb26DorothyT
sbb26-RctgatGGATCCcaatgtttttcggcagaatgcgaacgccgCloning of sbb26DorothyT
sbb25-FccataGAATTCatgAGATCTcagctgaagtgaccggattagcCloning of sbb25DorothyT
sbb25-RctgatGGATCCgcacgccctttgccggagatgcgaagCloning of sbb25DorothyT
mb0005gtcgagaattcATGagatctTGTTCGGAGCCGCTTTAACCCACTCForward construction of ZFNS target basic partMaziarB
mb0006gcgatggatccAGCACTTCCACAGAGTGGGTTAAAGCGGCTCCReverse construction of ZFNS target basic partMaziarB
mb0002gtacgGGATCCTTAaaaattgatctccccattgReverse BamHI MaziarB
gh1000FccagtGAATTCatgAGATCTCAGCTGGTTaaatctgaactggaggagForward for part <FokI-!Jing
gh1001FcgttggttccccgatcgattatggcgttatcgtggAcacaaaagcForward for part <FokI-!Jing
gh1001RcgccataatcgatcggggaaccaacggtataaatggcaccGTctggtttacForward for part <FokI-!Jing
gh1003FccatatcaccaatTgcaatggggcagtgctgagForward for part <FokI-!Jing
gh1003RccattgcAattggtgatatggForward for part <FokI-!Jing
gh1000RgcaaaGGATCCTTAaaaattgatctcgccattgttgForward for part <FokI-!Jing
rh01FccataAGATCTggttgagatgtgtataagagacagtcgacGGATCCtaactcgctcctcagEIPCR construction of Tn5 3'TR basic partRaffiHagopian
rh03FctctgGAATTCatgAGATCTctagcgcgtcgacataagccForward EcoRI for BglBricking GenRRaffiHagopian
rh04FcgcgtagtgagatAtatatctatgatcRemoving the BglII site from GenRRaffiHagopian
rh05RgatcatagatataTatctcactacgcgRemoving the BglII site from GenRRaffiHagopian
rh06RgcaaaGGATCCctagcgcgtcggccgggaagReverse BamHI for BglBricking GenRRaffiHagopian
fk0001ccaaaGAATTCatgAGATCTCAGCTGGTTaaatctgaactggaggag PaulinaT
fk0004ccataaaaccaatTgcaatggcgccg PaulinaT
repo99-FccaaaGAATTCatgAGATCTcctggaaggaatcgtaacacCloning of repo99JennaK
repCA42-FccaaaGAATTCatgAGATCTcagctgaagtgaccggattagCloning of repCA42JennaK
BDBn15001FCCATAgaattcATGagatctGAGGAACGGTAAGGAAGGAAAACatgAGCAAGGTAAAAATCGGForward retrieval, RBS introduction and BioBricking on Bca1455Bubbenheim
BDBn15001RCGCTTTTATCTTCACTGCGTTTTTTAGCTTGCCCTGAGReverse retrieval and SOE-site introduciton on Bca1455Bubbenheim
BDBn15002FCTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCGForward retrieval and SOE-site introduciton on Bca1485Bubbenheim
BDBn15002RCTGATggatccttaGCTGTAGTACGTTTCCCATGCGGReverse retrieval and BioBricking on Bca1485Bubbenheim
MNF11-FccagtGAATTCatgAGATCTAGCAAGGTAAAAATCGGTGAGTTGForward oligo for {<N15 Pretelomerase!}Michel
sbb32FccataGAATTCatgAGATCTagcgcctcagcgcgccgtagForward oligo for cloning of sbb32CarolynKwok
sbb32RctgatGGATCCaccaaacgccaacagctcaaReverse oligo for cloning of sbb32CarolynKwok
sbb24FccataGAATTCatgAGATCTacgattctgacgcattttttatgForward oligo for cloning of sbb24CarolynKwok
sbb24RctgatGGATCCacgtcaaaaaccagccagaactgcgReverse oligo for cloning of sbb24CarolynKwok
DS001CCATAgaattcATGagatctGGTAAATCTAAAGAAATCTCTCAGGACForward oligo for cloning of <SB100x!DanielSedor
DS002ctgatGGATCCttaGTATTTGGTAGCGTTACCTTReverse oligo for cloning of <SB100x!DanielSedor