2013_09_30 Gibson - build pTrc Msip34_2177 glucose plasmid
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
2013_09_30 GIBSON -
Oligo Design:
PCR band descriptionforward primerreverse primerforward Tmreverse Tmbp expectedtemplate212cctctgacacatgcagctccc
pCM66T pTrc25625769.770.25533pJ72 (pTrc RFP pCM66T)214accgtctccgggagctgcatgtgtcagaggttagaaaaactcatcgagcatcaaatgaaa
Oligo Design
Set up PCR
RECORD PCR products, gibson assemblies, etc.
Gibson Assembly