Shared SARS-Cov-2 genome annotations on UCSC Genome Browser
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
$
%
123
 
 
 
 
 
 
 
 
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAA
1
# Insert your annotations below. Mouse-over the headers to see instructions. Contact maxh@ucsc.edu if you have questions on this form or suggestions.
2
# Note that the annotations do not go immediately to the public site, they are only made public once per day. To show the current version of the annotations track, click this link:
https://genome-test.gi.ucsc.edu/cgi-bin/hgTracks?db=wuhCor1&hubUrl=https://hgwdev.gi.ucsc.edu/~max/userAnnots/hub.txt
3
StartEndLabelCategoryLong descriptive textURL to website or paper with further infoYour email
4
14505UTRgenes5' UTR structured RNA
https://www.biorxiv.org/content/10.1101/2020.03.27.012906v1.full.pdf+html
jferna10@ucsc.edu
5
2360523617furin_cleavageproteins
Novel polybasic protein cleavage site (aa seq RRAR) that can be processed by furin-like proteases, not present in the virus from SARS 2013 outbreak, situated on the S1 side of site where a human protease cleaves viral S protein into S1 and S2 facilitating infection. See also http://www.chinaxiv.org/abs/202002.00062, https://www.nature.com/articles/s41591-020-0820-9.pdf, and news article https://www.nature.com/articles/d41586-020-00660-x. See https://www.biorxiv.org/content/10.1101/2020.04.10.036533v1.full.pdf for the structural interaction between the furin protein and this site on the viral S protein.
https://www.biorxiv.org/content/10.1101/2020.02.19.956581v1.full.pdf
haussler@ucsc.edu
6
2287123086ACE2_receptorproteins
receptor biding site motif in the virus S protein for the human ACE2 protein
https://www.nature.com/articles/s41422-020-0305-x
haussler@ucsc.edu
7
2392323980fusion_peptideproteins
fusion peptide in the viral S protein facilitating fusion of viral membrane with host cell membrane
https://www.nature.com/articles/s41422-020-0305-x
haussler@ucsc.edu
8
2428924526Heptad_Repeat_1proteins
Heptad Repeat 1 (HR1), part of virus S protein that combines with HR2 to form a 6-helix bundle that brings viral and cellular membranes into close proximity for fusion and infection
https://www.nature.com/articles/s41422-020-0305-x
haussler@ucsc.edu
9
2504525180Heptad_Repeat_2proteins
Heptad Repeat 2 (HR2), part of virus S protein that combines with HR1 to form a 6-helix bundle that brings viral and cellular membranes into close proximity for fusion and infection
https://www.nature.com/articles/s41422-020-0305-x
haussler@ucsc.edu
10
1346713468-1_frame_shiftproteins
This base of the viral mRNA is sometimes translated twice by the ribosome due to programmed -1 ribosomal frameshifting. This allows translation to continue for almost the entire length of the remaining RNA, instead of hitting a stop codon very quickly, as it does without the frameshift. The reading frame downstream of this site is shifted by -1 bases relative to the reading frame upstream of this position.
https://viralzone.expasy.org/860?outline=all_by_protein
haussler@ucsc.edu
11
2841228433crRNA_N18fCRISPRCRISPR-Cas 13d guide for PAC-MAN viral inhibition strategy
https://www.biorxiv.org/content/10.1101/2020.03.13.991307v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
12
32713294Nsp3_gene_LB_+alnprimersRT-LAMP primer ( + strand aln)
https://www.biorxiv.org/content/10.1101/2020.03.09.983064v2.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
13
31913214Nsp3_gene_LF_-alnprimersRT-LAMP primer (- strand aln)
https://www.biorxiv.org/content/10.1101/2020.03.09.983064v2.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
14
33223345Nsp3_gene_B3_-alnprimersRT-LAMP primer (- strand aln)
https://www.biorxiv.org/content/10.1101/2020.03.09.983064v2.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
15
32153219Nsp3_gene_FIP_-alnprimersRT-LAMP primer (- strand aln)
https://www.biorxiv.org/content/10.1101/2020.03.09.983064v2.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
16
32413262Nsp3_gene_BIP_+alnprimersRT-LAMP primer ( + strand aln)
https://www.biorxiv.org/content/10.1101/2020.03.09.983064v2.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
17
33023321Nsp3_gene_BIP_-alnprimersRT-LAMP primer (- strand aln)
https://www.biorxiv.org/content/10.1101/2020.03.09.983064v2.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
18
2255822600S309_binding_siteprimersBinding site for neutralizing antibody S309
https://www.biorxiv.org/content/10.1101/2020.04.07.023903v2.full.pdf
jferna10@ucsc.edu
19
2262122645S309_binding_siteprimersBinding site for neutralizing antibody S309
https://www.biorxiv.org/content/10.1101/2020.04.07.023903v2.full.pdf
jferna10@ucsc.edu
20
2287922894S309_binding_siteprimersBinding site for neutralizing antibody S309
https://www.biorxiv.org/content/10.1101/2020.04.07.023903v2.full.pdf
jferna10@ucsc.edu
21
2304423047S309_binding_siteprimersBinding site for neutralizing antibody S309
https://www.biorxiv.org/content/10.1101/2020.04.07.023903v2.full.pdf
jferna10@ucsc.edu
22
2894728954NESproteins
Predicted Nuclear Export Signal, recently evolved in human and bat SARS-like viruses
https://www.biorxiv.org/content/10.1101/2020.04.05.026450v2
haussler@ucsc.edu
23
2911629125NLSproteins
Predicted Nuclear Localization Signal, recently evolved in human and bat SARS-like viruses
https://www.biorxiv.org/content/10.1101/2020.04.05.026450v2
haussler@ucsc.edu
24
2937729395NLSproteins
Predicted Nuclear Localization Signal, recently evolved in human and bat SARS-like viruses
https://www.biorxiv.org/content/10.1101/2020.04.05.026450v2
haussler@ucsc.edu
25
2941929440NLSproteins
Predicted Nuclear Localization Signal, recently evolved in human and bat SARS-like viruses
https://www.biorxiv.org/content/10.1101/2020.04.05.026450v2
haussler@ucsc.edu
26
2903829050NLSproteins
Predicted Nuclear Localization Signal, recently evolved in human and bat SARS-like viruses
https://www.biorxiv.org/content/10.1101/2020.04.05.026450v2
haussler@ucsc.edu
27
2297823020insertionevolution
Evolutionarily recent insertion of new bases in human and bat SARS-like viruses, altered further in SARS-CoV-2
https://www.biorxiv.org/content/10.1101/2020.04.05.026450v2
haussler@ucsc.edu
28
2423224244insertionevolution
Evolutionarily recent insertion of new bases in human and bat SARS-like viruses
https://www.biorxiv.org/content/10.1101/2020.04.05.026450v2
haussler@ucsc.edu
29
28880288833subsevolution
3 consecutive base par substitutions in SARS-CoV-2, defining a subclade of Nextstrain Clade A2a
https://www.biorxiv.org/content/10.1101/2020.04.10.029454v1
haussler@ucsc.edu
30
2639426421BH3-likeproteins
BH3-like motif that is evolutionarily conserved. Predicted to bind members of the Bcl-2 protein family
https://www.biorxiv.org/content/10.1101/2020.04.09.033522v1.full.pdf
haussler@ucsc.edu
31
2266622678CR3022_bindingantibodies
CR3022 is a neutralizing antibody against SARS1, has some affinity for SARS-CoV-2
https://science.sciencemag.org/content/early/2020/04/02/science.abb7269
jferna10@ucsc.edu
32
2268122720CR3022_bindingantibodies
CR3022 is a neutralizing antibody against SARS1, has some affinity for SARS-CoV-2
https://science.sciencemag.org/content/early/2020/04/02/science.abb7269
jferna10@ucsc.edu
33
2272622732CR3022_bindingantibodies
CR3022 is a neutralizing antibody against SARS1, has some affinity for SARS-CoV-2
https://science.sciencemag.org/content/early/2020/04/02/science.abb7269
jferna10@ucsc.edu
34
2273522738CR3022_bindingantibodies
CR3022 is a neutralizing antibody against SARS1, has some affinity for SARS-CoV-2
https://science.sciencemag.org/content/early/2020/04/02/science.abb7269
jferna10@ucsc.edu
35
2284022852CR3022_bindingantibodies
CR3022 is a neutralizing antibody against SARS1, has some affinity for SARS-CoV-2
https://science.sciencemag.org/content/early/2020/04/02/science.abb7269
jferna10@ucsc.edu
36
2310423113CR3022_bindingantibodies
CR3022 is a neutralizing antibody against SARS1, has some affinity for SARS-CoV-2
https://science.sciencemag.org/content/early/2020/04/02/science.abb7269
jferna10@ucsc.edu
37
2311623119CR3022_bindingantibodies
CR3022 is a neutralizing antibody against SARS1, has some affinity for SARS-CoV-2
https://science.sciencemag.org/content/early/2020/04/02/science.abb7269
jferna10@ucsc.edu
38
2895828990N-gene_-alnprimers
Forward primer sequence for SARS-CoV-2 N-gene in AIOD-CRISPR Cas12a assay
https://www.biorxiv.org/content/10.1101/2020.03.19.998724v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
39
2887028902N-gene_+alnprimers
Reverse primer sequence for SARS-CoV-2 N-gene in AIOD-CRISPR Cas12a assay
https://www.biorxiv.org/content/10.1101/2020.03.19.998724v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
40
2890328922N-gene_crRNA_-alnprimersN-gene crRNA target sequence used for AOID-CRISPR cas12a assay
https://www.biorxiv.org/content/10.1101/2020.03.19.998724v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
41
14505'UTR_conservedRNA
5' UTR structured RNA found to be highly conserved among SARS-CoV-2 and other betacoronaviruses, potential target for antivirals
https://www.biorxiv.org/content/10.1101/2020.03.27.012906v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
42
29543299033'UTR_conservedRNA
3' UTR structured RNA found to be highly conserved among SARS-CoV-2 and other betacoronaviruses, potential target for antivirals
https://www.biorxiv.org/content/10.1101/2020.03.27.012906v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
43
9191038
structuralRNA_conserved
RNA
Other highly conserved structural region for SARS-CoV-2 and other betacoronaviruses, a potential target for antivirals
https://www.biorxiv.org/content/10.1101/2020.03.27.012906v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
44
1345913546frameshift_conservedRNA
frameshift element structural RNA found to be highly conserved among SARS-CoV-2 and other betacoronaviruses
https://www.biorxiv.org/content/10.1101/2020.03.27.012906v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
45
1000910035RNA_conservedRNA
Unstructured conserved RNA common to SARS-CoV-2 and other betacoronaviruses. Unstructed conserved regions may be most easily targeted in primer-based diagnostic and oligonucleotide-based therapeutic strategies
https://www.biorxiv.org/content/10.1101/2020.03.27.012906v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
46
2291822939GAGbinding_motifproteins
Glycosaminoglycan binding motif experimentally and computationally predicted to bind heparin
https://www.biorxiv.org/content/10.1101/2020.04.14.041459v1
haussler@ucsc.edu
47
2360223620GAGbinding_motifproteins
Glycosaminoglycan binding motif experimentally and computationally predicted to bind heparin
https://www.biorxiv.org/content/10.1101/2020.04.14.041459v1
haussler@ucsc.edu
48
2358423597deletionevolutioncommon deletion in SARS-CoV-2
http://virological.org/t/identification-of-a-common-deletion-in-the-spike-protein-of-sars-cov-2/451
maxh@ucsc.edu
49
2359623617deletionevolutioncommon deletion in SARS-CoV-2
http://virological.org/t/identification-of-a-common-deletion-in-the-spike-protein-of-sars-cov-2/451
maxh@ucsc.edu
50
2856628590Ngene_LF_-alnprimersNgene LAMP LF primer sequence (-aln)
https://www.biorxiv.org/content/10.1101/2020.04.20.048066v2.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
51
2865428675Ngene_BIP_+alnprimersNgene LAMP BIP primer sequence (+aln)
https://www.biorxiv.org/content/10.1101/2020.04.20.048066v2.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
52
2860528626Ngene_FIP_-alnprimersNgene LAMP FIP primer sequence (-aln)
https://www.biorxiv.org/content/10.1101/2020.04.20.048066v2.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
53
2867628696Ngene_LB_+alnprimersNgene LAMP LB primer sequence (+aln)
https://www.biorxiv.org/content/10.1101/2020.04.20.048066v2.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
54
2872228741Ngene_B3_-alnprimersNgene LAMP B3 primer sequence (-aln)
https://www.biorxiv.org/content/10.1101/2020.04.20.048066v2.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
55
2629226354E_SECReTE_motifRNA
SECReTE motif that facilitates mRNA localization to the ER, present more frequently in (+) ssRNA viruses which utilize ER membranes to create VRCs. Thought to be important for VRC formation by SARS-CoV-2, serves as a possible drug target.
https://www.biorxiv.org/content/10.1101/2020.04.20.050088v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
56
809859nsp2_SECReTE_motifRNA
SECReTE motif that facilitates mRNA localization to the ER, present more frequently in (+) ssRNA viruses which utilize ER membranes to create VRCs. Thought to be important for VRC formation by SARS-CoV-2, serves as a possible drug target.
https://www.biorxiv.org/content/10.1101/2020.04.20.050088v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
57
2779127838Orf7b_SECReTE_motifRNA
SECReTE motif that facilitates mRNA localization to the ER, present more frequently in (+) ssRNA viruses which utilize ER membranes to create VRCs. Thought to be important for VRC formation by SARS-CoV-2, serves as a possible drug target.
https://www.biorxiv.org/content/10.1101/2020.04.20.050088v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
58
1477314817
nsp12RdRp_SECReTE_motif
RNA
SECReTE motif that facilitates mRNA localization to the ER, present more frequently in (+) ssRNA viruses which utilize ER membranes to create VRCs. Thought to be important for VRC formation by SARS-CoV-2, serves as a possible drug target.
https://www.biorxiv.org/content/10.1101/2020.04.20.050088v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
59
2155921597S_SECReTE_motifRNA
SECReTE motif that facilitates mRNA localization to the ER, present more frequently in (+) ssRNA viruses which utilize ER membranes to create VRCs. Thought to be important for VRC formation by SARS-CoV-2, serves as a possible drug target.
https://www.biorxiv.org/content/10.1101/2020.04.20.050088v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
60
1101111049nsp6_SECReTE_motifRNA
SECReTE motif that facilitates mRNA localization to the ER, present more frequently in (+) ssRNA viruses which utilize ER membranes to create VRCs. Thought to be important for VRC formation by SARS-CoV-2, serves as a possible drug target.
https://www.biorxiv.org/content/10.1101/2020.04.20.050088v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
61
2714727176M_SECReTE_motifRNA
SECReTE motif that facilitates mRNA localization to the ER, present more frequently in (+) ssRNA viruses which utilize ER membranes to create VRCs. Thought to be important for VRC formation by SARS-CoV-2, serves as a possible drug target.
https://www.biorxiv.org/content/10.1101/2020.04.20.050088v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
62
1440814409RdRp_missence evolution
P->L point mutation in RdRp region adjacent to a target of many of the antivirals being used to treat COVID19 patients. Appearance of this mutation also coincides with a dramatic spike in COVID19 cases in Europe according to the WHO.
https://assets.researchsquare.com/files/rs-20304/v1/manuscript.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
63
2340323404substitutionevolution
common missense mutation in SARS-CoV-2 with a notably high difference in resulting isoelectric point (D->G)
https://assets.researchsquare.com/files/rs-20304/v1/manuscript.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
64
2888128882substitutionevolution
common double substitution in SARS-CoV-2 with a notably high difference in resulting isoelectric points (R->K) and (G->R)
https://assets.researchsquare.com/files/rs-20304/v1/manuscript.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
65
2266022663V367F_substitutionevolution
V->F substitution isolated in the S protein RBD region which binds with human ACE2 receptors. Isolated in strains from Hong Kong and France and shown to reduce binding affinity
https://www.biorxiv.org/content/10.1101/2020.05.02.071811v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
66
2287322876S438F_substitutionevolution
S->F substitution isolated in the S protein RBD region which binds with human ACE2 receptors. Isolated in strains from India, shown to reduce binding affinity.
https://www.biorxiv.org/content/10.1101/2020.05.02.071811v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
67
2298722990G476S_substitutionevolution
G->S substitution isolated in the S protein RBD which binds with human ACE2 receptors. Isolated in strains from the US and Belgium, shown to reduce binding affinity
https://www.biorxiv.org/content/10.1101/2020.05.02.071811v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
68
2300823011V483A_substitutionevolution
V->A substitution isolated in the S protein RBD which binds with human ACE2 receptors. Isolated in 16 strains unique to the US, shown to reduce binding affinity.
https://www.biorxiv.org/content/10.1101/2020.05.02.071811v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
69
2889128912Ngene_BIP_+alnprimers
Ngene RT-LAMP primer sequence. This assay shows particularly promising speed and sensitivity
https://www.biorxiv.org/content/10.1101/2020.04.21.052530v1.article-info
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
70
2886428885Ngene_FIP_-alnprimers
Ngene RT-LAMP primer sequence. This assay shows particularly promising speed and sensitivity
https://www.biorxiv.org/content/10.1101/2020.04.21.052530v1.article-info
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
71
2882528845Ngene_LF_-alnprimers
Ngene RT-LAMP primer sequence. This assay shows particularly promising speed and sensitivity
https://www.biorxiv.org/content/10.1101/2020.04.21.052530v1.article-info
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
72
2898729006Ngene_B3_-alnprimers
Ngene RT-LAMP primer sequence. This assay shows particularly promising speed and sensitivity
https://www.biorxiv.org/content/10.1101/2020.04.21.052530v1.article-info
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
73
2251723185
binds_47D11_Antibody
antibodiesEpitope of neutralizing antibody 47D11
https://www.nature.com/articles/s41467-020-16256-y#Sec16
maxh@ucsc.edu
74
2340123404S_D614GRNA
Mutation with 63.5% frequency across 16,087 whole genomes. Located near the spike RBD, and in a region with an epitope prediction score appx 34% above the median.
https://www.biorxiv.org/content/10.1101/2020.05.11.089409v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
75
2888028885N_R203K_G204RRNA
Two mutations with 18.8% frequency across 16,087 whole genomes within the nucleocapsid gene, a target antigen for several RDTs currently in use. Located within a region with both a high mutation rate and a high epitope prediction score (appx 30% above median).
https://www.biorxiv.org/content/10.1101/2020.05.11.089409v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
76
2340323404spike_mutationproteins
invasive spike protein variant (A->G at 23403, D614G) affects the spike S1/S2 furin-like site and modifies motion of the RBD
https://www.biorxiv.org/content/10.1101/2020.05.14.095620v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
77
2875128816N_Bcell_epitopeantibodieshighly conserved B cell epitope in the N protein
https://www.biorxiv.org/content/10.1101/2020.05.14.095133v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
78
2914729197N_Tcell_epitopeantibodieshighly conserved T cell epitope in the N protein
https://www.biorxiv.org/content/10.1101/2020.05.14.095133v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
79
2463524685S_Bcell_epitopeantibodieshighly conserved B cell epitope in the S protein
https://www.biorxiv.org/content/10.1101/2020.05.14.095133v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
80
2459324646S_Tcell_epitopeantibodieshighly conserved T cell epitope in the S protein
https://www.biorxiv.org/content/10.1101/2020.05.14.095133v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
81
2359723626Del-Mut-1genes
30bp deletion at the S1/S2 junction removes the PRRA motif from this region of the spike protein. Infection with this mutation in hamsters does not cause severe pathological changes associated with WT SARS-CoV-2 infection. Screening for this variant in asymptomatic cases could have important implications for Del-mut variants as an attenuated vaccine.
https://www.tandfonline.com/doi/full/10.1080/22221751.2020.1756700
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
82
2329723315nCOV-S-F1_primerprimers
qRT-PCR primer set for amplification and detection of S gene in WT and Del-Mut-1 variant SARS-CoV-2. R2 (WT) can be replaced with nCOV-S-R-MT ATGATGGATTGACTAGTCTG for detection of Del-Mut-1, a variant strain of SARS-CoV-2 with a 30bp deletion of the S1/S2 junction thought to attenuate infection severity
https://www.tandfonline.com/doi/full/10.1080/22221751.2020.1756701
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
83
2365923679nCOV-S-R1_primerprimers
qRT-PCR primer set for amplification and detection of S gene in WT and Del-Mut-1 variant SARS-CoV-2. R2 (WT) can be replaced with nCOV-S-R-MT ATGATGGATTGACTAGTCTG for detection of Del-Mut-1, a variant strain of SARS-CoV-2 with a 30bp deletion of the S1/S2 junction thought to attenuate infection severity
https://www.tandfonline.com/doi/full/10.1080/22221751.2020.1756702
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
84
2346223486nCOV-S-F2_primerprimers
qRT-PCR primer set for amplification and detection of S gene in WT and Del-Mut-1 variant SARS-CoV-2. R2 (WT) can be replaced with nCOV-S-R-MT ATGATGGATTGACTAGTCTG for detection of Del-Mut-1, a variant strain of SARS-CoV-2 with a 30bp deletion of the S1/S2 junction thought to attenuate infection severity
https://www.tandfonline.com/doi/full/10.1080/22221751.2020.1756703
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
85
2360323625nCOV-S-R2_primerprimers
qRT-PCR primer set for amplification and detection of S gene in WT and Del-Mut-1 variant SARS-CoV-2. R2 (WT) can be replaced with nCOV-S-R-MT ATGATGGATTGACTAGTCTG for detection of Del-Mut-1, a variant strain of SARS-CoV-2 with a 30bp deletion of the S1/S2 junction thought to attenuate infection severity
https://www.tandfonline.com/doi/full/10.1080/22221751.2020.1756704
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
86
2896729080N_Bcell_epitopeantibodiesPredicted B cell linear epitope in the N protein
https://www.biorxiv.org/content/10.1101/2020.05.16.100206v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
87
2907229320N2b_evolutionproteins
Region of the N2b domain with several substitutions unique to SARS-CoV-2: A267, E290, Thr334, Asn345, Gln349. The N2b domain mediates homodimer formation in the N protein in all betacoronaviruses.
https://www.biorxiv.org/content/10.1101/2020.05.17.100685v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
88
16051607deletionevolution
Common 3bp deletion of start codon (ATG), prevent expression of non-canonical transcript
http://virological.org/t/common-microdeletions-in-sars-cov-2-sequences/485
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
89
516518deletionevolutionCommon 3bp deletion of TTA, disrupt start codon
http://virological.org/t/common-microdeletions-in-sars-cov-2-sequences/485
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
90
510518deletionevolutionCommon 6bp deletion of GTCATGTTA, disrupts 2 start codons
http://virological.org/t/common-microdeletions-in-sars-cov-2-sequences/485
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
91
2831328372Nprot_seq1proteins
Peptide sequence within the SARS-CoV-2 N protein identified by mass spectrometry. RITFGGPSDSTGSNQNGERS. Mass spectrometry offers a promising possibility for more rapid and sensitive diagnostic tools as an alternative to PCR methods.
https://www.biorxiv.org/content/10.1101/2020.05.24.113043v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
92
2889828954Nprot_seq2proteins
Peptide sequence within the SARS-CoV-2 N protein identified by mass spectrometry. RMAGNGGDAALALLLLDRL. Mass spectrometry offers a promising possibility for more rapid and sensitive diagnostic tools as an alternative to PCR methods.
https://www.biorxiv.org/content/10.1101/2020.05.24.113043v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
93
2871828783Nprot_seq3proteins
Peptide sequence within the SARS-CoV-2 N protein identified by mass spectrometry. RNPANNAAIVLQLPQGTTLPKG. Mass spectrometry offers a promising possibility for more rapid and sensitive diagnostic tools as an alternative to PCR methods.
https://www.biorxiv.org/content/10.1101/2020.05.24.113043v1.full.pdf
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
94
2360323614S_P681_RRA684proteins
Insertion unique to SARS-CoV-2 similar in structure and sequence to bacterial superantigens responsible for TSS, an immune response triggered by binding of these superantigens to MHCII molecules and TCRs. This motif is thought to be responsible for multisystem inflammatory syndrome in children associated with COVID-19, which induces similar pathology to TSS.
https://www.biorxiv.org/content/10.1101/2020.05.21.109272v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
95
2407724079S_D839Y/N/Eproteins
recently reported mutation in a European strain of SARS-CoV-2 thought to strenghten the interaction responsible for multisystem inflammatory syndrome in children
https://www.biorxiv.org/content/10.1101/2020.05.21.109272v1.full
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
96
2630226328Bcell_epitopeantibodies
B-cell epitope predicted as a universal candidate for peptide vaccine formation
https://www.biorxiv.org/content/10.1101/2020.05.26.115790v1
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
97
2642226439Tcell_epitopeantibodies
T-cell epitope predicted as a universal candidate for peptide vaccine formation
https://www.biorxiv.org/content/10.1101/2020.05.26.115790v2
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
98
2552425697ORF3c_OLGgenes
Previously unidentified gene that overlaps with codons 44-102 of ORF3a. Encodes a novel protein not present in other sarbecoronaviruses. Binds STOML2 mitochondrial protein and contains a signal peptide that may contribute to immune response as an antigenic target
https://www.biorxiv.org/content/10.1101/2020.05.21.109280v1.full#T1
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
99
2556325564G25563Ugenes
mutation in the newly characterized ORF3c gene that causes loss of function, linked with ORF3a Q57H, commonly seen with RdRp P323L as well
https://www.biorxiv.org/content/10.1101/2020.05.21.109280v1.full#T2
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu
100
266805ORF1ab_nsp1proteins
Non-structural Leader protein (NSP1) inhibits translation by binding to the 40S ribosomal subunit and induces a template-dependence endonucleolytic cleavage of host mRNAs. It also inhibits type I interferon expression and host antiviral signaling pathways, therefore inhibiting host innate immunity.
https://www.biorxiv.org/content/10.1101/2020.05.23.104919v1
kiley.charbonneau@ucsf.edu, maureen.lewis@ucsf.edu, kord.kober@ucsf.edu