R75 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79E1E2E3E4E5E6E7E8E9
2
1IsedceteShort Stacks 23108771
GGAAACUCGCGAAAAUGCAAACCCAACCGAAAAGGAAACGAAAUAAAGUAGGAUUACCAGGGAAAGAGGCUCGCCUUCGGGCGAGCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
5.764good93.30.1441.5820.8630.47880.64620.80831.09360.37130.19420.25270.3530.28641.00290.86051.15441.07461.15191.35961.00590.80590.52931.05411.22310.69810.129300.03950.8320.78440.20940.36970.7410.88681.37551.27320.76690.74480.54651.5131.5320.96670.50661.50821.68332.01451.96341.71682.08941.59681.61040.66190.71860.29050.47251.20460.99921.2691.72261.30460.61020.52850.73610.23630.27030.39631.61241.2691.14820.61850.70851.08340.52980.28130.16630.12450.13030.28160.71191.79740.40780.47591.18910.310.20660.2020.20080.1310.15290.13490.12750.1181
3
2ClosureShort Stacks 23113078
GGAAAGCGGCGAAAAUGCAAACCCAACCGAAAUGGAAGGUAAAAGAGCCAGUGAGAGCAGGGAAACGCGAGCGUCUUCGGACGCUCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
4.943
medium
93.30.1151.2680.6920.76840.33720.98120.50340.3530.17190.07360.14690.12220.62930.79710.81091.27791.80421.31441.04630.58870.1760.7791.3840.7372-0.026-0.01810.0840.86650.5793-0.01850.14940.76851.76761.89391.18730.40540.23520.44920.29980.30090.49420.71881.00811.93020.68131.14550.60310.95010.89590.28370.08760.20820.80011.74590.98631.27171.02460.97671.44810.76420.63560.39070.26360.50560.4121.79631.53011.1340.59940.24530.39820.21020.59850.35650.24880.12570.09130.28081.14820.51910.1610.98820.29940.19760.18550.14180.12410.09760.07740.09290.0881
4
3ConclusionShort Stacks 23113087
GGAAAGGCCCGAAAAUGGAAACCCAACCGAAAUGGAAGGUAAAAGAGCCAGCGAAUGCAGGGAAAGCCGUAGAUCUUCGGAUCUACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.872good920.1231.420.7720.36610.32840.680.7120.25460.28640.4540.05280.06620.32480.55941.53771.08851.3071.2490.36110.32910.32670.6631.28681.07140.40020.04890.07750.45770.52170.05650.06990.98922.30422.60921.30990.69860.21630.31530.37190.19730.28380.43160.87892.84161.98171.63440.99821.49651.2230.77140.12330.15420.9160.78860.99391.47312.78182.35691.98130.62650.67170.86440.20880.31010.42251.30711.32011.15271.13450.29430.26170.05890.12150.22280.14930.26470.14590.34720.96040.27440.60330.65750.18560.08560.1140.10420.06430.08140.08040.05260.0406
5
4TerminationShort Stacks 23113094
GGAAAGAGGCGAAAAUGCAAAUGCAACCGAAAAGGAAGGGAAAGAAACCACAGAAAUGAGCAAAACUCGGUCUGCUUCGGCAGACCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
6.871good880.1461.6110.8790.76590.87431.03270.67890.71630.61070.22590.48660.21341.00230.85781.30291.11751.49771.13090.78750.4170.38751.18092.17641.65780.96510.37170.48381.03840.79650.12580.17711.37961.21251.67711.28990.55530.40720.89881.48310.66550.26890.37560.89221.83441.91741.49171.14791.44891.64720.97890.31040.4810.96650.64621.04091.39631.791.65811.44590.71430.92411.82350.90440.94791.12141.32621.73790.97240.44670.28220.27170.23420.08770.21850.43420.25230.1080.10420.72210.5640.31540.34160.2620.1820.18320.15820.1530.14410.10730.12030.0886
6
5JR_Short2_Rnd1_Sub1Short Stacks 23113941
GGAAACGGGCGAAAAUGCAAGGCCAAGCGAAAAGCAACCGAACACAAGGACCGAAAGGAGGCAAACCGCAUCAUCUUCGGAUGAUGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.645good960.1371.5090.8230.59650.98561.29971.20690.47130.22470.12980.14130.17261.48341.36791.65760.92511.63771.36440.84550.45690.52691.11590.62950.74230.40530.28960.58511.34121.47630.45790.70050.48691.35791.77861.6311.69250.50760.18631.51461.10430.19120.0780.61861.93461.67871.43560.95720.83741.58690.57370.47281.46591.40450.22010.2390.6911.80661.92230.88710.470.75920.60520.80920.99740.69511.52341.91671.18990.28980.24090.32150.13770.12210.07960.12610.33390.17980.25440.88840.36420.53470.50010.20060.14270.14740.14180.09620.06620.05450.0560.0706
7
6With Ham and EggsShort Stacks 23114007
GGAAAGCCGCGAAAAUGCAAAGUCAACCGAAAAGGAAGCAAAAGAAGGCAGCGAGAGCAGACAAAGGCGUCAUAGUUCGCUAUGACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
9.12good920.1441.5860.8650.68470.83881.26080.87480.70630.15280.04480.16330.10870.89661.07611.00930.98611.37871.63130.72630.45560.31061.45561.31231.67952.37420.2460.48811.16490.88170.1720.23331.09111.17491.76571.4050.59410.29270.63741.00841.20980.71180.4781.56271.84851.81881.58631.96231.83110.68491.0970.37710.25380.88340.55660.20810.83790.64831.30451.46580.57590.34660.87061.60791.71540.90811.57121.69360.70341.0860.53930.71160.24190.12160.15080.23950.17840.27490.47311.32660.39880.880.53140.19090.13170.14540.11630.10540.05770.05430.06920.0699
8
7sstack1Short Stacks 23114020
GGAAAGCGCCGAAAAUGGGAGGGCAAGGGAAAACCAACGGAAAGAAACGAGGGAAACCAGUCAAACGCGUCGCUGUUCGCAGUGACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
10.309strong93.30.1291.420.7740.48340.56551.14870.6740.63440.01760.34080.48750.0510.18490.99221.9961.16291.56151.71370.67090.50110.48990.87990.52410.39050.71280.28770.48271.28040.6680.48940.32950.62461.32021.33991.32370.65680.12550.42060.80861.27760.17410.3190.87182.76293.01141.21021.38891.19421.06550.5060.16540.41030.40660.27380.31170.40591.65141.40280.79420.19170.15240.63951.14441.07950.84061.48341.67570.7030.77670.28880.51430.15050.14060.10030.12060.14320.11120.89231.56790.32560.94871.01720.15810.10840.10730.08560.09030.03550.06050.07750.0305
9
8sstack2Short Stacks 23114027
GGAAAGCGCCGAUAAUGGGAGGUCAAGGGAAUACCAACGGAAAGAAACGAGGGAAACCAGACAAACGCGUCUCUGUUCGCAGAGACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
6.826good94.70.131.4330.7820.54330.70321.28820.74220.70630.09040.34180.52590.16020.17751.10982.92032.02742.32021.93720.57280.44940.51460.88840.56821.76950.47210.20470.44731.88711.08640.32690.11690.31130.85881.58051.01160.56990.07720.34751.17551.20290.13620.33990.79562.56243.30681.46361.42591.14721.08160.39390.15590.28460.23970.11250.10280.24160.6480.89760.50740.19330.10.18430.41080.6340.64961.77952.30841.13750.85140.30670.50430.21470.17830.04350.10820.23110.10770.55181.52650.54830.83250.6360.26110.17430.17880.14960.14630.06450.10020.12910.0762
10
9sstack3Short Stacks 23114041
GGAAACCGGCGAUAAUGCGAGGUCAAGGGAAUACCAACCGAAAGAUAGGAGCGAAAGCAGACAAACGGCUGUGUGUUCGCACACAGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
7.151good93.30.1431.570.8560.39660.84981.27451.0920.75020.07090.09430.25260.25040.28381.33132.11191.40391.70261.49731.21340.6060.39120.98730.77440.85460.47190.36911.0571.28190.59750.16960.15640.71551.95632.14312.32281.5590.19290.3240.7910.69830.08980.2350.58232.10491.89651.1141.46242.41451.58690.75780.61811.27931.22050.50680.5060.53291.25891.00181.22390.44420.43510.79041.49481.4670.88071.39291.42670.5670.16550.2850.48240.20380.30750.21220.11770.32250.07040.29721.48960.39370.54420.65220.26010.16720.17290.16020.15170.05950.06440.08850.1113
11
10try 1Short Stacks 23114568
GGAAAGGCCCGAAAAUGGAAACCGAAGCAAUAAGCAAGCAAAUAAAAGCAGCAUAAGCACGGAAAGCCCAUAAUAUUCGUAUUGUGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
9.437good93.30.1341.4730.8040.88680.48711.64360.90880.29620.51670.4870.19170.20040.80170.4981.34341.31541.76641.38520.42570.69770.63711.12561.38421.20610.04180.09070.34491.70071.57870.18430.20710.55711.21591.05981.07360.96280.25350.25361.03821.79210.24780.32141.36521.98243.83111.47322.10411.39711.18431.28960.31540.20160.61160.30870.31870.67930.92470.9970.77260.16910.20020.38220.14870.3170.58951.49161.24821.10160.65990.39710.12360.18750.56330.73221.24081.43570.78841.02960.98160.27620.52991.0090.19780.11030.1430.11750.0660.08240.08690.05540.0657
12
11try 2Short Stacks 23114570
GGAAAGGCCCGAAAAUGGAAACCGAAGCGAUAAGCAAGCGAAUAAAAGCAGCGUAAGCACGGAAAGCCCUUAGAUUUCGAUUUGAGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.502good89.30.1251.3770.7510.95520.54481.36310.76650.27730.26440.39340.18710.19780.6541.15522.03071.52041.74051.8140.45670.61030.62971.35491.45821.35550.09260.0430.31431.78252.10820.15360.03780.25650.38710.3480.34130.34620.1230.2081.16561.9340.19830.18361.01861.98353.98961.19241.62671.25851.37571.52790.26970.13410.54980.15770.1050.19450.3160.57520.35190.05290.15990.24040.07190.27160.22161.33311.09241.16450.40910.23470.15330.22650.47780.69450.75311.69830.92330.54290.91220.25660.60981.08530.21020.12630.1490.11640.08810.0690.08760.06960.0705
13
12try 3Short Stacks 23114581
GGAAAGGCCCGAAAAUGGAAACCGAAGCGAUAAGCAAGCGAAUAAAAGCAGCGUAAGCACGGAAAGCCGUUAUUAUUCGUGAUGACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
10.302strong86.70.1161.2740.6951.30570.49661.22850.84110.32030.6280.46590.150.12070.32790.53130.91460.81640.87791.09850.43320.40750.5260.87561.23111.12270.11170.09670.37661.8191.8810.19680.12780.19380.56010.42860.35040.34560.14910.14121.0151.59870.23050.13410.99421.94033.55551.05831.74941.21221.2441.41320.29930.10270.30650.07450.11960.18890.60430.58420.45830.15690.20620.28990.11830.33440.4281.47131.19580.92410.75190.14860.09610.3951.1391.14491.68011.29830.88741.27930.72730.26040.40560.26320.16580.08150.10920.08820.06060.07770.07150.0510.0445
14
13SS2-Z2Short Stacks 23116147
GGAAAGCCGCGAUUAUGCAAAGCCAAGCGAUUAGCAAGCGAAUUAAAGCAGCGAAAGCAGGCAAAGGCGUAGUGCUUCGGCACUACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
9.532good97.30.0991.0910.5950.67830.67341.30710.7050.62530.14690.08940.13040.08170.1431.44990.85731.28781.37021.54070.98720.59230.23150.77330.83710.85060.11550.06920.11520.5691.28250.13470.03350.43350.44561.01290.48390.62780.20090.15090.93851.52070.23290.11350.84321.78483.36962.37381.70621.391.091.4290.25460.06660.08950.03160.16840.05920.23550.3940.24710.10590.04840.39810.33320.23170.19331.03041.30610.59770.55230.26760.25420.11210.28310.20760.15680.16710.11240.29480.69010.33020.50860.43140.1680.09890.11340.07840.07870.04120.03470.03940.0432
15
14SS2-Z3Short Stacks 23116153
GGAAAGCCGCGAAAAUGCAAAGCCAAGCGAAAAGCAAGCGAAUUAAAGCAGCGAAAGCAGGCAAAGGCGUAGUGCUUCGGCGCUACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.27good93.30.1411.5540.8471.05571.20171.6710.74660.53370.0870.01450.11470.22230.99891.01981.63351.25521.83351.69061.44970.50410.32921.01160.93381.38180.19820.08450.13320.84971.37060.26970.8480.7551.11882.07571.4931.29170.27260.35281.05912.00910.30180.16591.01852.35754.11372.62591.88951.79981.57131.80620.30020.15540.16260.3480.78560.27551.48341.36811.09170.20790.1820.4510.41640.24280.23611.3951.61430.88190.69350.40220.31010.28630.2030.35590.32120.35790.170.20230.79260.37780.3860.26010.23550.16250.1890.12130.11380.05490.03680.07450.0866
16
15AlternativeShort Stacks 23117413
GGAAAGCCGCGAAAAUGCAAAGCCAAGCUAAAUGCAAGGUAAAGAAUCCACCUAACGGAGGCAAAGGCGUCUCACUUCGGUGAGACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
10.433strong98.70.111.210.660.93410.82931.27660.83470.5460.15950.02370.22640.12090.62690.92621.13870.78491.20471.30540.9240.4660.2590.73840.78590.84710.29010.04290.13370.36450.66820.24030.23590.76921.41141.8131.49280.94310.180.25130.47010.53860.33010.31830.55161.88952.07751.50611.8981.3471.85860.59310.15260.2890.41480.51220.61761.25891.42940.70280.34240.30130.52390.17470.37020.42810.34671.08191.4720.87420.51320.25230.35190.21490.16390.08290.16530.14760.10960.47960.82630.28670.77270.5230.15560.09760.10910.08440.07070.05580.03210.05140.0467
17
16Little Lines 2Short Stacks 23120570
GGAAACCGGCGAAAAUGCAAAGUCAAGGGAAAACCAAGCGAAUAAAUGCAGAGAAAUCAGACAAACGGGAUUAGCUUCGGCUAAUCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
7.153good90.70.1731.9521.0620.40180.78241.69741.63080.86310.05810.0310.3090.3190.58750.84081.9521.04541.41121.9051.34141.0650.37510.81481.45642.70251.48790.93960.58930.99480.55610.12540.48130.78651.19421.66322.5731.74770.10080.28630.92311.08880.62390.66111.41682.94772.97062.16732.24611.74542.58941.38950.41210.3650.40460.5531.32811.762.15712.43091.57971.16380.75550.9671.93391.72341.01151.67292.08870.81740.20520.31520.41650.13980.12560.10990.12660.23120.24410.42991.27880.34620.72720.87780.27450.21220.23960.22270.16890.0990.06120.11340.1143
18
17Kcatstack - Brourd - Lab Short Stacks 2 R1 - Sub 3 (-3.3 -3.4 -3.3)Short Stacks 23124137
GGAAAGGCCCGAAAAUGGAAAGUCAACCGAAAAGGAAGCGAAAUAAAGCAGGGAAACCAGACAAAGCCGACUGAGUUCGCUCAGUCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
9.224good94.70.1681.851.0090.77660.62111.26710.91480.26630.25050.19950.17580.09620.42471.10662.37670.8411.62541.49180.51260.77560.88641.32171.40271.63351.82970.47830.45891.37610.91550.16650.42281.03451.40392.05722.04530.63760.55680.80831.15321.44830.34620.28181.14472.11252.66322.81841.85741.98111.97992.13930.76730.54840.7120.26580.32530.45221.91182.00891.24020.28930.32070.70041.83051.95090.85441.71361.38781.14970.71250.31530.30160.36490.28310.20460.2210.59010.33140.71091.55440.40730.87110.8620.20660.13090.15990.13910.08030.07830.08280.06860.0698
19
18Trohshort - Brourd - Lab Short Stacks 2 R1 - Sub 2.1 (-3.4 Quads)Short Stacks 23124141
GGAAAGGCGGGAAAAUCCAAAGUCAAGCGAAAAGCAAGCGAAAUAAAGCAGCGAAAGCAGACAAAGCCGACUGUCUUCGGACAGUCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
7.165good97.30.1411.5510.8461.52680.25991.27530.78670.58190.28050.06690.03760.18330.67971.23462.05461.34041.74032.37181.31760.5030.50631.41841.34341.53030.56390.19240.2311.21211.5510.21780.63670.45461.47341.61531.39811.09450.36570.17161.06311.7860.32290.1850.84612.10363.24612.85411.48191.82971.50871.86550.27370.20920.17380.10390.32160.40171.44891.17811.0910.33230.17990.49330.78420.54770.41271.33831.37021.19970.54320.19820.23570.23490.15370.25220.19240.24420.06880.29330.88060.47760.50680.25260.27260.13240.18810.13580.13190.10630.05810.0770.0777
20
19UstiarmaShort Stacks 23124497
GGAAAGUGGCGAAAAUGCAAGGUGAACGGAAAACGAACGGAAAAUAACGACGGAGACGACACAAACACGUUCCGCUUCGGCGGAACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
7.14good920.1511.6590.9050.80921.08221.52690.63891.02440.59330.26680.6880.40860.92950.88821.38631.19571.82721.3721.64950.50630.52731.18810.5361.26781.06470.35151.33891.34540.4250.00750.55160.63762.09651.54591.44320.68580.16150.64441.99221.06190.11180.49061.0382.53672.55032.73382.14981.84591.70130.78370.34320.57760.46440.19950.25890.55630.66322.02060.68870.26770.18920.44430.30420.38710.22570.78030.81050.69950.34320.35020.38350.19710.87921.96751.38330.7310.47290.92071.47570.34590.34760.6360.240.19260.19590.14570.17770.12890.09480.14660.1232
21
20Short Stacks 2.1Short Stacks 23125554
GGAAAGGCGCGAUAAUGCAAAGUCAAGCGAUAAGCAAGCUAAUAAAGGCAGCGAAAGCAGACAAAGCCCAUGCAGUUCGCUGCAUGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
10.041strong880.1261.3810.7530.71990.61831.04320.77230.33330.3670.17030.15290.11020.26081.1181.90221.181.60141.5281.14540.88120.38440.95671.15411.21120.83620.47070.3551.1251.71550.2210.17140.56731.38141.0230.9991.00760.28050.28441.21461.31350.31060.28261.3373.22652.3411.01461.61271.36930.65340.63870.180.12460.12090.1270.21380.21240.75330.91060.73710.37230.11160.46820.95461.25530.91121.36121.48991.07760.50050.22930.31740.29730.56950.24490.11680.20370.59790.40890.90770.27180.51030.28140.18520.10210.11760.09130.07210.06590.04850.04660.0414
22
21Fiskers Short stacks 2 D2Short Stacks 23125579
GGAAAGCCGCGAAAAUGCAAAGCCAAGCGAAAAGCAAGCGAAAUAAAGCAGCGAAAGCAGGCAAAGGCCUCUAGCUUCGGCUAGAGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.11good97.30.1491.6440.8971.44961.29911.62240.96140.65770.10420.11190.12760.13530.9771.20981.82691.15611.53061.77131.0150.4910.27941.08691.17911.26840.21120.05460.3211.38311.74630.14740.75160.52551.20151.89051.85411.25850.46150.27710.97091.79660.36050.19651.22252.26493.35153.57621.85161.62241.5891.71130.39260.26450.33690.19210.69980.43951.84021.39921.51960.33320.18390.51120.40750.25610.27811.25621.62190.69930.90920.44560.34640.30150.25390.1630.08990.31760.14350.5271.62260.38390.48961.110.25140.18250.1980.1430.12120.07780.0630.06560.0668
23
22Fiskers Short stacks 2 D3Short Stacks 23125586
GGAAAGCCGCGAAAAUGCAAAGUCAAGCGAAAAGCAAGCGAAAUAAAGCAGCGAAAGCAGACAAAGGCGUCAACCUUCGGGUUGACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
6.678good97.30.1431.5690.8561.06351.03631.50720.97160.9220.21590.04570.11740.13670.98111.28651.79591.24961.21981.35771.03040.69050.50271.30151.30531.56120.83130.33910.44270.77251.76950.34430.4620.67141.23571.72451.70171.08590.15030.22471.28551.98610.21470.26071.08011.98833.05432.54731.66531.65111.41851.73270.38780.27750.44920.12520.50590.32991.41830.8911.12650.35070.21540.5470.57240.90160.40221.23381.53680.79730.51140.19280.5660.15970.15230.15030.12120.15030.130.45391.17580.36030.70810.90930.3070.18180.20750.16260.15780.09080.08790.0750.0783
24
23Meechl SS2Short Stacks 23125982
GGAAAGAGGCGAAAAUGCAAAGACAAGCUAAAGGCAAGGUAAAGAAUCCAGCGAAAGCAGUCAAACUCCAAGAUCUUCGGAUCUUGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
12.653strong97.30.151.6480.8990.74290.93221.08121.11140.47350.38430.19370.56390.28090.89051.27641.33481.00071.67991.36911.53340.76010.50811.23591.10670.92520.75950.36820.36091.39041.35260.30890.39430.59421.52381.89930.65711.69630.41380.40281.23430.72820.66910.7391.85334.43322.69481.69161.8691.80652.43460.98380.19470.12360.18120.13610.37680.82071.47551.11870.71180.29030.16321.06130.59510.33730.37531.55022.23360.94240.59270.1880.21960.35650.19060.06270.1170.21650.36870.44411.3320.32261.19380.35120.14980.10580.10640.09870.07540.06440.05020.07450.0568
25
2415.1 @ 67Short Stacks 23129410
GGAAAGGCCCGAAAAUGGAAACCCAACCAAAAUGGAACCUAUAAAAUGGAGCAAAUGCAGGGAAAGCCCAUAAUAUUCGUAUUAUGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
9.794good94.70.1371.5060.8220.65640.47220.72420.61650.20390.30270.28330.12940.04960.47140.43231.43011.10521.42941.36060.51170.41380.43711.50141.45820.87130.50320.10810.15250.73650.92140.33880.44621.04820.96851.44081.59980.35780.46030.76651.63840.87840.20510.22061.0712.35281.81132.10351.41541.65491.15290.49190.39450.51651.1771.31280.93051.17771.73791.59881.58620.77180.72950.7210.17230.30110.46691.30281.00080.9310.63560.20.28770.13630.10280.16190.21410.29470.17590.86671.6270.42230.91171.51120.16020.09940.09670.09040.06170.06330.06150.04570.0337
26
25Mat - Short Stacks 2 D2Short Stacks 23129427
GGAAAGCCGCGAAAAUGCAAAGUCAAGGGAAAACCAAGCGAAAUAAAGCAGCGAAAGCAGACAAAGGCGAGUACGUUCGCGUACUCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.855good93.30.1661.8250.9950.60561.2951.76460.83050.67550.31530.10490.16110.130.99721.41621.86171.40931.53661.77951.13720.50670.44821.41081.39561.70041.41180.90250.74941.21290.62450.25920.64680.67911.73471.91672.94911.60430.31770.16151.2071.7040.41090.2571.38942.81982.8163.23661.70811.8251.77862.2560.6990.33570.69730.17060.44290.3562.09411.47390.9810.47920.22030.7611.50911.55350.731.4311.74161.02790.88040.45950.36980.19460.21660.17490.22830.40230.25110.57481.04310.54420.80170.42320.25480.18580.18960.14320.14240.09080.06210.07120.0814
27
26Mat - Short Stacks 2 D3Short Stacks 23129433
GGAAAGCCGCGAAAAUGCAAAGUCAAGGGAAAACCAAGCGAAAUAAAGCAGCGAAAGCAGACAAAGGCGAGUCUCUUCGGAGACUCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
6.44good94.70.1591.7490.9540.47930.98451.58160.80720.63190.25690.05130.12810.1930.69551.21461.56321.14261.13661.49190.99680.62890.25131.37531.18011.93051.02530.78330.66160.87840.62010.22410.64310.61581.40012.13722.66162.04410.21210.28241.23471.59620.32170.37441.3422.81493.13462.61191.47092.07291.93761.69310.42890.34520.55580.51230.50210.26791.43251.38191.32070.32170.30080.73331.56381.88210.95121.44921.64140.82930.75580.23310.23260.27880.45290.51930.29630.19060.08670.20750.89920.48860.36790.45860.3290.22540.23350.17490.15780.11310.07210.09070.1259
28
27Denney s short stack LEShort Stacks 23129885
GGAAAGGCGCGAAAAUGCAAAGCCAAGCGAAAAGCAAGCGAAAUAAAGCAGCGAAAGCAGGCAAAGCCGCCGCGCUUCGGCGCGGCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
3.665
medium
90.70.1361.4920.8141.54470.51121.0470.76610.2010.45250.21230.15880.10571.04050.87272.13641.31490.71941.38021.04480.55040.381.26750.75141.11250.17310.04320.31561.60951.33050.08370.64950.36331.22821.58561.51170.96820.46230.42251.04871.65720.73230.24320.95641.72332.98232.43871.73181.64561.11281.65410.33150.22280.78960.24540.21480.21410.51290.64910.8610.27010.10270.25590.38160.40460.31461.60831.8151.62430.63680.13020.20610.74720.96871.54540.64660.22550.05370.57450.84030.17260.31240.78220.54310.23760.3040.26920.1770.22360.17860.16570.1511
29
28silver dollarShort Stacks 23136797
GGAAAGCCGCGAAAAUGCAAAGUCAACCGAAAAGGAAGCGAAAUAAAGCAGCGAAAGCAGACAAAGGCGUAGAGCUUCGGCUCUACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
7.9good94.70.1441.5870.8660.69211.13351.54641.19950.70030.11220.03080.14210.27920.7080.8721.33110.97581.34351.4330.96930.48080.26820.95161.05651.55681.540.36530.32220.87330.97270.14830.1640.71221.02211.85561.4920.53080.18960.32220.9151.39230.2410.28941.13092.38252.67752.62921.6771.97321.73892.12620.48190.22410.5440.31510.49470.41821.39621.49471.0650.37110.25410.7551.42211.73270.94861.51481.86720.74450.71570.38620.38490.23690.16610.180.10960.38640.3030.47980.91010.46310.72590.53780.25420.17760.18840.15440.12190.09540.04440.06670.0842
30
29JR_Short2_Rnd1_Sub2Short Stacks 23147751
GGAAAGCGGCGAAAAUGCAAACCGAACCAAAAAGGAACCAAAAAAAAGGAGCUAACGCACGGAAACGCCGAAGACUUCGGUCUUCGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
6.365good920.1131.2870.70.70930.52321.18860.9460.67760.29640.02960.10350.07140.52410.5121.23330.95911.24391.08150.89820.31370.28040.96821.31110.71550.11310.11280.71731.061.16760.70850.59011.08171.50341.62541.13980.48920.31520.59791.12551.2420.94090.72670.45170.66032.50081.83481.52691.60062.12160.82650.23930.24420.57170.43830.22740.57390.9960.57120.42980.16510.21530.87720.38820.81580.57981.76061.57060.50760.37730.74930.22880.17370.06130.08570.12980.13720.08980.2410.50610.29990.27050.29670.24550.1660.15290.14840.13140.08630.04630.06140.0557
31
30BuckwheatShort Stacks 23152777
GGAAACGGGCGAAAAUGCAAAGCCAAGGGAAAACCAAGCUAAAGAAUGCAGCGAAAGCAGGCAAACCGGUCUACCUUCGGGUAGACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
6.781good960.1411.5560.8491.15551.12031.25791.50140.28510.07940.08590.23690.14421.08441.26012.15341.39611.55341.14141.1450.65980.35640.9650.92190.80680.25470.14290.43881.40130.56570.08170.33661.02381.41632.0192.75081.75250.38470.27420.7231.07820.2130.39240.99992.16872.97021.28561.95232.24222.18311.16090.33730.37630.36310.46230.4160.51041.24091.23391.15940.43760.17230.46551.45410.81810.4721.3041.95720.99960.28030.19410.2860.23020.34360.43740.07980.07460.14380.28890.99970.48090.81870.32540.26140.20160.19440.19590.13050.06810.09490.09410.1027
32
31Chocolate ChipShort Stacks 23152914
GGAAACGGGCGAUGAUGCAAAGCCAACCCAAAGGGAAGCAAAAAAAAGCAGCGAAAGCAGGCAAACCGGUCUUGGUUCGCCAAGACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
6.308good960.1241.3690.7470.30950.73231.2471.26340.40490.19710.17450.31670.10230.25011.25431.40030.30981.20791.60271.07240.39430.66071.16470.99891.35960.4330.07560.45790.96650.85190.39830.48840.85251.68281.77930.51020.31560.34990.61250.89931.24450.9830.50340.31270.4721.75731.13321.83661.70961.53931.75410.73790.42830.75030.40790.38070.64661.49131.04051.21860.27970.26490.39331.18450.98530.38220.79371.9170.98550.09940.10120.48830.39920.11060.04150.09940.20060.19750.27260.86640.33920.80960.90810.25990.14330.17740.1930.11070.08560.10230.10050.0697
33
32Short Stacks IIShort Stacks 23154634
GGAAAGCCGCGAAAAUGCAAAGACAAGGGAAAACCAAGGGAAGAAAACCAGCGAAAGCAGUCAAAGGCGCAGUCGUUCGCGACUGCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
4.972
medium
93.30.1321.4530.7930.62420.77081.41040.66110.44450.00460.02060.06660.07740.32250.99571.28341.47831.52691.67030.74990.54430.30611.07421.21040.80111.09071.02420.76341.43110.44690.14620.38270.76821.36761.80911.88491.73150.28170.38131.12580.6210.58280.50191.08712.1981.72561.4871.95741.72441.66840.85660.27380.22050.02870.46450.49740.32520.97651.24280.98910.3270.17070.68060.83920.59710.36161.15961.63881.10070.72290.3260.31270.38710.24540.24450.34750.38220.23150.63560.95210.36740.58330.19750.360.20790.26350.19510.1490.15650.11720.08570.1273
34
33Short Stacks IIIShort Stacks 23154738
GGAAAGCCGCGAAAAUGCAAAGUCAAGGGAAAACCAACCGAAAUAAAGGAGCGAAAGCAGACAAAGGCGAGAACCUUCGGGUUCUCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.163good960.1471.6160.8810.58860.88811.64741.05150.71220.26010.07990.21170.22920.72441.34881.91071.31671.55141.68811.17550.77810.36441.30851.00731.19960.81430.40130.46581.0490.46240.16090.35720.60011.47011.49933.11251.35840.26140.16370.77311.10890.15890.1411.10621.87123.2863.49811.64922.16321.6910.72820.28890.61090.54060.39020.27640.28241.17790.73171.02980.30140.13090.62461.02251.0240.52081.62781.87210.85430.79840.28280.43320.19090.05650.10320.08640.15560.29880.7231.18130.55740.73080.97010.23850.16340.1880.14930.13320.0920.07090.08680.0761
35
34Short Stacks ConsensusShort Stacks 23158508
GGAAAGCGGCGAAAAUGCAAAGUCGAGCGAAAAGCGAGGGAAAGAAACCAGCGAAAGCAGACAAACGCCUACAUGUUCGCAUGUAGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.969good94.70.1331.460.7961.08690.93871.51630.90480.94860.1620.10940.40880.18821.07070.84021.34791.0451.4821.63381.67121.0870.79141.5041.12731.69430.26140.11970.07890.49111.66290.28230.31610.94381.46061.53121.40141.05470.10420.15830.79361.16320.22440.17410.90682.3653.25231.6271.7921.35091.55021.06980.1770.12080.0480.06130.35560.39681.39651.11771.08780.25890.15470.38680.34670.48130.20681.23621.91210.68910.23830.17720.06890.1460.40120.71430.32160.30140.18190.26471.33230.44081.16260.27690.20560.14190.14340.11310.11460.0670.04930.08750.0754
36
35Brourd modShort Stacks 23160111
GGAAAGGCGCGAAAAUGCAAAGUCAACCGAAAAGGAAGCGAAAUAAAGCAGGGAAACCAGACAAAGCCGCCUGAGUUCGCUCAGGCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
5.657good93.30.1251.4250.7750.05130.51750.97690.61430.44140.20710.23210.15440.25470.7251.02261.31841.08111.23891.05310.9580.45910.49441.1961.25841.19881.53360.51010.12511.0091.0330.07940.140.79111.14761.33861.36460.43590.54060.84460.99441.47630.30080.4461.01482.17562.1112.79151.41191.95471.79521.50410.53190.33820.44320.04560.43820.7741.42541.58221.19110.42050.54540.63841.16041.34820.9571.44421.35121.28970.56690.34960.40770.08080.22150.09050.07030.09340.31860.56451.24930.65130.62620.82460.30180.19650.20890.16610.13860.10650.11030.0970.151
37
36:TheTitle:Short Stacks 23163414
GGAAACCGCCGAAAAUGGAAACUGAAGCGAAGAGCAAGCGAAGAAAAGCAGUGAAAACACAGAGACGGGUGCAGCUUCGGCUGCGCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.114good90.70.1431.6520.8980.69020.8281.62131.36360.69110.0650.10870.07620.03890.5560.7631.90781.49581.30061.0720.30710.58840.5891.21061.60190.70240.14260.3230.69521.56072.02210.32920.25820.41570.87540.84471.49461.2880.82370.42261.44192.04450.70720.37151.40342.36193.23520.93162.31631.71921.49691.63440.91070.46590.58370.62021.46250.89751.85972.22281.65231.08120.80820.59830.60130.98870.90271.39910.88790.4090.11210.17960.22080.24970.27230.11820.1640.2030.44250.46441.2910.43190.96130.21270.23010.16860.18310.17260.14310.0530.07490.06980.0728
38
37Healed thumbShort Stacks 23164459
GGAAAGCCGCGAAAAUGCAGAGCCAAGCGAAAAGCAAGCGAGAAGAAGCAGCGAAAGCAGGCAAAGGCGGUGCGCUUCGGCGCACCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
7.513good93.30.1161.2770.6970.8330.82641.47820.75610.7210.15670.02470.19080.08610.99651.02631.10921.0451.37931.22331.20850.42170.33350.39080.63430.80270.2060.08650.21020.84681.12690.30450.8120.20651.42791.61311.49650.89970.30680.36681.10361.42910.27480.16590.89411.14541.8031.65031.0151.46381.19041.28360.42690.17560.25960.21340.37380.44241.34411.27351.06190.31560.22030.51960.50440.3160.17651.00271.55860.56960.40780.16430.29440.24090.14780.08440.19780.12910.14780.9721.29010.58990.91230.84210.22290.14870.15930.11180.12020.07910.03620.06410.0493
39
38Done!Short Stacks 23174384
GGAAAGGCGCGAAAAUGCAAAGGCAAGCGAAGAGCAAGCGAAGAAAAGCAGUGAAAACAGUCAGAGCCGUGGAGCUUCGGCUCCGCAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
6.585good85.30.141.5390.8390.93320.60151.17610.87960.41250.35170.13440.21370.1260.82340.59171.22971.20971.48271.24940.72340.39190.2111.15721.44720.81951.62730.27360.12590.30220.53650.11840.06690.49720.51570.6491.09670.62980.08020.20690.670.96380.2730.14291.5782.0812.19750.79182.04151.95531.6661.46030.47150.30290.81351.45781.76991.27832.19742.18771.9381.52230.88051.68111.66081.12090.85180.7790.84271.160.55260.10980.2610.41720.28450.1870.24550.53070.20210.32540.75570.30880.44230.29720.30060.16710.19290.15480.1140.10710.09870.08950.0756
40
39Ustiarma 2.0Short Stacks 23179936
GGAAAGUGGCGAAAAUGCAAAGGGAACGGAAAACGAACGGAAAAUAACGACGGAGACGACCCAAACACGUUCCACUUCGGUGGAACAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
8.994good98.70.1441.5880.8660.99290.79761.46610.89440.93160.66360.12370.62740.27491.19120.98951.78271.11261.98941.56021.61080.82660.51531.06711.06180.47740.15650.05630.42811.75971.01390.2260.78850.76821.631.42491.4070.62390.15620.48251.96381.13480.14010.44151.03723.18933.05412.80562.63451.92411.65690.78810.19350.44440.39980.20910.16910.50150.71951.54240.66820.2050.26810.62390.24770.10610.22171.23171.51791.2250.57230.51010.79420.18880.15170.09770.10820.16140.09310.34290.95740.52860.60750.8440.18680.12940.16070.12780.13580.1060.06720.11360.0824
41
40LROppy s Short Stacks 2_01Short Stacks 23181286
GGAAAGCCGCGAAAAUGCAAAGCCAAGCGAAAAGCAAGCGAAAAUAAGCAGCGAAAGCAGGCAAAGGCCUCUGGCUUCGGCCAGAGAAAAGAAACAACAACAACAAC
.....(((((......))...(((..((.....))..((........)).((....)).)))...)))(((((((....))))))).....................
7.29good94.70.1431.5730.8580.83951.06441.5110.70610.40780.08520.01890.08510.27310.67120.77631.58010.88331.62961.45850.92420.37260.31560.6430.76690.9650.2580.14310.35621.39781.70240.24760.93970.51171.15692.12551.79771.52110.45910.28930.93212.00550.41790.56471.19282.89942.32122.25112.48481.98411.62951.66960.40730.20680.66460.25620.65910.53031.62112.22172.11780.67990.22070.36880.37610.33320.14310.82071.58981.0520.81580.59920.5070.4330.6290.15690.11390.12380.07090.29650.65790.190.26350.10470.28110.19110.1920.1380.11040.06530.04690.06520.0947
42
41Try 1SARS coronavirus structure test3045746
GGAAAUUUAGGGAGAAUAGCGCGAGUAGCAUGCAGAUUACAGUCCAAUUUAAUACUUCGGUAUUAAAUGUAAUACUUCGGUAUUGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
7.913good89.30.0981.0790.5880.56460.80490.92461.13951.66560.58970.8951.01020.49740.40890.50920.6740.62920.70141.22870.94440.68791.07720.44470.31070.23820.17381.00071.00591.2711.18651.03360.28330.29681.43961.29810.52350.3380.58071.45771.32580.83191.11730.90850.5820.90081.350.91620.23550.31190.66490.48810.26970.17380.20550.08240.08330.18910.06180.21020.68480.24920.26530.42550.30410.08060.25620.1550.16180.22440.45720.54650.53760.36530.39460.39680.30810.39550.30080.2680.72710.28340.40150.62720.15220.11370.11490.12750.13850.09460.10010.10780.0799
43
42Try 2SARS coronavirus structure test3045784
GGAAAUUUAGGGAGAUCAGCGCGAGUAGCAUGCAGGAUACAGUCCAAUUUAAUACUUCGGUAUUAAAUGUAUUACUUCGGUAAUGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
8.448good920.0860.9420.5140.58220.83930.72021.08551.73610.66731.23021.61310.73040.50230.48251.02310.20920.60020.75570.33820.20.5610.25620.20360.12330.09110.94930.75951.14181.25950.85090.22870.31191.53761.08210.25920.25420.4870.74980.33680.40460.58131.07640.6791.26411.59060.74760.23950.0990.54290.39570.28890.21250.14270.13020.14610.15690.06670.19650.53870.32140.31850.56320.29280.15240.19330.12580.22510.27160.3480.53110.65940.36110.42190.1710.20830.29750.24680.16910.59550.29810.30360.42150.14590.10360.09510.10860.12110.08190.10320.10940.0825
44
43Try 3SARS coronavirus structure test3045787
GGAAAUUUAAGGAGAUCAGCGCGAGUAGCAUGCAGGAUACAGUCUAAUUUAAUACUUCGGUAUUAAAUGUAUUUCUUCGGAAAUGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
10.844strong880.0981.0740.5860.83041.10751.15360.95711.40880.98641.38621.40811.62110.49930.54291.32790.31370.69460.72130.24120.340.60220.28880.27890.1360.1150.90620.79871.20661.38150.97680.21680.39491.39041.0750.29110.2570.56330.70170.50450.68680.66481.06150.5281.28441.43910.89840.66410.93791.48540.92150.34640.22670.16280.13570.08780.15890.1010.17740.54140.28940.31350.54340.32090.25370.17270.16210.24370.23480.16340.73810.52060.29110.29020.12860.19230.26410.1340.29430.68110.48650.69240.45320.12280.09570.09120.08960.10470.08610.09350.09750.1008
45
44Plague (Full G-C)SARS coronavirus structure test3113048
GGAAAUUUAGGGAGCGCACGCGGAGUACGAUCGAGGCGACAGUCCAAUUUAAUACUUCGGUAUUAAAUGAGACACUUCGGUGUCUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
5.338good93.30.0890.9760.532-0.00270.71510.5290.79521.7470.88081.29861.42550.80170.45230.44230.97751.13260.26360.11470.0270.08080.20150.29420.48560.0530.21140.350.41760.40892.05020.57660.2470.41884.39720.63990.25220.18290.42650.19020.04470.02240.14471.83850.60841.24011.94270.88660.24260.22750.9370.56530.25260.16730.24850.12640.09430.19440.1050.12390.53860.24150.29630.57090.3830.22350.39330.22720.46470.39340.32710.50960.76750.40550.18390.14370.08850.06050.08390.2720.6920.33870.38670.45830.25880.15270.17930.19890.1910.16170.15630.17160.1252
46
45Pestilence (2 A-U)SARS coronavirus structure test3113058
GGAAAUUUAUGGAGAGCACGCGGAGUACGAUCGAGGCUACAGUCAAAUUUAAUACUUCGGUAUUAAAUGACCGUCUUCGGACGGUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
4.88
medium
90.70.0961.0590.5780.41141.2060.9581.28141.34721.13911.33831.23891.54030.59570.8131.65641.05690.44540.24590.04830.07010.0830.26140.49130.12070.06030.380.3970.49792.08960.59210.1330.33214.40510.88070.19920.22790.44550.24740.05820.11610.4230.72110.44371.24911.76811.14470.84121.22911.47230.51560.10910.23330.08580.21770.15230.2040.20570.15430.43160.29830.2820.49510.37130.26850.23590.2040.29890.52470.41460.43890.41970.30040.23280.13280.11050.11580.16490.28821.00330.65910.41150.50430.33870.22080.2130.2040.21460.20140.20130.19390.2077
47
46Epidemic (1 A-U and 1 G-U)SARS coronavirus structure test3113061
GGAAAUUUAUGGAGGCCACGCGGAGUACGAUCGAGGGUACAGUCAAAUUUAAUACUUCGGUAUUAAAUGUCGAGCUUCGGCUCGACAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.13good800.0790.8680.4730.34761.23881.11470.94670.90070.90060.76591.08280.96940.27540.24260.40860.15980.06030.09220.01780.0562-0.00610.08550.45010.03530.07930.33750.32130.32842.01070.21090.09490.29824.53740.6810.03840.17080.35250.12620.04260.06280.14620.56480.13820.48780.93350.770.80170.86060.93340.5380.24650.22770.3450.36180.29490.14760.12580.1910.52050.3670.34960.50110.38960.21590.21210.34060.64040.96860.70030.85060.55210.14540.09220.20060.07640.19350.12010.61791.44380.30180.40030.97790.23780.1460.14010.12820.13410.12460.10710.13860.1148
48
47JR_SARS_Rnd1_Sub1SARS coronavirus structure test3113422
GGAAAUUUACCGAGCCGAGGGCGAGUAGCAUCCAGCGGACAGUGGAAUUUAAUACUUCGGUAUUAAAUGGUGAACUUCGGUUCACCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
7.256good880.080.8850.4830.59240.78941.07981.18251.23590.56640.52010.79250.57840.08370.29750.62910.87730.50350.04550.05810.31870.30080.10920.19560.06370.1160.91731.14391.27421.27971.28050.25910.17571.5791.09330.17210.33420.7350.58210.12460.0450.47910.80310.36280.81951.11590.30270.39050.76861.18550.50720.29590.42910.37370.36410.28960.34890.22780.14680.60320.28970.26450.43150.27530.23280.23490.32320.57310.56220.51880.84460.48850.24080.20850.12840.29550.28560.19820.2280.63530.13990.32060.40160.17830.11250.13230.11830.1240.08140.07870.08490.0809
49
48HooplaSARS coronavirus structure test3114033
GGAAAUUUAGUGAGCGGACCGCGAGUAGCAUGGAGCCGACAGUACAAUUUAAUACUUCGGUAUUAAAUGAUAGUCUUCGGACUAUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
8.328good89.30.0971.0690.5830.77920.8660.82981.10371.29190.90161.22681.32671.23271.14190.51651.55631.85690.42940.08840.02840.41440.33010.14370.41880.06020.09490.61890.75120.86591.26320.82020.2060.46992.35520.57130.30460.6871.42250.42610.01320.00730.12890.61080.36950.81351.53741.38481.01940.72971.26540.72520.43610.37650.28320.27480.24110.21430.08950.16950.42630.33250.32110.47110.30540.25790.43440.23930.27390.53660.66750.53130.44780.27170.23880.25360.09870.17830.20060.28841.26590.30870.26210.60110.17510.10860.13420.14050.12490.09590.12280.11840.1186
50
49modreds1SARS coronavirus structure test3114074
GGAAAUUUACGGAGGCCAGCGCGAGUAGCAUGCAGGGUACAGUCGAAUUUAAUACUUCGGUAUUAAAUGACCAGCUUCGGCUGGUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
5.193good86.70.0770.8470.4620.62031.19790.97841.23661.18790.55220.71790.75670.31930.10990.22320.80340.36260.22640.1901-0.0480.07120.20110.12990.21710.16420.07550.79280.76861.19711.40480.83210.24460.39162.28431.25620.21340.26190.45340.40070.280.2070.34170.56790.25540.6480.35440.39270.31731.13881.61120.53780.31450.32430.37040.32540.30950.25330.3110.20290.55860.17070.36730.6530.3080.40570.36020.22940.57930.86910.59510.65890.47480.45460.13720.06860.09260.16170.1210.1620.58930.25190.37760.14870.25220.18380.14940.1660.16250.13130.13240.11290.1082
51
50modreds2SARS coronavirus structure test3114108
GGAAAUUUACGGAGCCGAGCGCGAGUAGCAUGCAGCGGACAGUCGAAUUUAAUACUUCGGUAUUAAAUGAGUCGCUUCGGCGACUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
5.861good90.70.0880.9670.5270.50941.18781.00180.85321.23620.50520.88541.02120.4630.13610.60351.26251.28860.32850.06440.04290.1050.36740.25770.10790.08440.08430.98271.02111.27091.54791.11460.34690.38731.94121.30460.29250.31711.14610.50560.10310.13910.52450.65380.41981.03491.08790.59390.29820.96171.23940.57490.23850.28020.38610.24590.21750.24010.17610.24630.48160.29510.29380.4450.30460.04280.25820.29210.4570.65670.48680.85470.4270.05150.26490.18610.35010.47010.21970.31140.70870.31420.25610.43490.25830.17860.16270.14990.15360.09380.12920.12320.1046
52
51modreds3SARS coronavirus structure test3114132
GGAAAUUUAGCGAGGGCAGCGCGAGUAGCAUGCAGGCCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGUCUCCGUUCGCGGAGACAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
5.94good90.70.0810.8870.4840.86020.93971.36941.20631.15050.7751.02631.18811.28340.23730.21321.01120.26960.33210.27220.0680.10740.22920.14430.20550.06720.06710.7850.88361.18081.50870.86740.28430.27611.53780.9780.33770.27780.41490.70250.24660.04770.25810.64530.59810.96471.20861.06720.57310.48331.12930.47370.38980.24540.24450.21960.18180.18820.08740.16990.55580.34830.39080.37910.41120.0670.05870.21410.26420.35950.49660.89260.54720.21630.02930.02170.06810.03780.03670.41921.03090.40370.80270.13740.21820.16050.16790.15940.1350.1220.12660.13370.1569
53
52SARSSARS coronavirus structure test3114859
GGAAAUUUAGCGAGGGCAGGGCGAGUAGCAUCCAGGCCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGCCCGGCUUCGGCCGGGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
4.769
medium
90.70.0820.8990.490.7310.81451.22390.84250.98760.84820.9151.16331.37820.18370.21970.95010.35620.26890.1780.11370.04240.17660.17640.4130.0670.01741.19661.10241.38991.38741.03270.21550.18331.51390.80290.1510.25240.24540.47740.15970.04780.10751.28520.54940.92350.97861.15210.53040.41371.28620.61440.20210.25020.20380.13070.13440.06750.10650.28040.54940.2990.20220.540.33820.74950.29550.15010.36780.25070.25930.58080.47530.38510.17120.14950.09330.10480.16720.24061.19120.36690.71880.29330.23490.17240.18440.24070.16920.16070.13870.1520.2139
54
53SARS Z2SARS coronavirus structure test3116104
GGAAAUUUAGGGAGCGCACCGCGAGUAGCAUGGAGGCGACAGUCCAAUUUAAUACUUCGGUAUUAAAUGUACUGCUUCGGCAGUACAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
5.74good90.70.0820.9050.4940.70110.44060.96511.01571.57890.94361.39541.26440.55040.58290.40071.02621.0210.35530.11150.04050.09770.11980.03230.29960.07220.04770.77810.88190.88391.19230.74530.180.41542.55910.6020.25380.27780.49530.49160.02060.03860.22811.29320.37061.25571.55060.79460.17930.21750.55030.56940.26570.28960.13010.09080.12460.09670.13520.15370.69890.29050.34270.43930.3980.06870.43290.1730.23270.18920.34030.67730.54870.29570.15820.14320.08850.18340.09490.42891.29780.62520.39630.44520.21880.13060.14980.15090.1570.15020.15240.15570.1189
55
54SARS viral 1SARS coronavirus structure test3120440
GGAAAUUUAGCGAGGUCAGCCCGAGUAGGAUGCAGGACACAGUGCAAUUUAAUACUUCGGUAUUAAAUGGUAACCUUCGGGUUACCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.388good90.70.0870.9560.5210.94891.06111.08211.04230.91660.75930.95981.00611.74490.15030.19980.70390.3630.4620.28920.10290.1270.22370.2230.03290.03510.13150.85090.91821.35271.26390.44390.1190.39891.53830.9660.19460.3760.49750.72430.63940.46280.49641.07680.50780.90011.38231.16930.56320.37551.30530.74780.38420.47090.40120.3240.2920.15420.1080.17180.56810.28530.19870.48590.26070.27170.27720.28760.33140.46340.42580.66790.46860.1490.22140.29890.34740.35120.18320.33360.98050.15930.28480.79290.20670.1310.14480.16720.13020.10780.11670.10970.168
56
55shooting SARSSARS coronavirus structure test3120504
GGAAAUUUAGUGAGGGCACCGCGAGUAGCAUGGAGGCCACAGUACAAUUUAAUACUUCGGUAUUAAAUGAUCCUGUUCGCAGGAUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.109good880.0880.9640.5260.85460.7770.84421.08341.02480.87411.09681.00271.51390.86490.40611.19780.59670.40970.09780.02650.0530.15960.06870.1370.05790.05650.86260.79260.98891.52570.89360.17760.182.04420.65460.23980.44740.41410.41420.09930.02710.11390.7420.48240.9451.42411.58981.05450.78231.0510.57640.34580.20630.24910.17630.22040.22730.09840.25520.55970.33790.34370.46360.28210.32640.30450.16970.42240.65560.50220.75240.45320.24160.23350.14390.06160.10250.07850.25161.14220.46440.84820.33560.23090.15180.15760.15160.13910.12530.13540.12990.1595
57
56CorruptionSARS coronavirus structure test3120611
GGAAAUUUAGCGAGGUCAGGGCGAGUAGCAUCCAGGACACAGUGCAAUUUAAUACUUCGGUAUUAAAUGAAUUGCUUCGGCAAUUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.602good920.0830.9120.4970.75691.24431.28141.1641.18350.86730.87411.22651.57210.25860.18260.68970.45610.4610.20510.14060.180.20190.14970.21870.09810.10771.13921.10961.20561.43461.22410.17950.22051.55540.93030.30240.40.23780.62690.32050.09350.28580.97790.42350.65661.1891.16050.4850.5030.7540.45880.21320.140.18640.20140.20680.14430.14490.1860.56530.34920.31220.46790.34330.0850.26660.2190.16670.34280.51990.60060.5810.31140.20880.13710.09850.15770.35840.38330.98620.28050.60920.58940.18930.15690.13030.15410.14040.10950.10040.12290.1423
58
57Fiskers SARS piece 2SARS coronavirus structure test3127592
GGAAAUUUAGCGAGGCCACCGCGAGUAGCAUGGAGGGCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGAGUCUGUUCGCAGACUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
7.134good86.70.0890.9780.5340.80530.87271.22161.0851.33390.83121.11581.0031.44670.24520.26910.9150.41260.45920.13900.07230.08070.00860.27020.02530.10951.0490.85941.20011.64640.83620.12860.28172.63280.52860.33040.51870.49270.35130.22940.08680.15271.04580.51480.83661.38761.01970.83770.59481.10170.61740.29520.24850.22290.25920.22570.26740.13670.18740.6640.36870.36670.60940.31380.57180.42160.29030.38660.39880.53841.04940.5340.12490.11380.09020.08380.04410.07550.33711.03950.27750.63610.82340.22770.12950.13220.15070.14680.10750.11680.13060.1404
59
58
SARStenance - Brourd - Lab SARS coronavirus structure test R1 - Sub 3 (A little bit of everything)
SARS coronavirus structure test3128202
GGAAAUUUAGCGAGACGAGCCCGAGUAGGAUGCAGCGUACAGUGCAAUUUAAUACUUCGGUAUUAAAUGCUGGAGUUCGCUCCAGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
9.864good89.30.0981.0780.5880.58821.16331.29291.3421.19030.60141.11151.01991.36070.21450.23040.89220.86560.78460.40510.15810.32830.31320.19530.16110.06620.11430.93380.7511.07031.02550.45660.19780.42061.54220.80610.11980.17671.11221.12220.36450.62030.9311.60270.6731.17851.3451.08720.45660.3221.02840.73040.4980.46730.45040.43920.33410.1560.10810.16630.70010.30840.33320.3260.22110.25860.40990.48820.50460.64490.49121.01440.50830.13190.04740.08090.08410.18120.19730.80121.87480.46430.52470.78660.14070.11030.10080.10460.10170.07980.09310.08430.1126
60
59Second Shot Sars VirusSARS coronavirus structure test3129394
GGAAAUUUAGCGAGGACAGAGCGAGUAGCAUUCAGGUCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGAGGUACUUCGGUACCUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.446good85.30.0820.9040.4931.26470.92531.18781.28671.11730.58110.69871.12681.34920.22070.10790.8460.30640.23880.18990.25860.06760.35720.36350.72710.14110.10210.73730.82541.02621.44480.91510.19980.30481.06791.07260.53580.73880.50110.87230.57610.16350.51341.02930.55520.69180.99441.06270.56870.48661.51610.43080.23630.09620.18180.15670.1540.19320.11330.18080.4020.26220.25150.43820.42130.59080.48660.17920.2040.36770.33710.57540.62350.21050.10040.09360.0770.23550.21840.15580.7880.32110.45680.24350.18410.13350.1410.15280.13410.10140.10130.11270.1456
61
60Mat - SARS coronavirus D1SARS coronavirus structure test3129516
GGAAAUUUAGCGAGGGCAGCCGGAGUACGAUGCAGGCCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGCGAUCGUUCGCGAUCGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.225good720.0951.0460.5710.87650.87380.92750.91741.14140.69571.09590.99711.31670.26060.23641.04150.39040.26430.72420.24920.16860.420.10820.00890.09690.13180.69830.49070.58790.94680.45430.12520.42780.65240.46750.23930.17180.21150.69930.78950.34480.42340.8280.56621.10661.28770.91120.23660.26170.971.18250.67880.94570.98420.86440.51270.20.15330.09670.2010.12030.20780.24680.09540.48851.2121.22551.31050.89350.84410.75350.61010.34540.21660.11860.18780.24070.1490.62271.88190.39210.45211.12260.20520.14150.13860.15780.1420.13320.13780.1370.1618
62
61Mat - SARS coronavirus D2SARS coronavirus structure test3129525
GGAAAUUUAGCGAGGCGACCGCGAGUAGCAUGGAGCGCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGCGUAGCUUCGGCUACGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.382good89.30.0810.8880.4840.51651.28041.31611.04581.03370.90460.95421.06221.31760.16990.18360.73470.62320.42160.15510.10120.38630.3270.03360.260.0702-0.03630.63440.65260.69981.07430.52080.16650.28082.45380.58990.22340.49321.57420.49460.15870.07480.38820.95460.49240.76671.50871.2020.60120.56311.00530.6230.20810.220.18350.19710.12750.16420.2030.18640.46950.27940.43520.49460.33280.1080.2270.12580.2040.29370.32430.59090.59870.3150.09520.11860.14790.32850.17550.39550.84280.19640.53730.27020.22620.15090.1410.14150.12210.10660.12230.1260.1348
63
62JR_SARS_SARS_CoronavirusSARS coronavirus structure test3137829
GGAAAUUUAUCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAAUUUAAUACUUCGGUAUUAAAUCGCUCACUUCGGUGAGCGAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
4.905
medium
760.0650.7110.3880.5651.14660.93710.66150.64930.54970.21460.44060.36010.14350.05980.08840.12910.1473-0.00260-0.01910.04640.24450.52270.08780.06650.29690.28310.35141.4180.22490.08910.523.83650.52860.16810.21480.32490.05070.09340.08470.14810.1640.04920.06350.4750.38960.47120.83041.4250.65130.29790.23780.34130.2480.24510.25380.17690.16610.6580.31050.36760.57570.42720.62720.43450.25140.38230.67870.55390.91760.28650.23810.15160.12090.06880.12050.08020.49230.79550.39690.84220.4210.25120.14430.12930.15750.11420.10870.08850.10220.0747
64
63TEST 2SARS coronavirus structure test3143756
GGAAAUUUAGAGAGGGCAGCCCGAGUAGGAUGCAGGCCACAGUUCAAUUUAAUACUUCGGUAUUAAAUCUCGCGCUUCGGCGCGAGAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
5.221good90.70.0840.9250.5051.011.07061.14441.43250.98010.75190.95950.6240.80510.42830.61671.5730.68040.51650.7130.26280.02840.13930.22360.50910.0420.08391.57011.83421.39921.83430.6430.10610.23640.75450.48620.1260.19780.39720.92580.28360.03540.06210.25850.33320.62340.51520.3050.31820.30111.27250.57210.21830.11360.14060.09780.11570.22350.05430.16170.71370.25960.28510.39370.15560.45390.20580.09290.22640.26640.16360.3660.35390.3220.07040.10040.13020.2970.47741.90692.13730.6620.86660.47690.23440.16780.19590.20690.17880.14320.15470.13330.1597
65
64SARS IISARS coronavirus structure test3153451
GGAAAUUUAGCGAGGUCAGCCCGAGUAGGAUGCAGGACACAGUGCAAUUUAAUACUUCGGUAUUAAAUGCCAUGCUUCGGCAUGGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
5.012good89.30.0740.8110.4420.7221.13991.12081.20331.18880.72140.7591.11021.44110.13910.11340.46030.31480.39740.06640.16310.05430.3780.15330.08690.0290.09090.79390.91971.07121.3120.47980.1730.42391.39590.94970.17080.27310.38510.72050.45070.29290.29450.74150.33480.54841.00450.75560.36160.43640.6250.41870.31760.24040.3040.11550.15550.11710.04260.22780.41590.25430.27120.3990.39660.20220.29250.17260.2360.29570.45520.47780.40030.42370.50420.47990.2320.09440.09260.59411.02250.30750.36370.25520.23790.17620.1530.16690.14430.14080.1290.13710.1711
66
65Animal Balloon Theory 1 - How low can you go?SARS coronavirus structure test3153684
GGAAAUUUAGCGAGGCCAGCGCGAGUAGCAUGCAGGGCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGCAGGAGUUCGCUUCUGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.941good90.70.0820.8990.490.63180.84261.0341.22811.32490.74330.91680.79051.21160.1320.13810.2780.34260.97030.73960.12730.37970.68320.43370.21940.16690.19010.94360.90840.9480.8820.84930.21630.37671.33980.62150.2130.18210.24190.26180.15720.05020.06340.42850.32210.74461.15290.53580.22550.21411.43371.2920.28650.19860.1360.15650.09460.14950.14120.2080.48590.19980.33740.48450.37970.2060.23860.06960.20410.2720.35260.39350.81690.23660.09470.07310.32161.15560.86410.69821.20120.60820.8150.49330.20480.12090.12210.13160.13110.09880.10630.11970.129
67
66Animal Balloon Theory 2 - The Twist and Shout Tradeoff.SARS coronavirus structure test3153711
GGAAAUUUAGCGAGGGCAGCGCGAGUAGCAUGCAGGCCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGCUCUAGUUCGCUGGAGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
8.352good920.0780.8570.4670.94751.06161.2631.4451.31580.76640.89540.76960.78710.12120.12690.51860.17910.24130.30670.06940.04660.27350.25660.18480.08830.13080.80080.87071.15611.43470.88490.20580.30111.40340.83550.38950.30420.37720.91110.32380.03550.15560.57150.39660.49580.76490.74470.31420.37331.15530.99020.35150.13590.16560.14030.15730.21070.17540.14850.55210.36490.38070.4630.33250.15820.14230.11990.20150.22820.27220.38930.2560.12690.16830.1040.09590.65731.27631.08171.76040.36350.45360.33650.14820.10970.10460.11920.10730.08050.0810.08240.0851
68
67Animal Balloon Theory 3 - Elbow GreaseSARS coronavirus structure test3153726
GGAAAUUUAGCGAGGGCACCCCGAGUAGGAUGGAGGCCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGCUCUUCUUCGGAGGAGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
9.102good89.30.0890.9790.5340.75711.13791.09981.23691.27380.75951.16661.36361.48680.23150.18251.04440.45610.3570.11260.02750.09770.16930.08160.07860.01160.14521.24281.15521.41221.48860.63390.23870.6132.34130.63290.30710.33530.39960.63220.11960.07740.20341.16660.62280.98921.5571.25690.63060.33061.0270.59180.29920.30110.23160.23380.1770.19580.13050.17150.63920.32870.40970.52220.1980.14840.25670.17130.26330.38820.47310.83680.64620.14180.08790.07450.14860.19310.11230.41121.28890.35890.43890.73980.16090.1110.10510.11060.11080.09020.09370.1110.1182
69
68Mod of Real SequenceSARS coronavirus structure test3153845
GGAAAUUUAGCGAGACCACGCGGAGUACGAUCGAGGGUACAGUGCAAUUUAAUACUUCGGUAUUAAAUCACUCACUUCGGUGAGUGAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
8.492good880.0880.9680.5280.29430.98341.25841.12861.35230.83450.8871.16661.43830.38030.42391.54060.98410.57110.20620.04760.06770.11470.17220.50260.08190.09560.44260.38290.37431.74160.29960.08920.31264.19810.67320.11680.15930.54720.13650.10730.08540.39021.01790.38430.76471.58240.9610.77770.64181.13320.6380.35940.25240.23960.18070.1460.16370.12040.17770.55160.3510.29450.41850.36010.14940.19380.17490.27730.29180.47570.69690.6760.31940.17280.03070.01620.18190.1410.45211.29240.38340.40080.85020.18070.12620.11530.11560.11440.09480.0910.10570.1207
70
69Mod of Real Sequence IISARS coronavirus structure test3153849
GGAAAUUUAUCGAGGCCAGCCGGAGUACGAUGCAGGGUACAGUGAAAUUUAAUACUUCGGUAUUAAAUCGAUCACUUCGGUGAUCGAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.407good78.70.0921.0130.5530.531.02331.07310.75240.75370.56270.48970.56370.88970.19580.06260.39960.3010.27830.4360.19090.11640.3580.23080.06990.07330.11491.5010.87830.95511.84230.67410.20780.57481.5010.99350.46120.50020.33850.61940.29830.43150.62750.65080.41940.70270.85370.75020.89811.13091.26220.78280.70920.58150.57760.57450.46050.34770.15270.1470.59410.26960.25360.32250.13820.25550.63030.60690.75110.91690.8031.10340.45030.12150.24210.29810.18340.2660.18840.32081.30990.44110.60550.87990.22760.14680.14360.12770.11610.11110.08860.11040.1266
71
70SARS IIISARS coronavirus structure test3154053
GGAAAUUUAGCGAGGCCACCGCGAGUAGCAUGGAGGGCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGAGUGUGUUCGCACACUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
5.892good86.70.0880.9710.530.32251.14571.33511.1741.10370.75340.82230.89711.13190.15620.20570.81590.3330.43910.16840.03160.09450.07650.05920.08160.08340.08330.92390.61451.06251.37811.12470.13190.17092.55020.55750.17260.40960.49110.30630.15090.05690.18120.88740.37780.73911.21941.21590.76360.46111.22140.73290.31690.25240.21780.20690.23410.20060.16690.19650.60090.32220.32590.51230.44510.83010.43640.24260.21330.45020.4061.18010.95020.19030.16790.21430.22020.42870.71110.77621.57120.30550.64720.5370.25920.17570.16790.19330.15050.1080.12320.13930.1581
72
71SARS Sub1SARS coronavirus structure test3156521
GGAAAUUUAUGGAGGCCACGCGGAGUACGAUCGAGGGUACAGUCAAAUUUAAUACUUCGGUAUUAAAUGGCUCACUUCGGUGAGCCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
3.951
medium
82.70.0740.8160.4450.7270.85240.87530.90671.14231.0690.7330.83390.91520.32170.15210.40680.30070.150.03330.03330.05360.04980.21520.4930.01950.03280.21260.20110.35411.79620.22060.14090.25013.99710.54210.13530.14940.45950.11470.21430.12510.34840.6430.17950.62591.07170.66630.55641.09481.31560.46310.40150.1280.23410.22910.24080.19450.12390.12750.64230.28620.43560.25310.26660.2080.23260.31910.41260.88450.62780.79980.54680.58540.3290.08780.06390.29320.07620.06530.47150.31130.28320.37730.32260.2010.18960.19020.18870.16210.13880.19370.1719
73
72SARS Sub2SARS coronavirus structure test3156565
GGAAAUUUAUGGAGGCCAGCGCGAGUAGCAUGCAGGGUACAGUCAAAUUUAAUACUUCGGUAUUAAAUGGAUCACUUCGGUGAUCCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.028good920.0810.8910.4860.61251.06361.02240.81410.92420.77390.92480.88721.63040.25730.28610.39290.32290.38640.42110.03710.06030.10290.06470.17520.11030.15131.11780.75451.2291.30620.89150.26790.25231.7850.96440.24320.1030.27530.27390.09880.15690.36250.75270.41680.4941.05530.81240.77441.05951.70610.50540.31550.25980.20580.21650.24930.14110.12740.19720.55480.34270.29250.47540.30170.32970.38990.23220.30970.48270.40690.70090.45010.12940.12180.08940.0850.20170.09260.37611.18920.29190.38760.93090.20980.13840.13760.13170.12320.11540.12170.10580.1431
74
73KeyfobSARS coronavirus structure test3162471
GGAAAUUUAGCGAGGACAGCCCGAGUAGGAUGCAGGUCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGAGGAGCUUCGGCUCCUCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.336good880.0830.9160.50.61421.11771.04511.07751.24430.72791.01921.08771.20370.26560.24470.83310.38850.44460.6850.32370.11890.30780.17010.10860.02670.04910.7870.6540.8650.95310.43020.20370.36491.37790.5930.2050.2380.27760.84070.46090.29220.51330.95830.40340.76461.17980.83950.3810.40450.95980.59940.46490.38470.44950.3760.3270.23510.10210.17360.74810.40660.29360.44090.31740.39650.53420.5190.40910.49410.59880.96440.30870.17970.04410.17310.3080.35740.1650.27191.00290.32960.52570.36860.1960.14170.11780.15720.13970.1120.12470.1220.1644
75
74The Title of TitlenessSARS coronavirus structure test3173932
GGAAAUUUAGAGAGUACAGCGCGAGUAGCAUGCAGGUAACAGUUCAAUUUAAUACUUCGGUAUUAAAUGGUUGUCUUCGGACGGCCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
10.425strong85.30.0981.0750.5860.4150.93771.10391.04931.40321.17221.84891.40371.32460.66590.86551.43351.43930.90780.68940.2810.20990.65880.34280.25590.10.17611.05440.91611.22671.30370.90130.22220.28481.64031.08430.23820.34510.41180.88460.66030.67620.74010.7890.44791.23150.87330.92730.5930.58471.47680.63230.27030.21330.110.13160.08840.14060.07960.15770.48780.23010.35740.51190.36230.44270.28330.07990.1870.34460.30930.59640.46420.24490.13450.07950.12680.16380.09470.25150.60280.24780.46690.37530.13810.09260.10120.1120.10080.08820.10780.09310.0946
76
75SARS from MARSSARS coronavirus structure test3176176
GGAAAUUUAGCGAGGGCACCGCGAGUAGCAUGGAGGCCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGCGUCUGUUCGCAGACGCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.1good89.30.090.9870.5380.93981.07031.08971.12821.04640.9751.04271.33751.53450.30190.1271.37790.33570.35910.08520.01070.09160.16550.0530.10150.06340.12220.75660.93531.2691.31141.04370.19980.23762.39570.81510.37830.59190.50340.61860.20060.05750.21161.07580.45630.77021.69781.03240.53380.38550.92530.69740.22130.2170.2040.18930.22860.24660.2330.16650.5080.35840.33430.53050.26060.22090.16150.26770.3350.27630.51110.74980.80270.02680.11020.39550.28960.1960.12440.59431.23150.28340.96240.90520.24040.15530.16680.1670.15040.14160.12440.14520.1754
77
76SARS V1SARS coronavirus structure test3178429
GGAAAUUUAGCGAGGCCAGCGCGAGUAGCAUGCAGGGCACAGUGCAAUUUAAUACUUCGGUAUUAAAUGGUGAGCUUCGGCUUACCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
7.168good90.70.0850.9320.5080.56380.88641.08651.04111.30810.92111.06170.94421.26970.19780.11270.64680.27370.46680.11690.03820.18510.61370.13890.24940.11770.14450.86480.89981.05031.49691.18560.36620.32131.77311.4940.81080.44640.42850.48490.40280.16260.21790.85220.53260.66651.35761.16880.54460.52131.34140.56440.20790.17730.08960.15610.12550.15680.07580.12380.60060.36560.39780.55330.35930.26370.32730.15390.28290.26440.22940.72190.36970.26850.20420.18150.20590.4660.16480.2520.69390.20380.2820.42970.19670.12650.11390.16940.12580.11170.10890.10380.1321
78
77SARSSARS coronavirus structure test3179037
GGAAAUUUAGGGAGCGUAGAGCGAGUAGCAUUCAGACGACAGUCCAAUUUAAUACUUCGGUAUUAAAUGUGACAGUUCGCUGUCACAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
8.447good89.30.0830.9120.4970.59180.49640.95961.04321.41460.6291.15281.29990.5630.48290.38860.88241.30990.26890.12470.20050.42830.39910.52240.49640.07680.12490.76170.77590.92121.30430.87370.25150.35291.21451.20090.70270.42410.7441.24710.37720.13360.25380.99490.35621.10081.1430.63430.14710.17880.60260.52160.25610.15660.11470.10730.09090.16580.13040.17730.640.26990.28820.46470.2840.24610.15490.08480.21980.19390.53780.52680.70870.24850.17170.11440.11740.11520.1940.24771.02970.22660.50240.52270.12610.08160.09050.09990.10640.0850.09590.10540.0752
79
78steve s mod of zanna 1SARS coronavirus structure test3180834
GGAAAUUUAGGGAGCAGACCGCGAGUAGCAUGGAGCUGACAGUCCAAUUUAAUACUUCGGUAUUAAAUGGAGAGGUUCGCCUCUCCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
6.963good93.30.0910.9960.5430.35970.51090.43111.14691.70530.85191.43931.15820.60350.38230.39911.3921.05380.29320.27020.16540.40350.44420.11950.19730.05720.09630.99421.14851.26321.43361.15480.33070.29951.88941.05660.24470.76971.12340.280.2150.14620.87791.64270.56390.91091.43860.52830.19930.1581.09070.79090.28340.19960.13230.16080.14520.14020.06430.16050.57190.32630.31960.47810.32550.64620.32680.15190.20440.17270.31550.44520.28350.0260.10370.08870.13280.15080.13570.34820.78720.28020.77420.470.190.10740.15570.14830.15290.09750.1280.13510.0914
80
79LROppy s SARS coronavirus struc test_01SARS coronavirus structure test3181316
GGAAAUUUAGGGAGCGCAGGCCGAGUAGGAUCCAGGCGACAGUCCAAUUUAAUACUUCGGUAUUAAAUGGUCGUCUUCGGACGACCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
4.695
medium
93.30.0850.9310.5080.29810.76590.69581.10121.72590.68611.15391.25140.52690.6990.24910.89761.34920.45230.16480.04740.06960.07880.28770.51910.09850.06790.96381.22381.23061.4910.49330.08580.24862.85851.24270.39140.41270.46780.63980.16790.06450.31451.31750.43721.2071.44520.80930.35060.17420.57030.47760.20190.13490.1710.10810.06820.19270.11320.02750.36420.40210.24480.51890.32960.21140.21810.17710.21670.27250.4180.39420.46550.29490.2220.07330.08370.26190.0520.30051.12040.50520.28160.23020.27460.17610.18120.20190.21160.15430.18060.16770.1183
81
80LROppy s SARS coronavirus struc test_02SARS coronavirus structure test3181323
GGAAAUUUAGCGAGCCGACCGCGAGUAGCAUGGAGCGGACAGUGCAAUUUAAUACUUCGGUAUUAAAUGGUGGACUUCGGUCCACCAAAAGAAACAACAACAACAAC
.........(((..(((.((((.....))..))..)))....))).(((((((((....)))))))))(((((((....))))))).....................
5.827good880.0911.0020.5470.46030.98111.20461.02761.03350.61931.05870.99731.16370.31840.30820.9221.26040.35570.12120.05650.31620.36450.15530.2972-0.02920.01830.8670.78541.021.44361.1470.44770.44192.32630.42630.29850.81091.82070.43460.03920.03240.1690.96710.50351.08421.78971.02720.620.56761.30840.55210.11320.18620.14610.12540.13360.09370.11350.18030.51580.21560.34230.4140.33440.18970.16460.09320.22540.28170.19490.58150.71790.90570.37090.52350.38540.29310.19070.50820.88580.2760.70970.30080.2450.16340.1880.16920.14390.13230.13430.14510.1697
82
81RouteFMN Binding Site Chemical Footprint3113031
GGAAAACGUCGGACUCAGGAUAUCGAGUCUACGAAAGAAGUAGACUCGAGAAGGGAGUCCGACAAAACGAUAUACUUCGGUAUAUCAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
3.021
medium
920.0720.9090.4910.95321.10691.1551.10661.21710.50370.69070.2360.02950.05890.02940.02940.06330.06320.00450.04270.10091.4571.2511.79330.58950.3090.01340.0063000.08040.05360.0268-0.0206-0.0740.1291.17561.6191.81711.16551.8341.39152.16290.370.13750.07230.11550.03620.0971-0.1112-0.0140.06450.11450.13570.39060.04060.18240.25280.12610.01280.0420.02530.02090.11680.8960.78410.6851.07521.84352.06490.970.81350.31970.42350.22860.45410.43290.46470.46141.09830.51180.95750.86420.51270.36230.2720.22780.2340.21980.1880.13530.0951
83
82TrackFMN Binding Site Chemical Footprint3113033
GGAAAACGUGCACCUUAGGAUAUCGACUGUCCGAAAAGAGGACAGUCGAGAAGGAAGGUGCACAAAACGCGAUCCUUCGGGAUCGCAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
2.316
medium
880.0410.7980.4190.65580.74341.34781.05121.15770.64530.59640.20320.05410.02030.10130.040500.04050.04050.2820.26081.58610.99981.46670.31510.11190.01240.01240.01240.074500.03720000.34260.9523.18921.79181.48080.64751.05140.80670.18930.0630.0944-0.09540.03150.09420-0.2221-0.03210.03130.06260.24630.3095-0.0650.15410.21270.02850.06120.0611-0.0633-0.1280.55640.45270.4650.82081.8671.60091.1250.6490.3940.06650.64880.02590.43810.40981.1081.54940.69260.70830.51630.54350.33950.29980.27110.27830.22590.28430.16310.1302
84
83TrailFMN Binding Site Chemical Footprint3113038
GGAAAACGACGAUCUUAGGAUAUCGCUGCACUGAAAAGAAGUGCAGCGAGAAGGGAGAUCGUCAAAACGCUGUGCUUCGGCACAGCAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
2.855
medium
97.30.0460.7650.4050.5990.42431.25441.01061.13030.33390.32220.2610.03480.00870.06080.05210.0390.0130.1730.37170.47771.3661.59010.95290.59280.43470.10260000.04730000.01181.03061.15612.67781.6260.91380.65671.32541.28480.3290.02890.07880.01970.0197-0.2084-0.0694-0.11880.04910.00980.12260.25890.25790.29070.29430.17320.0461-0.0115-0.16030.0842-0.06430.03070.29030.27650.95171.65481.5730.85550.60040.37530.170.16950.06770.10130.28530.28441.77010.75830.48910.52040.46730.2520.22420.20470.21180.13950.19070.12970.0904
85
84DieddibeFMN Binding Site Chemical Footprint3113046
GGAAAAGUGAUAAUGGAGGAUAUAAGAGGAGGGAAAGAACCUCCUCUUAGAAGGCCAUUAUCAAAAUACUCUGCCUUCGGGCAGAGAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
3.387
medium
90.70.0480.5260.2871.17310.26371.34120.95160.75770.70840.69130.23220.02990.06950.0579-0.01650.07590.02310.05770.0576-0.01010.05910.46811.37310.20840.16740.0230.0070.01590.02210.04420.03310.0221-0.09590.03780.0880.45411.37541.0990.58010.53520.73350.63710.18150.02020-0.0196-0.07770.00120.03020.0101-0.0190.05030.06470.24520.11980.19710.07670.0792-0.0290.01980.0593-0.00370.0657-0.10570.03990.57471.15061.06061.26071.3080.59450.31580.08890.07680.09740.14140.14550.47710.77440.54040.60340.30460.26080.12370.15670.1510.1140.11050.10890.07490.0889
86
85JR_FMNBinding_Rnd1_Sub1FMN Binding Site Chemical Footprint3113405
GGAAAAACACUAUAGCAGGAUAUCAUCAUACGCAACACACGUAUGAUGAGAAGGGCUAUAGUGAACAAGAUCAACUUCGGUUGAUCAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
6.62good960.0380.6060.3220.48251.47941.34841.0540.73670.81620.49260.03540.02170.0325-0.04690.02260.03290.02950.0180.0710.14321.21451.28711.7950.64490.3270.0271-0.01230.01030.0054-0.00150.01620.00390.03770.12860.0430.45771.37111.05260.50660.30430.1590.15630.0880.01010.04020.0221-0.0081-0.07430.03860.03010.06180.050.16220.35570.12150.15740.20840.1130.05890.04420.05880.0269-0.03470.0470.05850.35321.57061.65220.81841.24791.64380.54230.3030.21350.11640.27250.13240.42221.22490.22040.30870.78960.1890.12750.11210.09340.08470.07770.06230.06740.0396
87
86Footprints in the SandFMN Binding Site Chemical Footprint3114104
GGAAAGAGUAGUCAUGAGGAUAUCUAUGACUGAAAUAAACAGUCAUAGAGAAGGCAUGACUACGAAAACUGCUAGUUCGCUAGCAGAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
6.158good93.30.0340.7750.4050.65320.86091.1160.90430.56590.80241.44180.16240.09280.0290.0510.03240.03010.010400.02770.06570.6311.60641.51630.67350.27430.07710.0257-0.03670.008600.034200.03420.01350.23052.58062.66272.31281.54361.26071.05510.83270.07460.05250.01220.035-4.00E-040.02790.02250.04180.02940.03080.12630.34090.09150.32360.09130.02850.02050.00680.09560.04090.0205-0.0422-0.02050.30371.15241.38551.61041.33760.86880.29930.08170.07280.03730.12760.16860.60031.33510.39510.80010.57150.24390.15230.11790.1070.10820.11190.12810.07390.0469
88
87thumberFMN Binding Site Chemical Footprint3114188
GGAAAAGCUUUAUAUGAGGAUAUAUAUUUAUGGAAAGAACGUAGAUAUAGAAGGCAUGUAAAGAAAAGCUAUAGCUUCGGCUAUAGAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
2.329
medium
89.30.0410.4460.2431.02481.42670.85550.78610.70840.69080.27320.07580.060600.00390.04540.00380.04530.02270.0830.4570.83250.08850.05040.21140.1133-0.00380.0049-0.06110.03650.03650.04380.0495-0.0841-0.30590.24620.37441.16360.42280.35510.54880.35230.01640.082-0.0726-0.02830.02720.08150.095-0.08640.05410.05690.16610.20160.33340.00910.3090.13220.09240.12030.13140.10490.11780.09290.0420.10910.40120.9761.08541.05270.85481.08030.34510.22350.10570.11380.16360.10140.24390.77930.25740.39030.29850.36720.17510.17170.13680.1310.12910.09550.07210.0697
89
88flickFMN Binding Site Chemical Footprint3114207
GGAAAAGCAAACGAUGAGGAUAUAUUAGAUGGGAAACAACUAUUUAAUAGAAGGCAUUGUUUGAAAAGCUUGUGCUUCGGCACAAGAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
5.595good97.30.0590.6460.3531.49260.43191.15060.9230.5540.66650.4170.0410.06910.10740.03070.0230.08760.0535-0.00650.11040.24550.65660.63171.85480.41110.27650.06080.01670.0140.07310.02250.09420.0302-7.00E-040.04220.08110.822.06721.93880.77830.68181.01070.99120.15550.1489-0.00290.08660.11430.06480.11080.04920.0644-0.00110.15960.35780.16930.30180.05820.02270.05020.00860.06020.0541-0.1149-0.00850.11830.85210.78291.09860.89420.86390.53890.19980.16710.1090.09250.19530.19210.32041.36160.32240.65350.68650.20640.10270.11360.09580.09260.08260.0790.06220.0377
90
89hammerFMN Binding Site Chemical Footprint3114210
GGAAAAGCAAAUGAUGAGGAUAUGUUAGAUGGGAAACAACUAUUUAACAGAAGGCAUUAUUUGAAAAGCUUCUCGUUCGCGAGAAGAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
6.138good93.30.060.6650.3621.79310.56361.06910.93770.68420.60040.50860.01980.0616-0.00230.08790.03510.0745-0.01550.00660.05020.13180.38280.96971.31450.34610.10810.03840.00730.01860.03840.00730.04960.00840.01480.06180.11820.69132.08841.68190.73720.54650.91751.0430.11290.13260.00870.04230.0650.14140.11180.05510.02720.02750.09040.30150.13770.24350.09710.03210.07790.04610.09350.1360.13360.24750.30380.78271.34561.71621.16211.03121.00880.35010.27080.07990.04120.14210.11350.29831.07340.49370.84250.31820.17450.09170.10010.09810.08760.09980.07450.0560.046
91
90try 1FMN Binding Site Chemical Footprint3114636
GGAAAAGUAUAAAUUAAGGAUAUAUUUAUAAUGAAAUAAAUUAUAAAUAGAAGGUAAUUUAUAAACAAAAUUAAUUUCGAUUAAUUAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
1.633
medium
90.70.1021.1230.6121.17160.52981.46611.43440.70951.19441.55520.482500.09640.09620.19190-0.12330.1910.75540.93111.3678-0.07261.41990.39850.349800.0873000.08720.08710.08700.08690.17331.27491.86912.09912.25861.57850.85332.38430.34390.1656-0.215600.07090.14150.0707-0.07380.23420.1636-0.01620.52010.27620.47990.40880.1360.20340.27010.20190.20130.20070.72780.52511.28732.62081.58560.61661.50421.8010.77870.49680.38420.45420.34340.34160.79941.34981.12550.5581.87320.93550.5880.5430.53320.430.49570.53340.38190.2401
92
91try 2 FMN Binding Site Chemical Footprint3114653
GGAAAAGUAUAGAUUGAGGAUAUGUUUAUAGUGAAAUAAAUUGUGGAUAGAAGGUAGUUUGUGAACAAGGUUAAUUUCGGUUGAUUAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
8.906good720.1431.5680.8551.33010.52551.1550.94320.84260.92591.15190.91641.38210.94780.64791.05931.16580.8350.45740.83590.40890.57521.07771.29210.18670.71890.37080.3330.68820.78820.86941.1550.82311.75470.95130.43341.10321.4351.76111.52731.41281.09171.23961.11060.71520.41920.69850.31740.39241.61041.35181.13920.68150.97950.89530.52520.75361.02881.01550.97020.56480.73110.50870.48350.56250.46311.02671.49141.05160.77650.80750.73641.02970.5160.61280.51831.10691.04440.4820.61090.34990.21450.690.20780.11530.13650.12010.12150.12510.13510.11950.1452
93
92try 3 FMN Binding Site Chemical Footprint3114676
GGAAAAGUGUCGGGCGAGGAUAUGGGCUUGGCGAAAUAAGUCGGGCUUAGAAGGUGUUUGGCGAACAAGGCUUGUUUCGGCGGGUUAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
16.929strong840.1191.3060.7121.36240.76221.27010.8860.81260.93910.71090.50760.52510.25220.11150.19470.57360.42560.29270.79810.40040.45410.84671.29260.28360.89510.31630.31210.43340.11380.07980.15250.10950.26060.23910.1040.52021.1361.44321.3411.22350.87641.80240.30.23080.04820.24320.78610.39150.24611.27542.61561.42091.7691.67360.78061.39111.85131.84230.35651.12721.15470.96211.06550.4670.26981.41092.13251.13310.62330.97590.96180.53150.10860.21050.2320.34360.23560.27610.39680.11730.29450.37560.09950.06290.06820.06290.05670.05980.0510.04310.0443
94
93FMN R-G deckFMN Binding Site Chemical Footprint3114826
GGAAAGAGCCGCCGUCAGGAUAUGCCGCCGCCAAAGAAAGGCGGCGGCAGAAGGGACGGCGGCAAGAAGCGAGCGUUCGCGCUCGCAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
1.126
medium
94.70.0790.8660.4730.16370.77021.24130.90220.5751.06850.49910.2486000.2477000.12360-0.270201.33230.89612.30650.85380.22690.11330000000001.85231.95251.6240.98430.96991.15030.58640.29190.097200.1293-0.23460.12890.19290.09630.383-0.17020.19070.56720.18850.1880.28080.107500.092900.0928-0.26370.27730.45890.63630.71931.06172.05751.73290.90220.488500.24330.16180.16140.12090.67792.01061.24981.26030.58781.33150.78320.59840.54260.48230.5620.46230.40450.2984
95
94FMN Z1FMN Binding Site Chemical Footprint3116059
GGAAAUAGUGCGUACAAGGAUAUGUGCGUGUCGAAUUAAGAUAUGUACAGAAGGUGUAUGUACAUAAACAUAUACUUCGGUAUGUGAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
8.63good94.70.0690.7630.4160.27551.24891.0780.93371.02010.79820.71720.11010.14480.03490.00250.03490.04230.02240.03720.14130.14070.34470.76551.36320.18210.25380.06130.00580.01070.05640.02050.04230.07440.16610.10670.0770.68822.28842.52071.01331.37811.22631.24960.35910.23590.13230.10340.06540.12640.18030.08070.05090.06250.1060.4640.24210.35940.42420.19150.15720.1050.23770.1080.04470.19060.3820.33751.39381.19381.17291.25030.65720.16130.11740.12140.11620.31510.47030.50950.73350.36220.38860.38160.1470.10670.08980.08170.07850.07590.07010.04330.0455
96
95Experiment with a Bunch of UGFMN Binding Site Chemical Footprint3116575
GGAAAUAGCGGGGGCGAGGAUAUCGGGGGGGCUAAGUAUGCUUUUUUGAGAAGGCGUUUUUGCAUAAACAUUAGCUUCGGCUGGUGAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
14.611strong86.70.111.210.660.58551.03090.90910.91610.86360.53570.35110.15150.07430.25150.22920.34670.82540.67980.1690.28580.17460.28831.64311.42320.9761.37860.48090.20460.08270.17430.28990.25190.38040.61190.27880.18320.50730.78021.0421.37470.8540.70310.38620.21780.17020.38790.49550.57151.37084.43251.13751.17321.1091.39581.05370.42290.40810.36540.58130.34850.38990.37180.49770.75630.75260.51620.55481.17390.95331.44081.48590.95240.59440.48170.34630.32260.20360.14140.240.87540.28740.46730.81740.09080.07840.06380.06560.06090.05070.04160.02930.0205
97
96JR_FMNBinding_Rnd1_Sub3FMN Binding Site Chemical Footprint3116589
GGAAAAACACGAUAUAAGGAUAUAUAUAUAGCUUACACUGCUAUAUAUAGAAGGUAUAUCGUGAACAAGCUCUACUUCGGUAGAGCAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
7.029good94.70.0430.6250.3341.15521.14081.3571.12070.86190.65640.350.01670.02340.00130.03120.0441-0.0340.02650.08090.26820.2670.45730.09150.04960.11510.0232-0.0174-0.00440.04260.0228-0.01450.02280.03410.03580.06240.16742.99783.27052.10121.01480.66940.77770.57850.06684.00E-040.02370.00950.06420.01580.05350.00940.06370.07220.18950.43730.1320.41930.31510.15580.05810.03430.02010.04330.05930.0228-0.00940.26811.20951.19640.65090.91890.92940.29960.05080.02570.0430.07620.12940.21390.94960.35380.77360.71180.16890.11630.11970.09790.0850.08350.05380.08880.024
98
97JR_FMNBinding_Rnd1_Sub2FMN Binding Site Chemical Footprint3116605
GGAAAAACACGAUAUGAGGAUAUGUGUAUAGCUUACACUGCUAUACACAGAAGGCAUAUCGUGAACAAGCUCGACUUCGGUCGAGCAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
3.978
medium
960.0220.5590.291.00221.15641.01720.85390.77920.65120.39390.02270.03060.01750.03060.05240.05230.0175-0.00430.02180.08260.24470.50071.39120.40730.159-7.00E-04-0.00560.00420.00420.04990.01250.04980.01510.040.08482.40892.86832.00531.07040.63830.79160.60940.10010.03160.01580.0211-0.06130.0210.0676-0.01340.0040.0440.08280.19050.09610.2720.16760.0142-0.00330.0207-0.11960.007-0.01360.01030.02060.10981.17721.09210.71120.67460.77610.50430.09890.07590.08530.09830.03780.18020.83880.43620.28910.27880.24820.16770.16770.15110.12060.11170.09210.13820.0481
99
98Total:-13.4 kcalFMN Binding Site Chemical Footprint3116655
GGAAAUAUUGAGAGUAAGGAUAUUAUAUAUAUAAAUAAAGUGUGUGUGAGAAGGUGUUUUUAAAAUAAGUUUAUUUUCGAGUGAGCAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
9.919good78.70.1761.9361.0561.38591.58881.50271.45041.31350.92960.91180.80310.76061.4390.68941.58861.54661.36341.1320.76670.56970.76621.02771.44470.79091.18540.16220.31550.13030.530.41470.95481.69510.77281.9061.62862.01851.6282.11221.44962.44891.69620.25810.10590.20610.19520.4020.48950.1990.41420.28420.74470.88051.47341.13610.52980.88270.75830.58690.20710.61040.50141.08222.90612.48222.40622.15411.93132.12441.56631.63342.3330.8120.52830.770.69490.81940.52761.15481.17070.45820.38991.51590.21920.18060.16930.16820.15410.13790.13330.13150.1148
100
99Total:-10.1 kcalFMN Binding Site Chemical Footprint3116659
GGAAAUAUUGAAAGUAAGGAUAUGAGAGUUUGAAAUAAAUAGAUUUUUAGAAGGUGUUUUUAAAAUAACUAGUUUUUCGAGAUUGGAAAAGAAACAACAACAACAAC
.......(((((((((......((((((((((.......)))))))))).....))))))))).....(((((((....))))))).....................
8.38good760.1591.7450.9520.74061.44891.03031.47521.00660.67671.21050.59570.92651.5892.38091.4032.11591.68761.5031.32790.67691.1360.85741.06280.61811.35970.57381.1560.82781.23941.8580.85010.81460.83430.51290.9210.9810.84451.09451.14621.03320.98370.96840.72890.48111.2691.0330.7380.25640.39850.71410.65170.50150.8180.58780.44031.41232.11152.66391.20851.98820.60590.47891.00670.94820.78141.25860.82720.85940.86831.40360.43090.21620.2690.69170.48040.25670.21960.51360.79030.26150.46360.98030.20940.1970.15610.18470.15150.14650.1560.12090.1424
Loading...
Main menu