| A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z | AA | AB | AC | AD | AE | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | Timestamp | Your name | Your email (if this is your first entry) | Your Institution (if this is your first entry) | GIAB Genome | Version of high-confidence calls | Optionally, enter the vcf line (or related vcf lines) here instead of entering chromosome, position, REF, ALT, and genotype below | Chromosome number | Start Position on chromosome | True Reference base(s) | True Alternate base(s) - 2 alternates should be separated by a comma and no space | Genotype in VCF format | What evidence do you have that you are correct? Be as specific as possible. Check all that apply | Did you find any other variants within 50 bp of this variant? | If yes, please give some information about the other variants and how confident you are in them. | Is there any additional information about this variant or region that would be useful for us to know? | rs number of the variant if it is in dbSNP and you know it | Does the GIAB call appear to be correct? | Is this a repetitive region? | Reference assembly | |||||||||||
2 | 2/3/2016 16:17:21 | John Thompson | thompson.john.f@gmail.com | Claritas Genomics | HG001/NA12878 | NISTv2.19 | 1 | 3669201 | A | G | 1/1 (Homozygous variant) | Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay | Yes | Yes. rs10910021 is 4 bp away and is also homozygous alternate (G rather than C). Highly confident. Sanger, NextSeq and Proton | rs10797410 | ||||||||||||||||
3 | 2/3/2016 16:23:29 | John Thompson | thompson.john.f@gmail.com | Claritas Genomics | HG001/NA12878 | NISTv2.19 | 3 | 33138544 | A | G | 1/1 (Homozygous variant) | Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay | Yes | Additional homozygous alternate SNP 5 bp away. rs7614776. Confirmed with Sanger, NextSeq, Proton | rs7614776 | ||||||||||||||||
4 | 2/3/2016 17:10:35 | John Thompson | thompson.john.f@gmail.com | Claritas Genomics | HG001/NA12878 | NISTv2.19 | 6 | 33644768 | A | G | 1/1 (Homozygous variant) | Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay | Yes | rs4713652 located 5 bp away, also homozygous alternate, confirmed with Sanger, NextSeq, Proton | rs2068236 | ||||||||||||||||
5 | 2/3/2016 17:15:44 | John Thompson | thompson.john.f@gmail.com | Claritas Genomics | HG001/NA12878 | NISTv2.19 | 6 | 107077507 | C | A | 0/1 (Heterozygous) | Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay | Yes | rs2054365 Homozygous alternate located 5 bp away. Confirmed via Sanger, NextSeq, Proton | rs72945092 | ||||||||||||||||
6 | 2/3/2016 17:21:48 | John Thompson | thompson.john.f@gmail.com | Claritas Genomics | HG001/NA12878 | NISTv2.19 | 12 | 80650276 | T | TCAAA,TCAAACAAA | 1/2 (Compound heterozygous) | Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay | I don't know | Confirmed by Sanger that this is a heterozygous mess. NextSeq and Proton agree on 1/2 assignment | rs147846753 | ||||||||||||||||
7 | 2/3/2016 17:26:06 | j | t | c | HG001/NA12878 | NISTv2.19 | 17 | 71232804 | G | T | 1/1 (Homozygous variant) | Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay | Yes | rs904383 located 3 bp away. homozygous alternate confirmed by Sanger, NextSeq, Proton | rs904384 | ||||||||||||||||
8 | 2/3/2016 17:33:58 | John Thompson | thompson.john.f@gmail.com | Claritas Genomics | HG001/NA12878 | NISTv2.19 | 21 | 47558591 | A | C | 1/1 (Homozygous variant) | Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay | Yes | rs62214031 located 5 bp away, homozygous alternate, confirmed by Sanger, NextSeq, Proton | rs62214031 | ||||||||||||||||
9 | 4/29/2016 11:00:45 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 6 32574624 . A G 0 PASS metal=platinum;cgi=.;bwa_freebayes=HD:0,LOOHD:0;bwa_platypus=HD:0,LOOHD:0;bwa_gatk3=HD:0,LOOHD:0;cortex=.;isaac2=HD:1,LOOHD:1;dist2closest=4 GT 1|0 | 0/1 (Heterozygous) | Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from other sequencing datasets from NA12878 | Yes | many variants in this HLA region - likely true but difficult to resolve all | probably should exclude HLA from high-confidence regions for now | ||||||||||||||||||||
10 | 4/29/2016 11:02:53 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 4 21932902 . A T 0 PASS metal=platinum;cgi=.;bwa_freebayes=HD:0,LOOHD:0;bwa_platypus=.;bwa_gatk3=HD:0,LOOHD:0;cortex=.;isaac2=HD:0,LOOHD:0;dist2closest=42 GT 1|1 | 1/1 (Homozygous variant) | Confirmation with second NGS method, Manual inspection of reads from other sequencing datasets from NA12878 | Yes | nearby indel | 3.1b miscalls as a het | ||||||||||||||||||||
11 | 4/29/2016 11:14:53 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 2 739644 . G GA 0 PASS metal=platinum;cgi=.;bwa_freebayes=HD:0,LOOHD:0;bwa_platypus=HD:0,LOOHD:0;bwa_gatk3=HD:0,LOOHD:0;cortex=.;isaac2=HD:0,LOOHD:0;dist2closest=29 GT 1|0 | Confirmation with second NGS method, Manual inspection of reads from other sequencing datasets from NA12878 | Yes | SNP upstream and others farther, including SV | possibly true insertion in 10bp homopolymer, though not in novoalign mappings which had low coverage, many variants in the region, and a likely SV is downstream | |||||||||||||||||||||
12 | 4/29/2016 15:55:02 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 2 78910526 . A AT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:495:153 | Manual inspection of reads from other sequencing datasets from NA12878 | No | This is a 10bp homopolymers and small fraction of Illumina and CG have insertion. | It is unclear | |||||||||||||||||||||
13 | 4/29/2016 16:09:32 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 2 172123774 . G GTC 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:421:143 | Manual inspection of reads from other sequencing datasets from NA12878 | No | PG k-mer incorrectly calls deletion. This is a tandem repeat region. | Yes, variant and genotype are correct | |||||||||||||||||||||
14 | 4/29/2016 16:27:03 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 2 205478771 . AT A 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt GT:PS:DP:GQ 0/1:.:555:109 | Manual inspection of reads from other sequencing datasets from NA12878 | No | 10% of Illumina reads have deletion. This is a 10bp homopolymer. Possibly an SSE. | It is unclear | Yes, homopolymer | ||||||||||||||||||||
15 | 4/29/2016 16:42:34 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 3 16918093 . GT G 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:559:103 | Manual inspection of reads from other sequencing datasets from NA12878 | No | ~10% of Illumina and CG reads have evidence of deletion. This is a 6bp homopolymer. | It is unclear | Yes, homopolymer | ||||||||||||||||||||
16 | 4/29/2016 16:52:56 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 3 18380321 . A AT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xfreebayes,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:365:181 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads | No | 1bp insertion in 10bp homopolymer. Illumina and CG have ~10% of reads supporting reference. In PG father is heterozygous and mother is homozygous so PG is likely correct. | No, Variant is correct but GIAB genotype is incorrect | Yes, homopolymer | ||||||||||||||||||||
17 | 4/29/2016 17:07:12 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 3 79006193 . G GA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:730:187 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads | No | ~10% of Illumina and CG reads have evidence of insertion. This is a 5bp homopolymers. Moleculo has three haplotypes in this region. | No, position is homozygous reference | Yes, homopolymer | ||||||||||||||||||||
18 | 4/29/2016 17:21:50 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 4 37191158 . C CA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt GT:PS:DP:GQ 0/1:.:567:309 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | ~10% Illumina and CG have evidence for insertion. Molecule does not support insertion. This is a 9bp homopolymer. | No, true call is homozygous reference | Yes, homopolymer | ||||||||||||||||||||
19 | 5/9/2016 13:52:40 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 112015 | G | A | 0/1 (Heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Yes, variant and genotype are correct | Low MQ | |||||||||||||||||
20 | 5/9/2016 15:02:08 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 2090925 | C | T | 0/1 (Heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Yes, variant and genotype are correct | No | |||||||||||||||||
21 | 5/9/2016 15:04:41 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 2479984 | A | G | 0/1 (Heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | ~10 within 200 bp | Yes, variant and genotype are correct | No | ||||||||||||||||
22 | 5/9/2016 15:08:10 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 2480035 | TG | CG,CA | 1/2 (Compound heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | adjacent SNPs; near large del | low cov in illumina | Yes, variant and genotype are correct | No | |||||||||||||||
23 | 5/9/2016 15:11:15 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 3044286 | GGCTCC | TGCTCC,TGCTCG | 1/2 (Compound heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | another compound het pair downstream | Yes, variant and genotype are correct | No | ||||||||||||||||
24 | 5/9/2016 15:13:13 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 10447120 | G | A | 0/1 (Heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Yes, variant and genotype are correct | No | |||||||||||||||||
25 | 5/9/2016 15:16:07 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 11528201 | T | C | 0/1 (Heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | possible long T homopolymer indel downstream 30bp | Yes, variant and genotype are correct | No | ||||||||||||||||
26 | 5/9/2016 15:20:17 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 17336156 | C | T | 0/1 (Heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Might be a large CNV, but clear in moleculo and a little evidence in PacBio | It is unclear | No | ||||||||||||||||
27 | 5/9/2016 15:23:55 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 18061537 | A | G | 0/1 (Heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | May be more complex, but probably not too large, since it is supported well by PacBio | Yes, variant and genotype are correct | No | ||||||||||||||||
28 | 5/9/2016 15:30:28 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 7284487 | C | A | 0/0 (Homozygous reference) | Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | SNP downstream looks good | Next to 5 T's. Not in PacBio. In 1/15 moleculo reads and ~10% of illumina on both strands. Likely a sequencing error? | Yes, variant and genotype are correct | No | |||||||||||||||
29 | 5/9/2016 15:33:25 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 22110086 | G | A | 0/0 (Homozygous reference) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | In ~10% of Illumina and 1/13 moleculo. Not in pacbio or CG | Yes, variant and genotype are correct | No | ||||||||||||||||
30 | 5/9/2016 15:38:58 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 16389107 | G | A | 0/0 (Homozygous reference) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | In <5% of moleculo and illumina. Not in PacBio or CG | Yes, variant and genotype are correct | No | ||||||||||||||||
31 | 5/9/2016 15:44:01 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 10783438 | C | CAT | 0/1 (Heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | AT del in upstream AT repeat, likely homozygous | complex, but likely good | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||
32 | 5/9/2016 15:47:06 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 11837479 | GA | G | 0/1 (Heterozygous) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Looks good in Illumina, CG, and moleculo. Not in PG8 | Yes, variant and genotype are correct | Yes, homopolymer | ||||||||||||||||
33 | 5/9/2016 15:55:42 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 16421193 . CACAC C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0|1:.:237:160 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | compound het in CA repeat | Correct but this part of compound het is not left aligned | Yes, tandem repeat | ||||||||||||||||||||
34 | 5/9/2016 16:01:12 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 59933876 . GAC AGG 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xfreebayes,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt;arbitrated=TRUE GT:PS:DP:GQ 0|1:.:259:815 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | downstream phased SNP | Yes, variant and genotype are correct | No | ||||||||||||||||||||
35 | 5/9/2016 16:06:23 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 32310237 | TG | T | 0/0 (Homozygous reference) | Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | In Illumina-bwa but not novoalign, moleculo, CG, or PacBio so seems unlikely to be true variant | Yes, variant and genotype are correct | No | ||||||||||||||||
36 | 5/9/2016 16:13:47 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 58508810 | GC | G | 0/1 (Heterozygous) | Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Unclear - should probably expand low confidence regions a bit more | It is unclear | Yes, homopolymer | ||||||||||||||||
37 | 5/9/2016 16:16:48 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 30089846 | A | AT | 0/0 (Homozygous reference) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads | No | In small fraction of illumina and moleculo reads in 10bp homopolymer. Looks unlikely to be true, but not certain | It is unclear | Yes, homopolymer | ||||||||||||||||
38 | 5/9/2016 16:18:51 | Justin Zook | NIST | HG001/NA12878 | NISTv3.1beta | 20 | 54146967 | GT | G | 0/0 (Homozygous reference) | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Yes, variant and genotype are correct | Yes, homopolymer | |||||||||||||||||
39 | 5/11/2016 17:14:55 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 2 193407934 . T TA 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:365:228 | Manual inspection of reads from other sequencing datasets from NA12878, abnormal allele balance in Illumina, CG, Molecule and SOLiD | No | This is likely a SSE in multiple technologies or a true variant in a small fraction of the cells as there is evidence for insertion in all technologies. | It is unclear | Yes, homopolymer | ||||||||||||||||||||
40 | 5/11/2016 17:37:54 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 3 18380321 . A AT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xfreebayes,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:365:181 | Evidence from phasing using pedigree or long/linked reads | No | Illumina, SOLiD, CG and Moleculo have small fraction of reads supporting reference however PG calls homozygous variant in NA12878 and heterozygous in NA12877. | No, Variant is correct but GIAB genotype is incorrect | Yes, homopolymer | ||||||||||||||||||||
41 | 5/11/2016 17:45:25 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 4 37191158 . C CA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:567:309 | Manual inspection of reads from other sequencing datasets from NA12878 | No | Variant is only in a small fraction of Illumina and CG reads. | No, true call is homozygous reference | Yes, homopolymer | ||||||||||||||||||||
42 | 5/11/2016 17:51:21 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 4 101197879 . T A,G 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=4;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 1|2:.:516:641 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | PG incorrectly calls homozygous variant. | Yes, variant and genotype are correct | No | ||||||||||||||||||||
43 | 5/11/2016 18:06:52 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 4 119117261 . A G 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt,CS_SolidPE50x50GATKHC_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:417:218 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | Confident of homozygous SNP at previous position. | This appears to be a true variant in a small fraction of cells. | No | ||||||||||||||||||||
44 | 5/13/2016 13:43:28 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 4 138641605 . G GA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 0/1:.:627:221 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads | Yes | True homozygous SNP | Homozygous variant in PGv7 and no call for v8. Not phased properly with heterozygous SNP. Variant is about 80% of CG and Illumina reads. | No, Variant is correct but GIAB genotype is incorrect | Yes, homopolymer | |||||||||||||||||||
45 | 5/13/2016 13:51:06 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 5 27306485 . C CT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:681:280 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads | No | Variant only in 10-20% of Illumina and CG reads. | No, true call is homozygous reference | Yes, homopolymer | ||||||||||||||||||||
46 | 5/13/2016 14:15:27 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 5 83046430 . TA T 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:379:261 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | It's in 10-20% of Ilumina, CG and Molecule reads. Either variant in small fraction of cells or SSE. | It is unclear | No | ||||||||||||||||||||
47 | 5/13/2016 14:24:56 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 5 84697030 . CT C 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:657:279 | Manual inspection of reads from other sequencing datasets from NA12878 | No | Variant only in 10-20% of CG and Illumina reads. | No, true call is homozygous reference | Yes, homopolymer | ||||||||||||||||||||
48 | 5/13/2016 14:37:33 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 6 109713384 . C CT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:552:279 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Variant only in 15-30% of Illumina, CG and Moleculo reads. | No, true call is homozygous reference | Yes, homopolymer | ||||||||||||||||||||
49 | 5/13/2016 14:50:20 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 6 112769586 . A G 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=3;callsetnames=HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 0/1:.:396:316 | Manual inspection of reads from other sequencing datasets from NA12878 | No | Variant in 85-95% of CG and Illumina reads. | It is unclear | No | ||||||||||||||||||||
50 | 5/13/2016 15:02:11 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 6 114480340 . T G 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xGATK,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt,CS_SolidSE75GATKHC_filt GT:PS:DP:GQ 0/1:.:412:243 | Manual inspection of reads from other sequencing datasets from NA12878 | No | Variant in ~90% of GC, SOLiD and Illumina reads. | It is unclear | No | ||||||||||||||||||||
51 | 5/13/2016 15:47:06 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 6 167245524 . T TGATA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:401:148 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | This was an error in PG7 that was fixed in PG8. | Yes, variant and genotype are correct | Yes, tandem repeat | ||||||||||||||||||||
52 | 5/13/2016 15:55:33 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 6 168780695 . A C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:220:150 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Long reads show evidence for duplication. Long and short reads have several variants within this region. | It is unclear | No | ||||||||||||||||||||
53 | 5/13/2016 16:08:09 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 8 27278795 . CTATTTATTTATTTATTTATTTATT CTATTTATTTATTTATTTATT,C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 2|1:.:343:160 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | SNP phased with shorter deletion. | Error in PG calls | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||
54 | 5/13/2016 16:28:11 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 2 143366875 . T C . PASS MTD=isaac2 GT 1|0 | Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Illumina has low mapping quality reads with multiple variants and high coverage. PacBio has high coverage and some reads with the same phased variant. Probably a duplication in NA12878. | Yes, variant and genotype are correct | |||||||||||||||||||||
55 | 5/26/2016 14:24:34 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 8 42384671 . A C 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=4;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:760:923 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Yes, variant and genotype are correct | No | |||||||||||||||||||||
56 | 5/26/2016 14:25:52 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 8 114484792 . T TGAAA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:351:160 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Error in PG7 | Yes, variant and genotype are correct | Yes, tandem repeat | ||||||||||||||||||||
57 | 5/26/2016 14:26:48 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 9 87032826 . T TTTTA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:307:160 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Error in PG7 | Yes, variant and genotype are correct | Yes, tandem repeat | ||||||||||||||||||||
58 | 5/26/2016 14:27:42 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 10 67516838 . T TTTTA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 1/1:.:420:145 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Error in PG7 | Yes, variant and genotype are correct | Yes, tandem repeat | ||||||||||||||||||||
59 | 5/26/2016 14:30:15 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 10 127738581 . C CTGGC 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0|1:.:249:160 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | Overlapping deletion | partial compound het in PG | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||
60 | 5/26/2016 14:33:01 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 11 125295399 . CTCCAATAACGATCAGAGAGCAGCCACTGTGCCTTGATGGTTTGCCGTGA C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=1;callsetnames=HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:173:99 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Partially in high-confidence region | Yes, variant and genotype are correct | |||||||||||||||||||||
61 | 5/26/2016 14:34:34 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 19 10489509 . ATATCTTATCT ATATCT,A 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 2|1:.:326:160 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from phasing using pedigree or long/linked reads | No | compound het with incorrect length in PG7 | Yes, variant and genotype are correct | Yes, tandem repeat | ||||||||||||||||||||
62 | 5/26/2016 20:35:51 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 1 153697703 . TAC T 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_CGnormal_filt GT:PS:DP:GQ 1/1:.:552:179 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | nearby compound het in TR | Yes, variant and genotype are correct | Yes, tandem repeat | ||||||||||||||||||||
63 | 5/26/2016 20:38:52 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 2 229289081 . G C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:464:160 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | Many phased nearby variants | Probably true but many nearby variants so possibly a duplication | Yes, variant and genotype are correct | No | |||||||||||||||||||
64 | 5/26/2016 20:42:00 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 4 118979242 . CACTTATGAGCA C 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 1/1:.:644:251 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | missing in 2.19 | Yes, variant and genotype are correct | No | ||||||||||||||||||||
65 | 5/26/2016 20:44:35 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 6 72011579 . GAGA G 50 PASS platforms=4;platformnames=Illumina,CG,Ion,Solid;datasets=4;datasetnames=HiSeqPE300x,CGnormal,IonExome,SolidPE50x50bp;callsets=5;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,IonExomeTVC,SolidPE50x50GATKHC;datasetsmissingcall=SolidSE75bp;lowcov=CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:822:1075 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | missing in 2.19 | Yes, variant and genotype are correct | No | ||||||||||||||||||||
66 | 5/26/2016 20:50:21 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 8 116818941 . GAAGGAAAGA G 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt GT:PS:DP:GQ 1/1:.:573:160 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | Multiple nearby deletions. One deletion dearby may be incorrect genotype but outside high confidence region | Yes, variant and genotype are correct | Yes, tandem repeat | ||||||||||||||||||||
67 | 5/26/2016 20:52:35 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 11 13069952 . G C 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=4;datasetnames=HiSeqPE300x,CGnormal,SolidPE50x50bp,SolidSE75bp;callsets=5;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidPE50x50GATKHC,SolidSE75GATKHC;datasetsmissingcall=IonExome;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 1|1:.:781:440 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | multiple nearby homozygous SNPs | missed in 2.19 | Yes, variant and genotype are correct | No | |||||||||||||||||||
68 | 5/26/2016 20:56:08 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 12 121087853 . TGC T 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=1;callsetnames=HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:172:99 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | phased SNP and del | partially excluded in 2.19 | Yes, variant and genotype are correct | No | |||||||||||||||||||
69 | 5/26/2016 20:58:59 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 16 80203808 . ACATAAAATTATAGCACAATG A 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:668:1111 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | phased SNP ~60bp away | Yes, variant and genotype are correct | No | ||||||||||||||||||||
70 | 5/26/2016 21:01:05 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | 22 45514995 . CAT C 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=4;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_SolidSE75GATKHC_filt GT:PS:DP:GQ 1/1:.:487:211 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Yes, variant and genotype are correct | No | |||||||||||||||||||||
71 | 5/26/2016 21:03:19 | Justin Zook | NIST | HG001/NA12878 | NISTv3.2 | X 151572041 . CGT CGTGT,C 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_CGnormal_filt GT:PS:DP:GQ 2|1:.:465:219 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | error in 2.19 | Yes, variant and genotype are correct | |||||||||||||||||||||
72 | 5/26/2016 21:07:23 | Justin Zook | NIST | HG001/NA12878 | NISTv2.19 | 1 39563402 . AG A 8804 PASS DPSum=619;HRun=0;HapNoVar=0;NoPLTot=10;PLCG=386,386,386,65,386,0;PLHSWG=1114,1114,1114,179,1114,0;PLILL250=298,298,298,51,298,0;PLILLCLIA=1231,1231,1231,197,1231,0;PLILLWG=457,457,457,68,457,0;PLIllPCRFree=757,757,757,129,757,0;PLIonEx=13,13,13,3,13,0;PLNCIIonWG=33,33,33,0,33,0;PLPlatGen=3859,3859,3859,634,3859,0;PLXIll=533,533,533,79,533,0;PLXPSolWGLS=123,123,123,10,123,0;PLminsum=1415;PLminsumOverDP=2.29;RPA=14,15,16;RU=A;TrancheABQDmin2=95;TrancheAlignmin2=90;TrancheMapmin2=0;TrancheSSEmin2=0;YesPLtot=0;allalts=AA,A;datasetcalls=11;geno=3;genoMapGood=0;platformbias=ill,ion,cg;platformnames=ill,cg,ion;platforms=3;varType=INDEL GT:DP:GQ:PL 1/1:619:1415:8804,1415,0 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | SNP correct in 3.2 | No, true call is missing from GIAB calls or both variant and genotype are incorrect | No | ||||||||||||||||||||
73 | 5/26/2016 21:13:33 | Justin Zook | NIST | HG001/NA12878 | NISTv2.19 | 2 81081493 . ATCTC A 6944 PASS DPSum=471;HRun=0;HapNoVar=0;NoPLTot=0;PLCG=138,10,0;PLHSWG=659,88,0;PLILL250=589,59,0;PLILLCLIA=311,24,0;PLILLWG=96,9,0;PLIllPCRFree=1076,117,0;PLNCIIonWG=0,5,17;PLPlatGen=3811,418,0;PLXIll=195,23,0;PLXPSolWGLS=86,6,0;PLminsum=742;PLminsumOverDP=1.58;RPA=8,6;RU=TC;TrancheABQDmin2=0;TrancheAlignmin2=0;TrancheMapmin2=0;TrancheSSEmin2=0;YesPLtot=6;allalts=A;datasetcalls=10;geno=3;genoMapGood=6;platformbias=none;platformnames=ill;platforms=1;varType=INDEL GT:DP:GQ:PL 1/1:471:742:6961,759,17 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | error in 2.19 due to variants in adjacent TRs | No, true call is homozygous reference | Yes, tandem repeat | ||||||||||||||||||||
74 | 5/26/2016 21:23:42 | Justin Zook | NIST | HG001/NA12878 | NISTv2.19 | 3 127735960 . TGAGACAGAG T 1787 PASS DPSum=259;HRun=2;HapNoVar=0;NoPLTot=0;PLILLCLIA=216,0,2467;PLIllPCRFree=271,0,3117;PLPlatGen=1300,0,12199;PLminsum=1787;PLminsumOverDP=6.9;TrancheABQDmin2=0;TrancheAlignmin2=0;TrancheMapmin2=0;TrancheSSEmin2=90;YesPLtot=3;allalts=T;datasetcalls=3;geno=2;genoMapGood=3;platformbias=none;platformnames=ill;platforms=1;varType=INDEL GT:DP:GQ:PL 0/1:259:1787:1787,0,17783 | Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | I don't know | next to long T homopolymer. Deletion is not in PacBio | No, true call is homozygous reference | Yes, homopolymer | ||||||||||||||||||||
75 | 5/26/2016 21:27:00 | Justin Zook | NIST | HG001/NA12878 | NISTv2.19 | 4 82007747 . GTAATAA G 3431 PASS DPSum=552;HRun=0;HapNoVar=0;NoPLTot=0;PL454WG=72,0,303;PLHSWG=189,0,1513;PLILL250=261,0,1071;PLILLCLIA=270,0,713;PLILLWG=125,0,65;PLIllPCRFree=441,0,602;PLNCIIonWG=3,0,291;PLPlatGen=2008,0,3329;PLXIll=62,0,599;PLminsum=3431;PLminsumOverDP=6.22;RPA=7,5;RU=TAA;TrancheABQDmin2=0;TrancheAlignmin2=0;TrancheMapmin2=0;TrancheSSEmin2=0;YesPLtot=8;allalts=G;datasetcalls=9;geno=2;genoMapGood=8;platformbias=none;platformnames=ill,454;platforms=2;varType=INDEL GT:DP:GQ:PL 0/1:552:3431:3431,0,8486 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | error in 2.19. Near true het and hom SNP | No, true call is missing from GIAB calls or both variant and genotype are incorrect | |||||||||||||||||||||
76 | 5/26/2016 21:36:49 | Justin Zook | NIST | HG001/NA12878 | NISTv2.19 | 6 102743484 . T C 3201 PASS DPSum=407;HRun=2;HapNoVar=0;NoCG;NoPLTot=1;PL454WG=67,0,257;PLCG=0,48,956;PLHSWG=215,0,1048;PLILL250=128,0,775;PLILLCLIA=947,0,957;PLILLWG=0,39,428;PLIllPCRFree=98,0,1006;PLPlatGen=1546,0,2986;PLXIll=251,0,442;PLXPSolWGLS=0,12,149;PLminsum=3201;PLminsumOverDP=7.86;TrancheABQDmin2=90;TrancheAlignmin2=90;TrancheMapmin2=90;TrancheSSEmin2=0;YesPLtot=7;allalts=C;datasetcalls=10;geno=2;genoMapGood=7;platformbias=none;platformnames=ill,454;platforms=2;varType=SNP GT:DP:GQ:PL 0/1:407:3201:3252,51,8048 | Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | Looks likely to be an SV. Is not excluded by high confidence bed in 3.2 or 2.19 | It is unclear | |||||||||||||||||||||
77 | 6/17/2016 16:54:22 | Justin Zook | HG002/AJ Son | NISTv3.2.2 | 1 1661704 . A G . . BS=1661704;Regions=CONF, map_siren GT:QQ:BD:BK:BI:BVT:BLT .:.:.:.:.:NOCALL:nocall 0/1:232.77:FP:.: ti:SNP:het | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | I don't know | Difficult to map region but likely true since in pacbio | No, true call is missing from GIAB calls or both variant and genotype are incorrect | No | |||||||||||||||||||||
78 | 6/17/2016 16:56:04 | Justin Zook | HG002/AJ Son | NISTv3.2.2 | 1 1677120 . A C . . BS=1677120;Regions=CONF, lowcmp_Human_Full_Genome_TRDB_hg19_150331,lowcmp_Human_Full_Genome_TRDB_hg19_150 331_all_merged,map_l100_m1_e0,map_l100_m2_e0,map_l100_m2_e1,map_l125_m1_e0,map_l 125_m2_e0,map_l125_m2_e1,map_siren GT:QQ:BD:BK:BI:BVT:BLT .:.:.:.:.:NOCALL :nocall 1/1:76.77:FP:.:tv:SNP:het | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | I don't know | Clear evidence in pacbio - likely hom var but possibly het | No, true call is missing from GIAB calls or both variant and genotype are incorrect | No | |||||||||||||||||||||
79 | 6/17/2016 16:57:15 | Justin Zook | HG002/AJ Son | NISTv3.2.2 | 1 2050152 . C CTG,CTGTGTGTG . . BS=2050153;Regio ns=CONF,HG002compoundhet GT:BD:BK:BI:QQ:BVT:BLT 1|2:FN:am:i1_5,i6_15:.:I NDEL:hetalt | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | SNP in father nearby not inherited | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||||
80 | 6/17/2016 16:58:23 | Justin Zook | HG002/AJ Son | NISTv3.2.2 | 1 2563532 . A C . . BS=2563532;Regions=CONF GT:QQ:BD:BK:BI:BVT:BLT 0/0 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | Yes | More FPs in poly-C | Yes, variant and genotype are correct | Yes, homopolymer | |||||||||||||||||||||
81 | 11/9/2016 16:10:10 | Justin Zook | HG001/NA12878 | NISTv3.3.2 | 1 7667459 . G GTGGA . PASS MTD=isaac_strelka,bwa_freebayes,bwa_platypus,bwa_gatk;KM=12.14;KFP=0;KFF=0 GT 1|0 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | No, true call is missing from GIAB calls or both variant and genotype are incorrect | Yes, tandem repeat | ||||||||||||||||||||||
82 | 11/9/2016 16:14:19 | JZ | HG001/NA12878 | NISTv3.3.2 | 1 40283025 . G A . PASS MTD=isaac_strelka,bwa_freebayes,bwa_gatk;KM=5.00;KFP=0;KFF=0 GT 0|1 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | low frequency variant in one 10X haplotype and in pacbio. Inherited correctly in PG, so unclear what is happening | It is unclear | No | |||||||||||||||||||||
83 | 11/9/2016 16:16:26 | JZ | HG001/NA12878 | NISTv3.3.2 | 1 63644380 . A ATATATC,ATATATCTATATC 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes;datasetsmissingcall=CGnormal,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 1|2:.:331:0,79,91:0,79,91:99 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Yes, variant and genotype are correct | Yes, tandem repeat | ||||||||||||||||||||||
84 | 11/9/2016 16:53:35 | JZ | HG001/NA12878 | NISTv3.3.2 | 1 76807290 . TTTTCTTTC TTTTCTTTCTTTCTTTC,T 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_51to200bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 2|1:.:257:0,71,70:0,71,70:198 | Manual inspection of reads from other sequencing datasets from this genome | No | mis-genotype in PG | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||||
85 | 11/9/2016 16:55:47 | JZ | HG001/NA12878 | NISTv3.3.2 | 1 105751350 . T TTAAA 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:345:76,99:76,99:198 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | FN in PG | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||||
86 | 11/9/2016 17:00:11 | JZ | HG001/NA12878 | NISTv3.3.2 | 1 110622663 . A ATCTATTCTAT 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;filt=CS_HiSeqPE300xfreebayes_filt;difficultregion=AllRepeats_51to200bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:172:50,38:50,38:198 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Likely true but another del and ins 100 and 200bp downstream, also in TRs | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||||
87 | 11/9/2016 17:02:40 | JZ | HG001/NA12878 | NISTv3.3.2 | 1 242554329 . T TA 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xfreebayes;datasetsmissingcall=HiSeqPE300x,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_CGnormal_callable;filt=CS_HiSeqPE300xfreebayes_filt;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:274:32,14:32,14:124 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | in one haplotype of 10X and CG, so seems likely to be correct, though not in many illumina reads | Yes, variant and genotype are correct | Yes, homopolymer | |||||||||||||||||||||
88 | 11/9/2016 17:04:58 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 6810453 rs376388976 GGT G 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 1/1:.:385:1,186:1,186:198 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | miscalled 4bp del in PG | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||||
89 | 11/9/2016 17:06:33 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 46904585 . GT G 50 PASS platforms=3;platformnames=Illumina,CG,10X;datasets=3;datasetnames=HiSeqPE300x,CGnormal,10XChromium;callsets=4;callsetnames=HiSeqPE300xGATK,CGnormal,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable,CS_CGnormal_callable,CS_HiSeqPE300xfreebayes_callable GT:PS:DP:ADALL:AD:GQ 0/1:.:674:152,159:175,175:394 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | FN in PG | Yes, variant and genotype are correct | No | |||||||||||||||||||||
90 | 11/9/2016 17:08:18 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 172123774 rs57883612 G GTC 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;filt=CS_10XGATKhaplo_filt;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:421:101,102:101,102:198 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | called a del in PG | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||||
91 | 11/9/2016 17:11:21 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 137019290 . C T . PASS MTD=bwa_freebayes;KM=14.40;KFP=0;KFF=0 GT 0/0 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | appears to be FP in PG due to mapping error. not in PacBio and 10X reads with variant are discordant | Yes, variant and genotype are correct | No | |||||||||||||||||||||
92 | 11/9/2016 17:14:54 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 143366875 . T C . PASS MTD=isaac_strelka;KM=1.80;KFP=2;KFF=0 GT 0/0 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | multiple phased SNPs in Pacbio reads with this variant and Pacbio has high coverage | Likely a CNV or mapping error based on pacbio high cov | Yes, variant and genotype are correct | No | ||||||||||||||||||||
93 | 11/9/2016 17:21:43 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 159243800 . TTATCTA T . PASS MTD=isaac_strelka,bwa_freebayes,bwa_platypus,bwa_gatk;KM=12.62;KFP=0;KFF=0 GT 1|1 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | FN in CG and other callsets are "not callable" | No, true call is missing from GIAB calls or both variant and genotype are incorrect | Yes, tandem repeat | |||||||||||||||||||||
94 | 11/9/2016 17:24:12 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 193407934 . T TA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xGATK,CGnormal;datasetsmissingcall=HiSeqPE300x,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable,CS_CGnormal_callable;filt=CS_HiSeqPE300xGATK_filt;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:365:285,36:35,9:228 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | In low fraction of illumina and CG reads but in all reads from one 10X HP so seems likely to be true | Yes, variant and genotype are correct | Yes, homopolymer | |||||||||||||||||||||
95 | 11/9/2016 17:28:10 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 207404940 . TACACACACACACACACACAC TACACACACACACACACACACACACACAC,T 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;filt=CS_HiSeqPE300xfreebayes_filt;difficultregion=AllRepeats_51to200bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 2|1:.:201:0,21,91:0,21,91:198 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | PG calls compound del instead of del/ins | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||||
96 | 11/9/2016 17:30:31 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 240521404 . CATTCATTA C . PASS MTD=isaac_strelka,bwa_gatk;KM=24.92;KFP=0;KFF=0 GT 1|1 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | FN from CG and other callsets "not callable" | No, true call is missing from GIAB calls or both variant and genotype are incorrect | Yes, tandem repeat | |||||||||||||||||||||
97 | 11/9/2016 17:33:37 | JZ | HG001/NA12878 | NISTv3.3.2 | 2 241529084 . T G . PASS MTD=bwa_freebayes;KM=3.80;KFP=0;KFF=1 GT 0/0 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | nearby true SNP | Likely a GGT SSE that inherits properly in PG due to nearby SNP in homopolymer | Yes, variant and genotype are correct | Yes, homopolymer | ||||||||||||||||||||
98 | 11/9/2016 20:23:01 | JZ | HG001/NA12878 | NISTv3.3.2 | 3 14706745 . T TATTG . PASS MTD=bwa_platypus;KM=11.44;KFP=0;KFF=0 GT 0/0 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | Yes | PG double-calls insertion | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||||
99 | 11/9/2016 20:26:09 | JZ | HG001/NA12878 | NISTv3.3.2 | 3 29623640 . T TATAG,TATAGATAG 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes;datasetsmissingcall=CGnormal,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 1|2:.:396:0,116,86:0,116,86:99 | Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies | No | Erroneous del/ins compound het in PG when actually compound ins | Yes, variant and genotype are correct | Yes, tandem repeat | |||||||||||||||||||||
100 | 11/10/2016 9:01:23 | JZ | HG001/NA12878 | NISTv3.3.2 | 3 96651621 . T G 50 PASS platforms=3;platformnames=10X,Illumina,CG;datasets=3;datasetnames=10XChromium,HiSeqPE300x,CGnormal;callsets=3;callsetnames=10XGATKhaplo,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable,CS_CGnormal_callable,CS_HiSeqPE300xfreebayes_callable,CS_10XGATKhaplo_callable;filt=CS_HiSeqPE300xGATK_filt,CS_CGnormal_filt;arbitrated=TRUE GT:PS:DP:ADALL:AD:GQ 0/1:.:438:396,42:0,0:283 | Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads | No | Clearly on one haplotype in 10X, but low allele freq in Illumina and CG | Yes, variant and genotype are correct | No |