Account Options>

  1. Sign in
2013_09_30 Gibson - build pTrc Msip34_2177 glucose plasmid
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
$
%
123
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
|
 
Still loading...
ABCDEFGHIJKLMNOPQRS
1
2013_09_30 GIBSON -
2
3
Oligo Design:
4
PCR band descriptionforward primerreverse primerforward Tmreverse Tmbp expectedtemplate212cctctgacacatgcagctccc
5
Msip34_217725425569.869.81526SIP3-4213agtaaagcgctggctgctgaac
6
pCM66T pTrc25625769.770.25533pJ72 (pTrc RFP pCM66T)214accgtctccgggagctgcatgtgtcagaggttagaaaaactcatcgagcatcaaatgaaa
7
215gggggttcagcagccagcgctttactaactgtctgcttacataaacagtaatacaagggg
8
216ttattagctcggcattgcgattg
9
217atgagcctggaagataaggacctgc
10
218aagagaagcaagcaatcgcaatgccgagctaataaGTCTTGTCGGTCACATTGAGAATGC
11
219gatgctacgcaggtccttatcttccaggctcatTAAGCATCAAATTCCAGGGATTAAACC
12
220agagaagcaagcaatcgcaatgccgagctaataaGGTTTCGTGGTAGACCAAAACAAGCT
13
221atgctacgcaggtccttatcttccaggctcatTTGAGTTAATGCCACGATGTACTTCCTC
14
222gagcgatactgagcgaagcaagtg
15
223cgggcactgctcgacgcacttgcttcgctcagtatcgctcCCGAAGCAAGCAGGACCATG
16
224CTGTCAGACCAAGTTTACTCATATATAC
17
225AGCTGTTTCCTGTGTGAAATTG
18
226ccggcatccgcttacagaca
19
227gtgagcggataacaatttcacacaggaaacagctGGTTTCGTGGTAGACCAAAACAAGCT
20
228agctgtttcctgtgtgaaattgttatcc
21
229ATGGCAAGTAGTGAAGACGTTATCAAAGAGTT
22
230AACTCTTTGATAACGTCTTCACTACTTGCCATTTGAGTTAATGCCACGATGTACTTCCTC
23
231TTATTAAGCACCGGTGGAGTGACG
24
232ACGAACGTGCTGAAGGTCGTCACTCCACCGGTGCTTAATAAttaagccagccccgacacc
25
233cactcattaggcaccccaggc
26
234gcctggggtgcctaatgagtg
27
235atgtgagttagctcactcattaggcaccccaggcGGTTTCGTGGTAGACCAAAACAAGCT
28
236CAAAGCCAAGAACCCAGGCAC
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
Loading...
 
 
 
Oligo Design
Set up PCR
RECORD PCR products, gibson assemblies, etc.
Gibson Assembly
Transformations