GGGenome primer search
Comments
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
Comment only
 
 
Still loading...
ABCDEFGHIJKLMNOPQ
1
Primer name(1) Sequence(2) GGGenome URL(3) ImpotDATA functionhitsnamestartend--strand(4) PCR product length
2
YN001-Fcaatcaccctcaccctcttatatgchttp://GGGenome.dbcls.jp/rice/caatcaccctcaccctcttatatgc.bedchr01 27706 27731 . 0 +1chr012770627731.0+386
3
YN001-Rccgctgtgaacaacaatcatgchttp://GGGenome.dbcls.jp/rice/ccgctgtgaacaacaatcatgc.bedchr01 28070 28092 . 0 -1chr012807028092.0-
4
YN002-Ftgatcccaatagttgtttathttp://GGGenome.dbcls.jp/rice/tgatcccaatagttgtttat.bedchr03 9682633 9682653 . 0 +1chr0396826339682653.0+130
5
YN002-Rcatgcaaggtattagtgatghttp://GGGenome.dbcls.jp/rice/catgcaaggtattagtgatg.bedchr03 9682743 9682763 . 0 -1chr0396827439682763.0-
6
YN003-Facgtactgtggaacagtgaghttp://GGGenome.dbcls.jp/rice/acgtactgtggaacagtgag.bedchr06 7494239 7494259 . 0 +1chr0674942397494259.0+247
7
YN003-Racccaacctaatactatgaahttp://GGGenome.dbcls.jp/rice/acccaacctaatactatgaa.bedchr06 7494466 7494486 . 0 -1chr0674944667494486.0-
8
YN004-Fatcagattccgccgcggccghttp://GGGenome.dbcls.jp/rice/atcagattccgccgcggccg.bedchr01 27691272 27691292 . 0 +1chr012769127227691292.0+581
9
YN004-Rggagagatctggttggggaghttp://GGGenome.dbcls.jp/rice/ggagagatctggttggggag.bedchr01 27691833 27691853 . 0 -1chr012769183327691853.0-
10
acccaacctaatactatgaahttp://GGGenome.dbcls.jp/rice/acccaacctaatactatgaa.bedchr06 7494466 7494486 . 0 -1chr0674944667494486.0-
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
Loading...
 
 
 
シート1