Your email (if this is your first entry)

Your Institution (if this is your first entry)

Version of high-confidence calls

Optionally, enter the vcf line (or related vcf lines) here instead of entering chromosome, position, REF, ALT, and genotype below

Start Position on chromosome

True Alternate base(s) - 2 alternates should be separated by a comma and no space

What evidence do you have that you are correct? Be as specific as possible. Check all that apply

Did you find any other variants within 50 bp of this variant?

If yes, please give some information about the other variants and how confident you are in them.

Is there any additional information about this variant or region that would be useful for us to know?

rs number of the variant if it is in dbSNP and you know it

Does the GIAB call appear to be correct?

thompson.john.f@gmail.com

1/1 (Homozygous variant)

Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay

Yes. rs10910021 is 4 bp away and is also homozygous alternate (G rather than C). Highly confident. Sanger, NextSeq and Proton

thompson.john.f@gmail.com

1/1 (Homozygous variant)

Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay

Additional homozygous alternate SNP 5 bp away. rs7614776. Confirmed with Sanger, NextSeq, Proton

thompson.john.f@gmail.com

1/1 (Homozygous variant)

Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay

rs4713652 located 5 bp away, also homozygous alternate, confirmed with Sanger, NextSeq, Proton

thompson.john.f@gmail.com

Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay

rs2054365 Homozygous alternate located 5 bp away. Confirmed via Sanger, NextSeq, Proton

thompson.john.f@gmail.com

1/2 (Compound heterozygous)

Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay

Confirmed by Sanger that this is a heterozygous mess. NextSeq and Proton agree on 1/2 assignment

1/1 (Homozygous variant)

Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay

rs904383 located 3 bp away. homozygous alternate confirmed by Sanger, NextSeq, Proton

thompson.john.f@gmail.com

1/1 (Homozygous variant)

Sanger confirmation, Confirmation with second NGS method, Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from your assay

rs62214031 located 5 bp away, homozygous alternate, confirmed by Sanger, NextSeq, Proton

6 32574624 . A G 0 PASS metal=platinum;cgi=.;bwa_freebayes=HD:0,LOOHD:0;bwa_platypus=HD:0,LOOHD:0;bwa_gatk3=HD:0,LOOHD:0;cortex=.;isaac2=HD:1,LOOHD:1;dist2closest=4 GT 1|0

Confirmation with high coverage sequencing with same technology as primary assay, Manual inspection of reads from other sequencing datasets from NA12878

many variants in this HLA region - likely true but difficult to resolve all

probably should exclude HLA from high-confidence regions for now

4 21932902 . A T 0 PASS metal=platinum;cgi=.;bwa_freebayes=HD:0,LOOHD:0;bwa_platypus=.;bwa_gatk3=HD:0,LOOHD:0;cortex=.;isaac2=HD:0,LOOHD:0;dist2closest=42 GT 1|1

1/1 (Homozygous variant)

Confirmation with second NGS method, Manual inspection of reads from other sequencing datasets from NA12878

2 739644 . G GA 0 PASS metal=platinum;cgi=.;bwa_freebayes=HD:0,LOOHD:0;bwa_platypus=HD:0,LOOHD:0;bwa_gatk3=HD:0,LOOHD:0;cortex=.;isaac2=HD:0,LOOHD:0;dist2closest=29 GT 1|0

Confirmation with second NGS method, Manual inspection of reads from other sequencing datasets from NA12878

SNP upstream and others farther, including SV

possibly true insertion in 10bp homopolymer, though not in novoalign mappings which had low coverage, many variants in the region, and a likely SV is downstream

2 78910526 . A AT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:495:153

Manual inspection of reads from other sequencing datasets from NA12878

This is a 10bp homopolymers and small fraction of Illumina and CG have insertion.

2 172123774 . G GTC 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:421:143

Manual inspection of reads from other sequencing datasets from NA12878

PG k-mer incorrectly calls deletion. This is a tandem repeat region.

Yes, variant and genotype are correct

2 205478771 . AT A 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt GT:PS:DP:GQ 0/1:.:555:109

Manual inspection of reads from other sequencing datasets from NA12878

10% of Illumina reads have deletion. This is a 10bp homopolymer. Possibly an SSE.

3 16918093 . GT G 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:559:103

Manual inspection of reads from other sequencing datasets from NA12878

~10% of Illumina and CG reads have evidence of deletion. This is a 6bp homopolymer.

3 18380321 . A AT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xfreebayes,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:365:181

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads

1bp insertion in 10bp homopolymer. Illumina and CG have ~10% of reads supporting reference. In PG father is heterozygous and mother is homozygous so PG is likely correct.

No, Variant is correct but GIAB genotype is incorrect

3 79006193 . G GA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:730:187

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads

~10% of Illumina and CG reads have evidence of insertion. This is a 5bp homopolymers. Moleculo has three haplotypes in this region.

No, position is homozygous reference

4 37191158 . C CA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt GT:PS:DP:GQ 0/1:.:567:309

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

~10% Illumina and CG have evidence for insertion. Molecule does not support insertion. This is a 9bp homopolymer.

No, true call is homozygous reference

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Yes, variant and genotype are correct

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Yes, variant and genotype are correct

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Yes, variant and genotype are correct

1/2 (Compound heterozygous)

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

adjacent SNPs; near large del

Yes, variant and genotype are correct

1/2 (Compound heterozygous)

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

another compound het pair downstream

Yes, variant and genotype are correct

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

possible long T homopolymer indel downstream 30bp

Yes, variant and genotype are correct

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Might be a large CNV, but clear in moleculo and a little evidence in PacBio

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

May be more complex, but probably not too large, since it is supported well by PacBio

Yes, variant and genotype are correct

0/0 (Homozygous reference)

Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

SNP downstream looks good

Next to 5 T's. Not in PacBio. In 1/15 moleculo reads and ~10% of illumina on both strands. Likely a sequencing error?

Yes, variant and genotype are correct

0/0 (Homozygous reference)

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

In ~10% of Illumina and 1/13 moleculo. Not in pacbio or CG

Yes, variant and genotype are correct

0/0 (Homozygous reference)

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

In <5% of moleculo and illumina. Not in PacBio or CG

Yes, variant and genotype are correct

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

AT del in upstream AT repeat, likely homozygous

Yes, variant and genotype are correct

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Looks good in Illumina, CG, and moleculo. Not in PG8

Yes, variant and genotype are correct

20 16421193 . CACAC C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0|1:.:237:160

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

compound het in CA repeat

Correct but this part of compound het is not left aligned

20 59933876 . GAC AGG 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xfreebayes,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt;arbitrated=TRUE GT:PS:DP:GQ 0|1:.:259:815

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

downstream phased SNP

Yes, variant and genotype are correct

0/0 (Homozygous reference)

Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

In Illumina-bwa but not novoalign, moleculo, CG, or PacBio so seems unlikely to be true variant

Yes, variant and genotype are correct

Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Unclear - should probably expand low confidence regions a bit more

0/0 (Homozygous reference)

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads

In small fraction of illumina and moleculo reads in 10bp homopolymer. Looks unlikely to be true, but not certain

0/0 (Homozygous reference)

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

2 193407934 . T TA 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:365:228

Manual inspection of reads from other sequencing datasets from NA12878, abnormal allele balance in Illumina, CG, Molecule and SOLiD

This is likely a SSE in multiple technologies or a true variant in a small fraction of the cells as there is evidence for insertion in all technologies.

3 18380321 . A AT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xfreebayes,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:365:181

Evidence from phasing using pedigree or long/linked reads

Illumina, SOLiD, CG and Moleculo have small fraction of reads supporting reference however PG calls homozygous variant in NA12878 and heterozygous in NA12877.

No, Variant is correct but GIAB genotype is incorrect

4 37191158 . C CA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:567:309

Manual inspection of reads from other sequencing datasets from NA12878

Variant is only in a small fraction of Illumina and CG reads.

No, true call is homozygous reference

4 101197879 . T A,G 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=4;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 1|2:.:516:641

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

PG incorrectly calls homozygous variant.

Yes, variant and genotype are correct

4 119117261 . A G 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt,CS_SolidPE50x50GATKHC_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:417:218

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Confident of homozygous SNP at previous position.

This appears to be a true variant in a small fraction of cells.

4 138641605 . G GA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 0/1:.:627:221

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads

Homozygous variant in PGv7 and no call for v8. Not phased properly with heterozygous SNP. Variant is about 80% of CG and Illumina reads.

No, Variant is correct but GIAB genotype is incorrect

5 27306485 . C CT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:681:280

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from phasing using pedigree or long/linked reads

Variant only in 10-20% of Illumina and CG reads.

No, true call is homozygous reference

5 83046430 . TA T 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:379:261

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

It's in 10-20% of Ilumina, CG and Molecule reads. Either variant in small fraction of cells or SSE.

5 84697030 . CT C 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:657:279

Manual inspection of reads from other sequencing datasets from NA12878

Variant only in 10-20% of CG and Illumina reads.

No, true call is homozygous reference

6 109713384 . C CT 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:552:279

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Variant only in 15-30% of Illumina, CG and Moleculo reads.

No, true call is homozygous reference

6 112769586 . A G 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=3;callsetnames=HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 0/1:.:396:316

Manual inspection of reads from other sequencing datasets from NA12878

Variant in 85-95% of CG and Illumina reads.

6 114480340 . T G 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xGATK,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt,CS_SolidPE50x50GATKHC_filt,CS_SolidSE75GATKHC_filt GT:PS:DP:GQ 0/1:.:412:243

Manual inspection of reads from other sequencing datasets from NA12878

Variant in ~90% of GC, SOLiD and Illumina reads.

6 167245524 . T TGATA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:401:148

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

This was an error in PG7 that was fixed in PG8.

Yes, variant and genotype are correct

6 168780695 . A C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:220:150

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Long reads show evidence for duplication. Long and short reads have several variants within this region.

8 27278795 . CTATTTATTTATTTATTTATTTATT CTATTTATTTATTTATTTATT,C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 2|1:.:343:160

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

SNP phased with shorter deletion.

Yes, variant and genotype are correct

2 143366875 . T C . PASS MTD=isaac2 GT 1|0

Manual inspection of reads from other sequencing datasets from NA12878, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Illumina has low mapping quality reads with multiple variants and high coverage. PacBio has high coverage and some reads with the same phased variant. Probably a duplication in NA12878.

Yes, variant and genotype are correct

8 42384671 . A C 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=4;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:760:923

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

8 114484792 . T TGAAA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:351:160

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

9 87032826 . T TTTTA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:307:160

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

10 67516838 . T TTTTA 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 1/1:.:420:145

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

10 127738581 . C CTGGC 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0|1:.:249:160

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

partial compound het in PG

Yes, variant and genotype are correct

11 125295399 . CTCCAATAACGATCAGAGAGCAGCCACTGTGCCTTGATGGTTTGCCGTGA C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=1;callsetnames=HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:173:99

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Partially in high-confidence region

Yes, variant and genotype are correct

19 10489509 . ATATCTTATCT ATATCT,A 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 2|1:.:326:160

Manual inspection of reads from other sequencing datasets from this genome, Evidence from phasing using pedigree or long/linked reads

compound het with incorrect length in PG7

Yes, variant and genotype are correct

1 153697703 . TAC T 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_CGnormal_filt GT:PS:DP:GQ 1/1:.:552:179

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

nearby compound het in TR

Yes, variant and genotype are correct

2 229289081 . G C 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xGATK_filt GT:PS:DP:GQ 0/1:.:464:160

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Many phased nearby variants

Probably true but many nearby variants so possibly a duplication

Yes, variant and genotype are correct

4 118979242 . CACTTATGAGCA C 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 1/1:.:644:251

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

6 72011579 . GAGA G 50 PASS platforms=4;platformnames=Illumina,CG,Ion,Solid;datasets=4;datasetnames=HiSeqPE300x,CGnormal,IonExome,SolidPE50x50bp;callsets=5;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,IonExomeTVC,SolidPE50x50GATKHC;datasetsmissingcall=SolidSE75bp;lowcov=CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov GT:PS:DP:GQ 0/1:.:822:1075

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

8 116818941 . GAAGGAAAGA G 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt GT:PS:DP:GQ 1/1:.:573:160

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Multiple nearby deletions. One deletion dearby may be incorrect genotype but outside high confidence region

Yes, variant and genotype are correct

11 13069952 . G C 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=4;datasetnames=HiSeqPE300x,CGnormal,SolidPE50x50bp,SolidSE75bp;callsets=5;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidPE50x50GATKHC,SolidSE75GATKHC;datasetsmissingcall=IonExome;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_SolidPE50x50GATKHC_filt GT:PS:DP:GQ 1|1:.:781:440

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

multiple nearby homozygous SNPs

Yes, variant and genotype are correct

12 121087853 . TGC T 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=1;callsetnames=HiSeqPE300xGATK;datasetsmissingcall=HiSeqPE300x,CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_CGnormal_lowcov,CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_HiSeqPE300xfreebayes_filt;arbitrated=TRUE GT:PS:DP:GQ 0/1:.:172:99

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

16 80203808 . ACATAAAATTATAGCACAATG A 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_CGnormal_filt GT:PS:DP:GQ 0/1:.:668:1111

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

phased SNP ~60bp away

Yes, variant and genotype are correct

22 45514995 . CAT C 50 PASS platforms=3;platformnames=Illumina,CG,Solid;datasets=3;datasetnames=HiSeqPE300x,CGnormal,SolidSE75bp;callsets=4;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal,SolidSE75GATKHC;datasetsmissingcall=IonExome,SolidPE50x50bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_SolidSE75GATKHC_filt GT:PS:DP:GQ 1/1:.:487:211

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

X 151572041 . CGT CGTGT,C 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=3;callsetnames=HiSeqPE300xfreebayes,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;lowcov=CS_IonExomeTVC_lowcov,CS_SolidPE50x50GATKHC_lowcov,CS_SolidSE75GATKHC_lowcov;filt=CS_CGnormal_filt GT:PS:DP:GQ 2|1:.:465:219

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

1 39563402 . AG A 8804 PASS DPSum=619;HRun=0;HapNoVar=0;NoPLTot=10;PLCG=386,386,386,65,386,0;PLHSWG=1114,1114,1114,179,1114,0;PLILL250=298,298,298,51,298,0;PLILLCLIA=1231,1231,1231,197,1231,0;PLILLWG=457,457,457,68,457,0;PLIllPCRFree=757,757,757,129,757,0;PLIonEx=13,13,13,3,13,0;PLNCIIonWG=33,33,33,0,33,0;PLPlatGen=3859,3859,3859,634,3859,0;PLXIll=533,533,533,79,533,0;PLXPSolWGLS=123,123,123,10,123,0;PLminsum=1415;PLminsumOverDP=2.29;RPA=14,15,16;RU=A;TrancheABQDmin2=95;TrancheAlignmin2=90;TrancheMapmin2=0;TrancheSSEmin2=0;YesPLtot=0;allalts=AA,A;datasetcalls=11;geno=3;genoMapGood=0;platformbias=ill,ion,cg;platformnames=ill,cg,ion;platforms=3;varType=INDEL GT:DP:GQ:PL 1/1:619:1415:8804,1415,0

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

No, true call is missing from GIAB calls or both variant and genotype are incorrect

2 81081493 . ATCTC A 6944 PASS DPSum=471;HRun=0;HapNoVar=0;NoPLTot=0;PLCG=138,10,0;PLHSWG=659,88,0;PLILL250=589,59,0;PLILLCLIA=311,24,0;PLILLWG=96,9,0;PLIllPCRFree=1076,117,0;PLNCIIonWG=0,5,17;PLPlatGen=3811,418,0;PLXIll=195,23,0;PLXPSolWGLS=86,6,0;PLminsum=742;PLminsumOverDP=1.58;RPA=8,6;RU=TC;TrancheABQDmin2=0;TrancheAlignmin2=0;TrancheMapmin2=0;TrancheSSEmin2=0;YesPLtot=6;allalts=A;datasetcalls=10;geno=3;genoMapGood=6;platformbias=none;platformnames=ill;platforms=1;varType=INDEL GT:DP:GQ:PL 1/1:471:742:6961,759,17

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

error in 2.19 due to variants in adjacent TRs

No, true call is homozygous reference

3 127735960 . TGAGACAGAG T 1787 PASS DPSum=259;HRun=2;HapNoVar=0;NoPLTot=0;PLILLCLIA=216,0,2467;PLIllPCRFree=271,0,3117;PLPlatGen=1300,0,12199;PLminsum=1787;PLminsumOverDP=6.9;TrancheABQDmin2=0;TrancheAlignmin2=0;TrancheMapmin2=0;TrancheSSEmin2=90;YesPLtot=3;allalts=T;datasetcalls=3;geno=2;genoMapGood=3;platformbias=none;platformnames=ill;platforms=1;varType=INDEL GT:DP:GQ:PL 0/1:259:1787:1787,0,17783

Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

next to long T homopolymer. Deletion is not in PacBio

No, true call is homozygous reference

4 82007747 . GTAATAA G 3431 PASS DPSum=552;HRun=0;HapNoVar=0;NoPLTot=0;PL454WG=72,0,303;PLHSWG=189,0,1513;PLILL250=261,0,1071;PLILLCLIA=270,0,713;PLILLWG=125,0,65;PLIllPCRFree=441,0,602;PLNCIIonWG=3,0,291;PLPlatGen=2008,0,3329;PLXIll=62,0,599;PLminsum=3431;PLminsumOverDP=6.22;RPA=7,5;RU=TAA;TrancheABQDmin2=0;TrancheAlignmin2=0;TrancheMapmin2=0;TrancheSSEmin2=0;YesPLtot=8;allalts=G;datasetcalls=9;geno=2;genoMapGood=8;platformbias=none;platformnames=ill,454;platforms=2;varType=INDEL GT:DP:GQ:PL 0/1:552:3431:3431,0,8486

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

error in 2.19. Near true het and hom SNP

No, true call is missing from GIAB calls or both variant and genotype are incorrect

6 102743484 . T C 3201 PASS DPSum=407;HRun=2;HapNoVar=0;NoCG;NoPLTot=1;PL454WG=67,0,257;PLCG=0,48,956;PLHSWG=215,0,1048;PLILL250=128,0,775;PLILLCLIA=947,0,957;PLILLWG=0,39,428;PLIllPCRFree=98,0,1006;PLPlatGen=1546,0,2986;PLXIll=251,0,442;PLXPSolWGLS=0,12,149;PLminsum=3201;PLminsumOverDP=7.86;TrancheABQDmin2=90;TrancheAlignmin2=90;TrancheMapmin2=90;TrancheSSEmin2=0;YesPLtot=7;allalts=C;datasetcalls=10;geno=2;genoMapGood=7;platformbias=none;platformnames=ill,454;platforms=2;varType=SNP GT:DP:GQ:PL 0/1:407:3201:3252,51,8048

Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Looks likely to be an SV. Is not excluded by high confidence bed in 3.2 or 2.19

1 1661704 . A G . . BS=1661704;Regions=CONF,
map_siren GT:QQ:BD:BK:BI:BVT:BLT .:.:.:.:.:NOCALL:nocall 0/1:232.77:FP:.:
ti:SNP:het

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Difficult to map region but likely true since in pacbio

No, true call is missing from GIAB calls or both variant and genotype are incorrect

1 1677120 . A C . . BS=1677120;Regions=CONF,
lowcmp_Human_Full_Genome_TRDB_hg19_150331,lowcmp_Human_Full_Genome_TRDB_hg19_150
331_all_merged,map_l100_m1_e0,map_l100_m2_e0,map_l100_m2_e1,map_l125_m1_e0,map_l
125_m2_e0,map_l125_m2_e1,map_siren GT:QQ:BD:BK:BI:BVT:BLT .:.:.:.:.:NOCALL
:nocall 1/1:76.77:FP:.:tv:SNP:het

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Clear evidence in pacbio - likely hom var but possibly het

No, true call is missing from GIAB calls or both variant and genotype are incorrect

1 2050152 . C CTG,CTGTGTGTG . . BS=2050153;Regio
ns=CONF,HG002compoundhet GT:BD:BK:BI:QQ:BVT:BLT 1|2:FN:am:i1_5,i6_15:.:I
NDEL:hetalt

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

SNP in father nearby not inherited

Yes, variant and genotype are correct

1 2563532 . A C . . BS=2563532;Regions=CONF
GT:QQ:BD:BK:BI:BVT:BLT 0/0

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Yes, variant and genotype are correct

1 7667459 . G GTGGA . PASS MTD=isaac_strelka,bwa_freebayes,bwa_platypus,bwa_gatk;KM=12.14;KFP=0;KFF=0 GT 1|0

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

No, true call is missing from GIAB calls or both variant and genotype are incorrect

1 40283025 . G A . PASS MTD=isaac_strelka,bwa_freebayes,bwa_gatk;KM=5.00;KFP=0;KFF=0 GT 0|1

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

low frequency variant in one 10X haplotype and in pacbio. Inherited correctly in PG, so unclear what is happening

1 63644380 . A ATATATC,ATATATCTATATC 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes;datasetsmissingcall=CGnormal,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 1|2:.:331:0,79,91:0,79,91:99

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

1 76807290 . TTTTCTTTC TTTTCTTTCTTTCTTTC,T 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_51to200bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 2|1:.:257:0,71,70:0,71,70:198

Manual inspection of reads from other sequencing datasets from this genome

Yes, variant and genotype are correct

1 105751350 . T TTAAA 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:345:76,99:76,99:198

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

1 110622663 . A ATCTATTCTAT 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;filt=CS_HiSeqPE300xfreebayes_filt;difficultregion=AllRepeats_51to200bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:172:50,38:50,38:198

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Likely true but another del and ins 100 and 200bp downstream, also in TRs

Yes, variant and genotype are correct

1 242554329 . T TA 50 PASS platforms=2;platformnames=CG,Illumina;datasets=2;datasetnames=CGnormal,HiSeqPE300x;callsets=2;callsetnames=CGnormal,HiSeqPE300xfreebayes;datasetsmissingcall=HiSeqPE300x,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_CGnormal_callable;filt=CS_HiSeqPE300xfreebayes_filt;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:274:32,14:32,14:124

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

in one haplotype of 10X and CG, so seems likely to be correct, though not in many illumina reads

Yes, variant and genotype are correct

2 6810453 rs376388976 GGT G 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 1/1:.:385:1,186:1,186:198

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

2 46904585 . GT G 50 PASS platforms=3;platformnames=Illumina,CG,10X;datasets=3;datasetnames=HiSeqPE300x,CGnormal,10XChromium;callsets=4;callsetnames=HiSeqPE300xGATK,CGnormal,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable,CS_CGnormal_callable,CS_HiSeqPE300xfreebayes_callable GT:PS:DP:ADALL:AD:GQ 0/1:.:674:152,159:175,175:394

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

2 172123774 rs57883612 G GTC 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;filt=CS_10XGATKhaplo_filt;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:421:101,102:101,102:198

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

2 137019290 . C T . PASS MTD=bwa_freebayes;KM=14.40;KFP=0;KFF=0 GT 0/0

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

appears to be FP in PG due to mapping error. not in PacBio and 10X reads with variant are discordant

Yes, variant and genotype are correct

2 143366875 . T C . PASS MTD=isaac_strelka;KM=1.80;KFP=2;KFF=0 GT 0/0

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

multiple phased SNPs in Pacbio reads with this variant and Pacbio has high coverage

Likely a CNV or mapping error based on pacbio high cov

Yes, variant and genotype are correct

2 159243800 . TTATCTA T . PASS MTD=isaac_strelka,bwa_freebayes,bwa_platypus,bwa_gatk;KM=12.62;KFP=0;KFF=0 GT 1|1

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

FN in CG and other callsets are "not callable"

No, true call is missing from GIAB calls or both variant and genotype are incorrect

2 193407934 . T TA 50 PASS platforms=2;platformnames=Illumina,CG;datasets=2;datasetnames=HiSeqPE300x,CGnormal;callsets=2;callsetnames=HiSeqPE300xGATK,CGnormal;datasetsmissingcall=HiSeqPE300x,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable,CS_CGnormal_callable;filt=CS_HiSeqPE300xGATK_filt;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 0/1:.:365:285,36:35,9:228

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

In low fraction of illumina and CG reads but in all reads from one 10X HP so seems likely to be true

Yes, variant and genotype are correct

2 207404940 . TACACACACACACACACACAC TACACACACACACACACACACACACACAC,T 50 PASS platforms=2;platformnames=Illumina,10X;datasets=2;datasetnames=HiSeqPE300x,10XChromium;callsets=3;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes,10XGATKhaplo;datasetsmissingcall=CGnormal,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;filt=CS_HiSeqPE300xfreebayes_filt;difficultregion=AllRepeats_51to200bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 2|1:.:201:0,21,91:0,21,91:198

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

PG calls compound del instead of del/ins

Yes, variant and genotype are correct

2 240521404 . CATTCATTA C . PASS MTD=isaac_strelka,bwa_gatk;KM=24.92;KFP=0;KFF=0 GT 1|1

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

FN from CG and other callsets "not callable"

No, true call is missing from GIAB calls or both variant and genotype are incorrect

2 241529084 . T G . PASS MTD=bwa_freebayes;KM=3.80;KFP=0;KFF=1 GT 0/0

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Likely a GGT SSE that inherits properly in PG due to nearby SNP in homopolymer

Yes, variant and genotype are correct

3 14706745 . T TATTG . PASS MTD=bwa_platypus;KM=11.44;KFP=0;KFF=0 GT 0/0

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Yes, variant and genotype are correct

3 29623640 . T TATAG,TATAGATAG 50 PASS platforms=1;platformnames=Illumina;datasets=1;datasetnames=HiSeqPE300x;callsets=2;callsetnames=HiSeqPE300xGATK,HiSeqPE300xfreebayes;datasetsmissingcall=CGnormal,10XChromium,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=AllRepeats_lt51bp_gt95identity_merged_slop5 GT:PS:DP:ADALL:AD:GQ 1|2:.:396:0,116,86:0,116,86:99

Manual inspection of reads from other sequencing datasets from this genome, Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies

Erroneous del/ins compound het in PG when actually compound ins

Yes, variant and genotype are correct

3 96651621 . T G 50 PASS platforms=3;platformnames=10X,Illumina,CG;datasets=3;datasetnames=10XChromium,HiSeqPE300x,CGnormal;callsets=3;callsetnames=10XGATKhaplo,HiSeqPE300xGATK,CGnormal;datasetsmissingcall=HiSeqPE300x,IonExome,SolidPE50x50bp,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable,CS_CGnormal_callable,CS_HiSeqPE300xfreebayes_callable,CS_10XGATKhaplo_callable;filt=CS_HiSeqPE300xGATK_filt,CS_CGnormal_filt;arbitrated=TRUE GT:PS:DP:ADALL:AD:GQ 0/1:.:438:396,42:0,0:283

Evidence from long reads, linked reads, long mate-pairs, or other long-range technologies, Evidence from phasing using pedigree or long/linked reads

Clearly on one haplotype in 10X, but low allele freq in Illumina and CG

Yes, variant and genotype are correct