Feedback about challenging calls in GIAB high-confidence sets (Responses)
Comments
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
Comment only
 
 
Still loading...
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAE
1
TimestampYour name
Your email (if this is your first entry)
Your Institution (if this is your first entry)
GIAB Genome
Version of high-confidence calls
Optionally, enter the vcf line (or related vcf lines) here instead of entering chromosome, position, REF, ALT, and genotype below
Chromosome number
Start Position on chromosome
True Reference base(s)
True Alternate base(s) - 2 alternates should be separated by a comma and no space
Genotype in VCF format
What evidence do you have that you are correct? Be as specific as possible. Check all that apply
Did you find any other variants within 50 bp of this variant?
If yes, please give some information about the other variants and how confident you are in them.
Is there any additional information about this variant or region that would be useful for us to know?
rs number of the variant if it is in dbSNP and you know it
Does the GIAB call appear to be correct?
Is this a repetitive region?
Reference assembly
2
2/3/2016 16:17:21John Thompson
thompson.john.f@gmail.com
Claritas GenomicsHG001/NA12878NISTv2.1913669201AG
1/1 (Homozygous variant)
Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay
Yes
Yes. rs10910021 is 4 bp away and is also homozygous alternate (G rather than C). Highly confident. Sanger, NextSeq and Proton
rs10797410
3
2/3/2016 16:23:29John Thompson
thompson.john.f@gmail.com
Claritas GenomicsHG001/NA12878NISTv2.19333138544AG
1/1 (Homozygous variant)
Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay
Yes
Additional homozygous alternate SNP 5 bp away. rs7614776. Confirmed with Sanger, NextSeq, Proton
rs7614776
4
2/3/2016 17:10:35John Thompson
thompson.john.f@gmail.com
Claritas GenomicsHG001/NA12878NISTv2.19633644768AG
1/1 (Homozygous variant)
Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay
Yes
rs4713652 located 5 bp away, also homozygous alternate, confirmed with Sanger, NextSeq, Proton
rs2068236
5
2/3/2016 17:15:44John Thompson
thompson.john.f@gmail.com
Claritas GenomicsHG001/NA12878NISTv2.196107077507CA0/1 (Heterozygous)
Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay
Yes
rs2054365 Homozygous alternate located 5 bp away. Confirmed via Sanger, NextSeq, Proton
rs72945092
6
2/3/2016 17:21:48John Thompson
thompson.john.f@gmail.com
Claritas GenomicsHG001/NA12878NISTv2.191280650276TTCAAA,TCAAACAAA
1/2 (Compound heterozygous)
Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay
I don't know
Confirmed by Sanger that this is a heterozygous mess. NextSeq and Proton agree on 1/2 assignment
rs147846753
7
2/3/2016 17:26:06jtcHG001/NA12878NISTv2.191771232804GT
1/1 (Homozygous variant)
Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay
Yes
rs904383 located 3 bp away. homozygous alternate confirmed by Sanger, NextSeq, Proton
rs904384
8
2/3/2016 17:33:58John Thompson
thompson.john.f@gmail.com
Claritas GenomicsHG001/NA12878NISTv2.192147558591AC
1/1 (Homozygous variant)
Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay
Yes
rs62214031 located 5 bp away, homozygous alternate, confirmed by Sanger, NextSeq, Proton
rs62214031
9
4/29/2016 11:00:45Justin ZookNISTHG001/NA12878NISTv3.1beta
6 32574624 . A G 0 PASS metal=platinum;cgi=.;bwa_freebayes=HD:0,LOOHD:0;bwa_platypus=HD:0,LOOHD:0;bwa_gatk3=HD:0,LOOHD:0;cortex=.;isaac2=HD:1,LOOHD:1;dist2closest=4 GT 1|0
0/1 (Heterozygous)
Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from other sequencing datasets from NA12878
Yes
many variants in this HLA region - likely true but difficult to resolve all
probably should exclude HLA from high-confidence regions for now
10
4/29/2016 11:02:53Justin ZookNISTHG001/NA12878NISTv3.1beta
4 21932902 . A T 0 PASS metal=platinum;cgi=.;bwa_freebayes=HD:0,LOOHD:0;bwa_platypus=.;bwa_gatk3=HD:0,LOOHD:0;cortex=.;isaac2=HD:0,LOOHD:0;dist2closest=42 GT 1|1
1/1 (Homozygous variant)
Confirmation with second NGS method, Manual inspection of reads from other sequencing datasets from NA12878
Yesnearby indel3.1b miscalls as a het
11
4/29/2016 11:14:53Justin ZookNISTHG001/NA12878NISTv3.1beta
2 739644 . G GA 0 PASS metal=platinum;cgi=.;bwa_freebayes=HD:0,LOOHD:0;bwa_platypus=HD:0,LOOHD:0;bwa_gatk3=HD:0,LOOHD:0;cortex=.;isaac2=HD:0,LOOHD:0;dist2closest=29 GT 1|0
Confirmation with second NGS method, Manual inspection of reads from other sequencing datasets from NA12878
Yes
SNP upstream and others farther, including SV
possibly true insertion in 10bp homopolymer, though not in novoalign mappings which had low coverage, many variants in the region, and a likely SV is downstream
12
4/29/2016 15:55:02Justin ZookNISTHG001/NA12878NISTv3.1beta
2 78910526 . A AT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:495:153
Manual inspection of reads from other sequencing datasets from NA12878
No
This is a 10bp homopolymers and small fraction of Illumina and CG have insertion.
It is unclear
13
4/29/2016 16:09:32Justin ZookNISTHG001/NA12878NISTv3.1beta
2 172123774 . G GTC 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:421:143
Manual inspection of reads from other sequencing datasets from NA12878
No
PG k-mer incorrectly calls deletion. This is a tandem repeat region.
Yes, variant and genotype are correct
14
4/29/2016 16:27:03Justin ZookNISTHG001/NA12878NISTv3.1beta
2 205478771 . AT A 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt GT:PS:DP:GQ 0/1:.:555:109
Manual inspection of reads from other sequencing datasets from NA12878
No
10% of Illumina reads have deletion. This is a 10bp homopolymer. Possibly an SSE.
It is unclearYes, homopolymer
15
4/29/2016 16:42:34Justin ZookNISTHG001/NA12878NISTv3.1beta
3 16918093 . GT G 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:559:103
Manual inspection of reads from other sequencing datasets from NA12878
No
~10% of Illumina and CG reads have evidence of deletion. This is a 6bp homopolymer.
It is unclearYes, homopolymer
16
4/29/2016 16:52:56Justin ZookNISTHG001/NA12878NISTv3.1beta
3 18380321 . A AT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xfreebayes,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:365:181
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads
No
1bp insertion in 10bp homopolymer. Illumina and CG have ~10% of reads supporting reference. In PG father is heterozygous and mother is homozygous so PG is likely correct.
No, Variant is correct but GIAB genotype is incorrect
Yes, homopolymer
17
4/29/2016 17:07:12Justin ZookNISTHG001/NA12878NISTv3.1beta
3 79006193 . G GA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:730:187
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads
No
~10% of Illumina and CG reads have evidence of insertion. This is a 5bp homopolymers. Moleculo has three haplotypes in this region.
No, position is homozygous reference
Yes, homopolymer
18
4/29/2016 17:21:50Justin ZookNISTHG001/NA12878NISTv3.1beta
4 37191158 . C CA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt GT:PS:DP:GQ 0/1:.:567:309
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
~10% Illumina and CG have evidence for insertion. Molecule does not support insertion. This is a 9bp homopolymer.
No, true call is homozygous reference
Yes, homopolymer
19
5/9/2016 13:52:40Justin ZookNISTHG001/NA12878NISTv3.1beta20112015GA0/1 (Heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Yes, variant and genotype are correct
Low MQ
20
5/9/2016 15:02:08Justin ZookNISTHG001/NA12878NISTv3.1beta202090925CT0/1 (Heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Yes, variant and genotype are correct
No
21
5/9/2016 15:04:41Justin ZookNISTHG001/NA12878NISTv3.1beta202479984AG0/1 (Heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
Yes~10 within 200 bp
Yes, variant and genotype are correct
No
22
5/9/2016 15:08:10Justin ZookNISTHG001/NA12878NISTv3.1beta202480035TGCG,CA
1/2 (Compound heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
Yes
adjacent SNPs; near large del
low cov in illumina
Yes, variant and genotype are correct
No
23
5/9/2016 15:11:15Justin ZookNISTHG001/NA12878NISTv3.1beta203044286GGCTCCTGCTCC,TGCTCG
1/2 (Compound heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
another compound het pair downstream
Yes, variant and genotype are correct
No
24
5/9/2016 15:13:13Justin ZookNISTHG001/NA12878NISTv3.1beta2010447120GA0/1 (Heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
Yes, variant and genotype are correct
No
25
5/9/2016 15:16:07Justin ZookNISTHG001/NA12878NISTv3.1beta2011528201TC0/1 (Heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
possible long T homopolymer indel downstream 30bp
Yes, variant and genotype are correct
No
26
5/9/2016 15:20:17Justin ZookNISTHG001/NA12878NISTv3.1beta2017336156CT0/1 (Heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Might be a large CNV, but clear in moleculo and a little evidence in PacBio
It is unclearNo
27
5/9/2016 15:23:55Justin ZookNISTHG001/NA12878NISTv3.1beta2018061537AG0/1 (Heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
May be more complex, but probably not too large, since it is supported well by PacBio
Yes, variant and genotype are correct
No
28
5/9/2016 15:30:28Justin ZookNISTHG001/NA12878NISTv3.1beta207284487CA
0/0 (Homozygous reference)
Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
Yes
SNP downstream looks good
Next to 5 T's. Not in PacBio. In 1/15 moleculo reads and ~10% of illumina on both strands. Likely a sequencing error?
Yes, variant and genotype are correct
No
29
5/9/2016 15:33:25Justin ZookNISTHG001/NA12878NISTv3.1beta2022110086GA
0/0 (Homozygous reference)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
In ~10% of Illumina and 1/13 moleculo. Not in pacbio or CG
Yes, variant and genotype are correct
No
30
5/9/2016 15:38:58Justin ZookNISTHG001/NA12878NISTv3.1beta2016389107GA
0/0 (Homozygous reference)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
In <5% of moleculo and illumina. Not in PacBio or CG
Yes, variant and genotype are correct
No
31
5/9/2016 15:44:01Justin ZookNISTHG001/NA12878NISTv3.1beta2010783438CCAT0/1 (Heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
Yes
AT del in upstream AT repeat, likely homozygous
complex, but likely good
Yes, variant and genotype are correct
Yes, tandem repeat
32
5/9/2016 15:47:06Justin ZookNISTHG001/NA12878NISTv3.1beta2011837479GAG0/1 (Heterozygous)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Looks good in Illumina, CG, and moleculo. Not in PG8
Yes, variant and genotype are correct
Yes, homopolymer
33
5/9/2016 15:55:42Justin ZookNISTHG001/NA12878NISTv3.1beta
20 16421193 . CACAC C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0|1:.:237:160
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
Yes
compound het in CA repeat
Correct but this part of compound het is not left aligned
Yes, tandem repeat
34
5/9/2016 16:01:12Justin ZookNISTHG001/NA12878NISTv3.1beta
20 59933876 . GAC AGG 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xfreebayes,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt;arbitrated=TRUE GT:PS:DP:GQ 0|1:.:259:815
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
Yes
downstream phased SNP
Yes, variant and genotype are correct
No
35
5/9/2016 16:06:23Justin ZookNISTHG001/NA12878NISTv3.1beta2032310237TGT
0/0 (Homozygous reference)
Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
In Illumina-bwa but not novoalign, moleculo, CG, or PacBio so seems unlikely to be true variant
Yes, variant and genotype are correct
No
36
5/9/2016 16:13:47Justin ZookNISTHG001/NA12878NISTv3.1beta2058508810GCG0/1 (Heterozygous)
Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Unclear - should probably expand low confidence regions a bit more
It is unclearYes, homopolymer
37
5/9/2016 16:16:48Justin ZookNISTHG001/NA12878NISTv3.1beta2030089846AAT
0/0 (Homozygous reference)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads
No
In small fraction of illumina and moleculo reads in 10bp homopolymer. Looks unlikely to be true, but not certain
It is unclearYes, homopolymer
38
5/9/2016 16:18:51Justin ZookNISTHG001/NA12878NISTv3.1beta2054146967GTG
0/0 (Homozygous reference)
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
Yes, variant and genotype are correct
Yes, homopolymer
39
5/11/2016 17:14:55Justin ZookNISTHG001/NA12878NISTv3.2
2 193407934 . T TA 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:365:228
Manual inspection of reads from other sequencing datasets from NA12878, abnormal allele balance in Illumina, CG, Molecule and SOLiD
No
This is likely a SSE in multiple technologies or a true variant in a small fraction of the cells as there is evidence for insertion in all technologies.
It is unclearYes, homopolymer
40
5/11/2016 17:37:54Justin ZookNISTHG001/NA12878NISTv3.2
3 18380321 . A AT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xfreebayes,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:365:181
Evidence from phasing using pedigree or long/linked reads
No
Illumina, SOLiD, CG and Moleculo have small fraction of reads supporting reference however PG calls homozygous variant in NA12878 and heterozygous in NA12877.
No, Variant is correct but GIAB genotype is incorrect
Yes, homopolymer
41
5/11/2016 17:45:25Justin ZookNISTHG001/NA12878NISTv3.2
4 37191158 . C CA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:567:309
Manual inspection of reads from other sequencing datasets from NA12878
No
Variant is only in a small fraction of Illumina and CG reads.
No, true call is homozygous reference
Yes, homopolymer
42
5/11/2016 17:51:21Justin ZookNISTHG001/NA12878NISTv3.2
4 101197879 . T A,G 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=4;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 1|2:.:516:641
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
PG incorrectly calls homozygous variant.
Yes, variant and genotype are correct
No
43
5/11/2016 18:06:52Justin ZookNISTHG001/NA12878NISTv3.2
4 119117261 . A G 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt,CS_SolidPE50x50GATKHC_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:417:218
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
Yes
Confident of homozygous SNP at previous position.
This appears to be a true variant in a small fraction of cells.
No
44
5/13/2016 13:43:28Justin ZookNISTHG001/NA12878NISTv3.2
4 138641605 . G GA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 0/1:.:627:221
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads
YesTrue homozygous SNP
Homozygous variant in PGv7 and no call for v8. Not phased properly with heterozygous SNP. Variant is about 80% of CG and Illumina reads.
No, Variant is correct but GIAB genotype is incorrect
Yes, homopolymer
45
5/13/2016 13:51:06Justin ZookNISTHG001/NA12878NISTv3.2
5 27306485 . C CT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:681:280
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads
No
Variant only in 10-20% of Illumina and CG reads.
No, true call is homozygous reference
Yes, homopolymer
46
5/13/2016 14:15:27Justin ZookNISTHG001/NA12878NISTv3.2
5 83046430 . TA T 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:379:261
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
It's in 10-20% of Ilumina, CG and Molecule reads. Either variant in small fraction of cells or SSE.
It is unclearNo
47
5/13/2016 14:24:56Justin ZookNISTHG001/NA12878NISTv3.2
5 84697030 . CT C 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:657:279
Manual inspection of reads from other sequencing datasets from NA12878
No
Variant only in 10-20% of CG and Illumina reads.
No, true call is homozygous reference
Yes, homopolymer
48
5/13/2016 14:37:33Justin ZookNISTHG001/NA12878NISTv3.2
6 109713384 . C CT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:552:279
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Variant only in 15-30% of Illumina, CG and Moleculo reads.
No, true call is homozygous reference
Yes, homopolymer
49
5/13/2016 14:50:20Justin ZookNISTHG001/NA12878NISTv3.2
6 112769586 . A G 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=3;callsetnames=HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 0/1:.:396:316
Manual inspection of reads from other sequencing datasets from NA12878
No
Variant in 85-95% of CG and Illumina reads.
It is unclearNo
50
5/13/2016 15:02:11Justin ZookNISTHG001/NA12878NISTv3.2
6 114480340 . T G 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xGATK,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt,CS_SolidSE75GATKHC_filt GT:PS:DP:GQ 0/1:.:412:243
Manual inspection of reads from other sequencing datasets from NA12878
No
Variant in ~90% of GC, SOLiD and Illumina reads.
It is unclearNo
51
5/13/2016 15:47:06Justin ZookNISTHG001/NA12878NISTv3.2
6 167245524 . T TGATA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:401:148
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
This was an error in PG7 that was fixed in PG8.
Yes, variant and genotype are correct
Yes, tandem repeat
52
5/13/2016 15:55:33Justin ZookNISTHG001/NA12878NISTv3.2
6 168780695 . A C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:220:150
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Long reads show evidence for duplication. Long and short reads have several variants within this region.
It is unclearNo
53
5/13/2016 16:08:09Justin ZookNISTHG001/NA12878NISTv3.2
8 27278795 . CTATTTATTTATTTATTTATTTATT CTATTTATTTATTTATTTATT,C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 2|1:.:343:160
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
SNP phased with shorter deletion.
Error in PG calls
Yes, variant and genotype are correct
Yes, tandem repeat
54
5/13/2016 16:28:11Justin ZookNISTHG001/NA12878NISTv3.2
2 143366875 . T C . PASS MTD=isaac2 GT 1|0
Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
Illumina has low mapping quality reads with multiple variants and high coverage. PacBio has high coverage and some reads with the same phased variant. Probably a duplication in NA12878.
Yes, variant and genotype are correct
55
5/26/2016 14:24:34Justin ZookNISTHG001/NA12878NISTv3.2
8 42384671 . A C 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=4;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:760:923
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
Yes, variant and genotype are correct
No
56
5/26/2016 14:25:52Justin ZookNISTHG001/NA12878NISTv3.2
8 114484792 . T TGAAA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:351:160
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
NoError in PG7
Yes, variant and genotype are correct
Yes, tandem repeat
57
5/26/2016 14:26:48Justin ZookNISTHG001/NA12878NISTv3.2
9 87032826 . T TTTTA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:307:160
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
NoError in PG7
Yes, variant and genotype are correct
Yes, tandem repeat
58
5/26/2016 14:27:42Justin ZookNISTHG001/NA12878NISTv3.2
10 67516838 . T TTTTA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 1/1:.:420:145
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
NoError in PG7
Yes, variant and genotype are correct
Yes, tandem repeat
59
5/26/2016 14:30:15Justin ZookNISTHG001/NA12878NISTv3.2
10 127738581 . C CTGGC 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0|1:.:249:160
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
YesOverlapping deletion
partial compound het in PG
Yes, variant and genotype are correct
Yes, tandem repeat
60
5/26/2016 14:33:01Justin ZookNISTHG001/NA12878NISTv3.2
11 125295399 . CTCCAATAACGATCAGAGAGCAGCCACTGTGCCTTGATGGTTTGCCGTGA C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=1;callsetnames=HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:173:99
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Partially in high-confidence region
Yes, variant and genotype are correct
61
5/26/2016 14:34:34Justin ZookNISTHG001/NA12878NISTv3.2
19 10489509 . ATATCTTATCT ATATCT,A 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 2|1:.:326:160
Manual inspection of reads from other sequencing datasets from this genome, Evidence from phasing using pedigree or long/linked reads
No
compound het with incorrect length in PG7
Yes, variant and genotype are correct
Yes, tandem repeat
62
5/26/2016 20:35:51Justin ZookNISTHG001/NA12878NISTv3.2
1 153697703 . TAC T 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_CGnormal_filt GT:PS:DP:GQ 1/1:.:552:179
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
Yes
nearby compound het in TR
Yes, variant and genotype are correct
Yes, tandem repeat
63
5/26/2016 20:38:52Justin ZookNISTHG001/NA12878NISTv3.2
2 229289081 . G C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:464:160
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
Many phased nearby variants
Probably true but many nearby variants so possibly a duplication
Yes, variant and genotype are correct
No
64
5/26/2016 20:42:00Justin ZookNISTHG001/NA12878NISTv3.2
4 118979242 . CACTTATGAGCA C 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 1/1:.:644:251
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Nomissing in 2.19
Yes, variant and genotype are correct
No
65
5/26/2016 20:44:35Justin ZookNISTHG001/NA12878NISTv3.2
6 72011579 . GAGA G 50 PASS platforms=4;platformnames=Illumina,CG,Ion,Solid;datasets=4;datasetnames=HiSeqPE300x,CGnormal,IonExome,SolidPE50x50bp;callsets=5;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,IonExomeTVC,SolidPE50x50GATKHC;datasetsmissingcall=SolidSE75bp;lowcov=CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:822:1075
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Nomissing in 2.19
Yes, variant and genotype are correct
No
66
5/26/2016 20:50:21Justin ZookNISTHG001/NA12878NISTv3.2
8 116818941 . GAAGGAAAGA G 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt GT:PS:DP:GQ 1/1:.:573:160
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
Multiple nearby deletions. One deletion dearby may be incorrect genotype but outside high confidence region
Yes, variant and genotype are correct
Yes, tandem repeat
67
5/26/2016 20:52:35Justin ZookNISTHG001/NA12878NISTv3.2
11 13069952 . G C 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=4;datasetnames=HiSeqPE300x,CGnormal,SolidPE50x50bp,SolidSE75bp;callsets=5;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidPE50x50GATKHC,SolidSE75GATKHC;datasetsmissingcall=IonExome;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 1|1:.:781:440
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
multiple nearby homozygous SNPs
missed in 2.19
Yes, variant and genotype are correct
No
68
5/26/2016 20:56:08Justin ZookNISTHG001/NA12878NISTv3.2
12 121087853 . TGC T 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=1;callsetnames=HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:172:99
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yesphased SNP and del
partially excluded in 2.19
Yes, variant and genotype are correct
No
69
5/26/2016 20:58:59Justin ZookNISTHG001/NA12878NISTv3.2
16 80203808 . ACATAAAATTATAGCACAATG A 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:668:1111
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
phased SNP ~60bp away
Yes, variant and genotype are correct
No
70
5/26/2016 21:01:05Justin ZookNISTHG001/NA12878NISTv3.2
22 45514995 . CAT C 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=4;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_SolidSE75GATKHC_filt GT:PS:DP:GQ 1/1:.:487:211
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
Yes, variant and genotype are correct
No
71
5/26/2016 21:03:19Justin ZookNISTHG001/NA12878NISTv3.2
X 151572041 . CGT CGTGT,C 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_CGnormal_filt GT:PS:DP:GQ 2|1:.:465:219
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Noerror in 2.19
Yes, variant and genotype are correct
72
5/26/2016 21:07:23Justin ZookNISTHG001/NA12878NISTv2.19
1 39563402 . AG A 8804 PASS DPSum=619;HRun=0;HapNoVar=0;NoPLTot=10;PLCG=386,386,386,65,386,0;PLHSWG=1114,1114,1114,179,1114,0;PLILL250=298,298,298,51,298,0;PLILLCLIA=1231,1231,1231,197,1231,0;PLILLWG=457,457,457,68,457,0;PLIllPCRFree=757,757,757,129,757,0;PLIonEx=13,13,13,3,13,0;PLNCIIonWG=33,33,33,0,33,0;PLPlatGen=3859,3859,3859,634,3859,0;PLXIll=533,533,533,79,533,0;PLXPSolWGLS=123,123,123,10,123,0;PLminsum=1415;PLminsumOverDP=2.29;RPA=14,15,16;RU=A;TrancheABQDmin2=95;TrancheAlignmin2=90;TrancheMapmin2=0;TrancheSSEmin2=0;YesPLtot=0;allalts=AA,A;datasetcalls=11;geno=3;genoMapGood=0;platformbias=ill,ion,cg;platformnames=ill,cg,ion;platforms=3;varType=INDEL GT:DP:GQ:PL 1/1:619:1415:8804,1415,0
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
NoSNP correct in 3.2
No, true call is missing from GIAB calls or both variant and genotype are incorrect
No
73
5/26/2016 21:13:33Justin ZookNISTHG001/NA12878NISTv2.19
2 81081493 . ATCTC A 6944 PASS DPSum=471;HRun=0;HapNoVar=0;NoPLTot=0;PLCG=138,10,0;PLHSWG=659,88,0;PLILL250=589,59,0;PLILLCLIA=311,24,0;PLILLWG=96,9,0;PLIllPCRFree=1076,117,0;PLNCIIonWG=0,5,17;PLPlatGen=3811,418,0;PLXIll=195,23,0;PLXPSolWGLS=86,6,0;PLminsum=742;PLminsumOverDP=1.58;RPA=8,6;RU=TC;TrancheABQDmin2=0;TrancheAlignmin2=0;TrancheMapmin2=0;TrancheSSEmin2=0;YesPLtot=6;allalts=A;datasetcalls=10;geno=3;genoMapGood=6;platformbias=none;platformnames=ill;platforms=1;varType=INDEL GT:DP:GQ:PL 1/1:471:742:6961,759,17
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
error in 2.19 due to variants in adjacent TRs
No, true call is homozygous reference
Yes, tandem repeat
74
5/26/2016 21:23:42Justin ZookNISTHG001/NA12878NISTv2.19
3 127735960 . TGAGACAGAG T 1787 PASS DPSum=259;HRun=2;HapNoVar=0;NoPLTot=0;PLILLCLIA=216,0,2467;PLIllPCRFree=271,0,3117;PLPlatGen=1300,0,12199;PLminsum=1787;PLminsumOverDP=6.9;TrancheABQDmin2=0;TrancheAlignmin2=0;TrancheMapmin2=0;TrancheSSEmin2=90;YesPLtot=3;allalts=T;datasetcalls=3;geno=2;genoMapGood=3;platformbias=none;platformnames=ill;platforms=1;varType=INDEL GT:DP:GQ:PL 0/1:259:1787:1787,0,17783
Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
I don't know
next to long T homopolymer. Deletion is not in PacBio
No, true call is homozygous reference
Yes, homopolymer
75
5/26/2016 21:27:00Justin ZookNISTHG001/NA12878NISTv2.19
4 82007747 . GTAATAA G 3431 PASS DPSum=552;HRun=0;HapNoVar=0;NoPLTot=0;PL454WG=72,0,303;PLHSWG=189,0,1513;PLILL250=261,0,1071;PLILLCLIA=270,0,713;PLILLWG=125,0,65;PLIllPCRFree=441,0,602;PLNCIIonWG=3,0,291;PLPlatGen=2008,0,3329;PLXIll=62,0,599;PLminsum=3431;PLminsumOverDP=6.22;RPA=7,5;RU=TAA;TrancheABQDmin2=0;TrancheAlignmin2=0;TrancheMapmin2=0;TrancheSSEmin2=0;YesPLtot=8;allalts=G;datasetcalls=9;geno=2;genoMapGood=8;platformbias=none;platformnames=ill,454;platforms=2;varType=INDEL GT:DP:GQ:PL 0/1:552:3431:3431,0,8486
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
error in 2.19. Near true het and hom SNP
No, true call is missing from GIAB calls or both variant and genotype are incorrect
76
5/26/2016 21:36:49Justin ZookNISTHG001/NA12878NISTv2.19
6 102743484 . T C 3201 PASS DPSum=407;HRun=2;HapNoVar=0;NoCG;NoPLTot=1;PL454WG=67,0,257;PLCG=0,48,956;PLHSWG=215,0,1048;PLILL250=128,0,775;PLILLCLIA=947,0,957;PLILLWG=0,39,428;PLIllPCRFree=98,0,1006;PLPlatGen=1546,0,2986;PLXIll=251,0,442;PLXPSolWGLS=0,12,149;PLminsum=3201;PLminsumOverDP=7.86;TrancheABQDmin2=90;TrancheAlignmin2=90;TrancheMapmin2=90;TrancheSSEmin2=0;YesPLtot=7;allalts=C;datasetcalls=10;geno=2;genoMapGood=7;platformbias=none;platformnames=ill,454;platforms=2;varType=SNP GT:DP:GQ:PL 0/1:407:3201:3252,51,8048
Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
Yes
Looks likely to be an SV. Is not excluded by high confidence bed in 3.2 or 2.19
It is unclear
77
6/17/2016 16:54:22Justin ZookHG002/AJ SonNISTv3.2.2
1 1661704 . A G . . BS=1661704;Regions=CONF,
map_siren GT:QQ:BD:BK:BI:BVT:BLT .:.:.:.:.:NOCALL:nocall 0/1:232.77:FP:.:
ti:SNP:het
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
I don't know
Difficult to map region but likely true since in pacbio
No, true call is missing from GIAB calls or both variant and genotype are incorrect
No
78
6/17/2016 16:56:04Justin ZookHG002/AJ SonNISTv3.2.2
1 1677120 . A C . . BS=1677120;Regions=CONF,
lowcmp_Human_Full_Genome_TRDB_hg19_150331,lowcmp_Human_Full_Genome_TRDB_hg19_150
331_all_merged,map_l100_m1_e0,map_l100_m2_e0,map_l100_m2_e1,map_l125_m1_e0,map_l
125_m2_e0,map_l125_m2_e1,map_siren GT:QQ:BD:BK:BI:BVT:BLT .:.:.:.:.:NOCALL
:nocall 1/1:76.77:FP:.:tv:SNP:het
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
I don't know
Clear evidence in pacbio - likely hom var but possibly het
No, true call is missing from GIAB calls or both variant and genotype are incorrect
No
79
6/17/2016 16:57:15Justin ZookHG002/AJ SonNISTv3.2.2
1 2050152 . C CTG,CTGTGTGTG . . BS=2050153;Regio
ns=CONF,HG002compoundhet GT:BD:BK:BI:QQ:BVT:BLT 1|2:FN:am:i1_5,i6_15:.:I
NDEL:hetalt
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
SNP in father nearby not inherited
Yes, variant and genotype are correct
Yes, tandem repeat
80
6/17/2016 16:58:23Justin ZookHG002/AJ SonNISTv3.2.2
1 2563532 . A C . . BS=2563532;Regions=CONF
GT:QQ:BD:BK:BI:BVT:BLT 0/0
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
YesMore FPs in poly-C
Yes, variant and genotype are correct
Yes, homopolymer
81
11/9/2016 16:10:10Justin ZookHG001/NA12878NISTv3.3.2
1 7667459 . G GTGGA . PASS MTD=isaac_strelka,bwa_freebayes,bwa_platypus,bwa_gatk;KM=12.14;KFP=0;KFF=0 GT 1|0
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
No, true call is missing from GIAB calls or both variant and genotype are incorrect
Yes, tandem repeat
82
11/9/2016 16:14:19JZHG001/NA12878NISTv3.3.2
1 40283025 . G A . PASS MTD=isaac_strelka,bwa_freebayes,bwa_gatk;KM=5.00;KFP=0;KFF=0 GT 0|1
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
low frequency variant in one 10X haplotype and in pacbio. Inherited correctly in PG, so unclear what is happening
It is unclearNo
83
11/9/2016 16:16:26JZHG001/NA12878NISTv3.3.2
1 63644380 . A ATATATC,ATATATCTATATC 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes;datasetsmissingcall=CGnormal,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 1|2:.:331:0,79,91:0,79,91:99
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
Yes, variant and genotype are correct
Yes, tandem repeat
84
11/9/2016 16:53:35JZHG001/NA12878NISTv3.3.2
1 76807290 . TTTTCTTTC TTTTCTTTCTTTCTTTC,T 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_51to200bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 2|1:.:257:0,71,70:0,71,70:198
Manual inspection of reads from other sequencing datasets from this genome
Nomis-genotype in PG
Yes, variant and genotype are correct
Yes, tandem repeat
85
11/9/2016 16:55:47JZHG001/NA12878NISTv3.3.2
1 105751350 . T TTAAA 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:345:76,99:76,99:198
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
NoFN in PG
Yes, variant and genotype are correct
Yes, tandem repeat
86
11/9/2016 17:00:11JZHG001/NA12878NISTv3.3.2
1 110622663 . A ATCTATTCTAT 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;filt=CS_HiSeqPE300xfreebayes_filt;difficultregion=AllRepeats_51to200bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:172:50,38:50,38:198
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Likely true but another del and ins 100 and 200bp downstream, also in TRs
Yes, variant and genotype are correct
Yes, tandem repeat
87
11/9/2016 17:02:40JZHG001/NA12878NISTv3.3.2
1 242554329 . T TA 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xfreebayes;datasetsmissingcall=HiSeqPE300x,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_CGnormal_callable;filt=CS_HiSeqPE300xfreebayes_filt;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:274:32,14:32,14:124
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
in one haplotype of 10X and CG, so seems likely to be correct, though not in many illumina reads
Yes, variant and genotype are correct
Yes, homopolymer
88
11/9/2016 17:04:58JZHG001/NA12878NISTv3.3.2
2 6810453 rs376388976 GGT G 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 1/1:.:385:1,186:1,186:198
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Nomiscalled 4bp del in PG
Yes, variant and genotype are correct
Yes, tandem repeat
89
11/9/2016 17:06:33JZHG001/NA12878NISTv3.3.2
2 46904585 . GT G 50 PASS platforms=3;platformnames=Illumina,CG,10X;datasets=3;datasetnames=HiSeqPE300x,CGnormal,10XChromium;callsets=4;callsetnames=HiSeqPE300xGATK,CGnormal,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable,CS_CGnormal_callable,CS_HiSeqPE300xfreebayes_callable GT:PS:DP:ADALL:AD:GQ 0/1:.:674:152,159:175,175:394
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
NoFN in PG
Yes, variant and genotype are correct
No
90
11/9/2016 17:08:18JZHG001/NA12878NISTv3.3.2
2 172123774 rs57883612 G GTC 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;filt=CS_10XGATKhaplo_filt;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:421:101,102:101,102:198
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Nocalled a del in PG
Yes, variant and genotype are correct
Yes, tandem repeat
91
11/9/2016 17:11:21JZHG001/NA12878NISTv3.3.2
2 137019290 . C T . PASS MTD=bwa_freebayes;KM=14.40;KFP=0;KFF=0 GT 0/0
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
appears to be FP in PG due to mapping error. not in PacBio and 10X reads with variant are discordant
Yes, variant and genotype are correct
No
92
11/9/2016 17:14:54JZHG001/NA12878NISTv3.3.2
2 143366875 . T C . PASS MTD=isaac_strelka;KM=1.80;KFP=2;KFF=0 GT 0/0
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
multiple phased SNPs in Pacbio reads with this variant and Pacbio has high coverage
Likely a CNV or mapping error based on pacbio high cov
Yes, variant and genotype are correct
No
93
11/9/2016 17:21:43JZHG001/NA12878NISTv3.3.2
2 159243800 . TTATCTA T . PASS MTD=isaac_strelka,bwa_freebayes,bwa_platypus,bwa_gatk;KM=12.62;KFP=0;KFF=0 GT 1|1
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
FN in CG and other callsets are "not callable"
No, true call is missing from GIAB calls or both variant and genotype are incorrect
Yes, tandem repeat
94
11/9/2016 17:24:12JZHG001/NA12878NISTv3.3.2
2 193407934 . T TA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xGATK,CGnormal;datasetsmissingcall=HiSeqPE300x,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable,CS_CGnormal_callable;filt=CS_HiSeqPE300xGATK_filt;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:365:285,36:35,9:228
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
In low fraction of illumina and CG reads but in all reads from one 10X HP so seems likely to be true
Yes, variant and genotype are correct
Yes, homopolymer
95
11/9/2016 17:28:10JZHG001/NA12878NISTv3.3.2
2 207404940 . TACACACACACACACACACAC TACACACACACACACACACACACACACAC,T 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;filt=CS_HiSeqPE300xfreebayes_filt;difficultregion=AllRepeats_51to200bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 2|1:.:201:0,21,91:0,21,91:198
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
PG calls compound del instead of del/ins
Yes, variant and genotype are correct
Yes, tandem repeat
96
11/9/2016 17:30:31JZHG001/NA12878NISTv3.3.2
2 240521404 . CATTCATTA C . PASS MTD=isaac_strelka,bwa_gatk;KM=24.92;KFP=0;KFF=0 GT 1|1
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
FN from CG and other callsets "not callable"
No, true call is missing from GIAB calls or both variant and genotype are incorrect
Yes, tandem repeat
97
11/9/2016 17:33:37JZHG001/NA12878NISTv3.3.2
2 241529084 . T G . PASS MTD=bwa_freebayes;KM=3.80;KFP=0;KFF=1 GT 0/0
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yesnearby true SNP
Likely a GGT SSE that inherits properly in PG due to nearby SNP in homopolymer
Yes, variant and genotype are correct
Yes, homopolymer
98
11/9/2016 20:23:01JZHG001/NA12878NISTv3.3.2
3 14706745 . T TATTG . PASS MTD=bwa_platypus;KM=11.44;KFP=0;KFF=0 GT 0/0
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
Yes
PG double-calls insertion
Yes, variant and genotype are correct
Yes, tandem repeat
99
11/9/2016 20:26:09JZHG001/NA12878NISTv3.3.2
3 29623640 . T TATAG,TATAGATAG 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes;datasetsmissingcall=CGnormal,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 1|2:.:396:0,116,86:0,116,86:99
Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies
No
Erroneous del/ins compound het in PG when actually compound ins
Yes, variant and genotype are correct
Yes, tandem repeat
100
11/10/2016 9:01:23JZHG001/NA12878NISTv3.3.2
3 96651621 . T G 50 PASS platforms=3;platformnames=10X,Illumina,CG;datasets=3;datasetnames=10XChromium,HiSeqPE300x,CGnormal;callsets=3;callsetnames=10XGATKhaplo,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable,CS_CGnormal_callable,CS_HiSeqPE300xfreebayes_callable,CS_10XGATKhaplo_callable;filt=CS_HiSeqPE300xGATK_filt,CS_CGnormal_filt;arbitrated=TRUE GT:PS:DP:ADALL:AD:GQ 0/1:.:438:396,42:0,0:283
Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads
No
Clearly on one haplotype in 10X, but low allele freq in Illumina and CG
Yes, variant and genotype are correct
No
Loading...
 
 
 
Form Responses 1