STE qPCR Primers
Comments
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
$
%
123
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZ
1
Primer IDShort NameSequenceDescription / reference
2
3
TE_qPCR_001ail12a_FCCGTCAGCGCTAACTCGTCil12a q(RT)PCR Fwd primer
4
TE_qPCR_001bil12a_RCCTCTGATTCAAGCAATTGATGAGCil12a q(RT)PCR Rev primer
5
6
TE_qPCR_002ammp9_FCATTAAAGATGCCCTGATGTATCCCDr mmp9 q(RT)PCR Fwd primer (AM Meijer)
7
TE_qPCR_002bmmp9_RAGTGGTGGTCCGTGGTTGAGDr mmp9 q(RT)PCR Rev primer (AM Meijer)
8
9
TE_qPCR_003amCherry_FCCCCGTAATGCAGAAGAAGAmCherry q(RT)PCR Fwd Primer (JG Patton)
10
TE_qPCR_003bmCherry_RTCTTGGCCTTGTAGGTGGTCmCherry q(RT)PCR Rev Primer (JG Patton)
11
12
TE_qPCR_004amfap4_FGGAAGGAGAGGTTTCGCTCAmfap4 q(RT)PCR Fwd Primer (R. Beerman, Tobin)
13
TE_qPCR_004bmfap4_RGGTGGCATCTTCTCCCCATAmfap4 q(RT)PCR Rev Primer (R. Beerman, Tobin)
14
15
TE_qPCR_005aeGFP_FGAAGAAGTCGTGCTGCTTCAeGFP q(RT)PCR Fwd Primer (Camp, PLoS Gen)
16
TE_qPCR_005beGFP_RCCTGAAGTTCATCTGCACCAeGFP q(RT)PCR Rev Primer (Camp, Plos Gen)
17
18
TE_qPCR_006atdT_FCACCATCGTGGAACAGTACGtdTomato q(RT)PCR Fwd Primer (Camp, PLoS Gen)
19
TE_qPCR_006btdT_RGGCCATGTTGTTGTCCTCtdTomato q(RT)PCR Rev Primer (Camp, PLoS Gen)
20
21
TE_qPCR_007aDr_stat3_F0ACAGCAGGATGGCCAGGTTGCDr q(RT)PCR Fwd 0 (Liu, Solnica-Krezel)
22
TE_qPCR_007bDr_stat3_R0TCTGTCTGGTGGCTGCTGCCTDr q(RT)PCR Rev 0 (Liu, Solnica-Krezel)
23
24
TE_qPCR_008aDr_stat3_F1CCCATGGAGCTCCGACAGTTDr q(RT)PCR Fwd 1 (Liu, Solnica-Krezel)
25
TE_qPCR_008bDr_stat3_R1ACGATGCGGGCAATCTCCATDr q(RT)PCR Rev 1 (Liu, Solnica-Krezel)
26
27
TE_qPCR_009aDr_stat3_F2TTTGGCAAATACTGCCGCCCDr q(RT)PCR Fwd 2 (Liu, Solnica-Krezel)
28
TE_qPCR_009bDr_stat3_R2ATGAGAGAGTCGAGCGTGCGDr q(RT)PCR Rev 2 (Liu, Solnica-Krezel)
29
30
TE_qPCR_010aDr_stat3_F3CTGTGTCACCCCGTGTCCTTDr q(RT)PCR Fwd 3 (Liu, Solnica-Krezel)
31
TE_qPCR_010bDr_stat3_R3GCCTCAGCAGCTTCGTTGTGDr q(RT)PCR Rev 3 (Liu, Solnica-Krezel)
32
33
TE_qPCR_011bdsRed_RevTCTTGGCCTTGTACACGGTCModified mCherry rev (003b) for dsRed (Q)PCR
34
35
TE qPCR_012aDr_bactin_FGCCCCACCTGAGCGTAAATADr b-actin fwd primer (I. Semova)
36
TE_qPCR_012bDr_bactin_RCCTGCTTGCTAATCCACATCTGDr b-actin rev primer (I. Semova)
37
38
TE_qPCR_013aDr_l-plastin_FTGTCTGTGCCCGACACCATDr l-plastin qPCR fwd primer
39
TE_qPCR_013bDr_l-plastin_RGGCGGAGGCAGAGTTCAGDr l-plastin qPCR rev primer
40
41
TE_qPCR_014aDr_gcsf_FGCTTTTTGATTGGTGTTGCTATAATGDr gcsf qPCR fwd primer
42
TE_qPCR_014bDr_gcsf_RCAACGATCCCCACTAATGTGAADr gcsf qPCR rev primer
43
44
TE_qPCR_015aDr_gcsfr_FTGAACAATCAGACCGCACAACDr gcsfr fwd primer
45
TE_qPCR_015bDr_gcsfr_RGCCATTGGCACGGAACTGDr gcsfr rev primer
46
47
TE_qPCR_016aDr_il17a_FGGTCAAATGAATGAACCATGTDr il17a qPCR fwd primer
48
TE_qPCR_016bDr_il17a_RTGCAAGCCACCATAAGAAAGCDr il17a qPCR rev primer
49
50
TE_qPCR_017aDr_il17c_FCAATCACTCCGAAGTCACTTTTGATDr il17c qPCR fwd primer
51
TE_qPCR_017bDr_il17c_RCGACAACCAGAAGAATAATAATCCAADr il17c qPCR rev primer
52
53
TE_qPCR_018aDr_il17d_FGCGAACACCGGTCAATCTGDr il17d qPCR fwd primer
54
TE_qPCR_018bDr_il17d_RGCTGGATCATGGGAGATTCTGTACDr il17d qPCR rev primer
55
56
TE_qPCR_019aDr_muc5AC_FTGTGGACCCGAGCAAAAATTADr muc qPCR fwd primer
57
TE_qPCR_019b
Dr_muc5AC_R
AGCTAACTCGAATCCCACATCACDr muc qPCR rev primer
58
59
TE_qPCR_020aDr_il23p19_FCTGAAAGTGCTTAAGGAATCGGDr il23p19 qPCR fwd primer
60
TE_qPCR_020bDr_il23p19_RGAGAAGGAGTAGAGTCTTTCCACDr il23p19 qPCR rev primer
61
62
TE_qPCR_021aDr_cmyb_F
63
TE_qPCR_021bDr_cmyb_R
64
65
TE_qPCR_022aDr_runx1_F
66
TE_qPCR_022bDr_runx1_R
67
68
TE_qPCR_023aDr_ikaros_F
69
TE_qPCR_023bDr_ikaros_R
70
71
TE_qPCR_024aDr_cd41_F
72
TE_qPCR_024bDr_cd41_R
73
74
TE_qPCR_025aDr_pu1_F
75
TE_qPCR_025bDr_pu1_R
76
77
TE_qPCR_026aDr_cd45_F
78
TE_qPCR_026bDr_cd45_R
79
80
TE_qPCR_027aDr_elfa_FCTTCTCAGGCTGACTGTGCDr elfa q(RT)-PCR forward primer (housekeeping)
81
TE_qPCR_027bDr_elfa_RCCGCTAGGATTACCCTCCDr elfa q(RT)-PCR reverse primer (housekeeping)
82
83
TE_qPCR_028aDr_cd11b_F1GACACATCAAGTCTGATCGTGAGCG
Dr cd11b q(RT)-PCR forward primer - spans intron2-3 - ps 1
84
TE_qPCR_028bDr_cd11b_R1CATGTTGACAGCTTCTGAGGGC
Dr cd11b q(RT)-PCR reverse primer - spans intron3-4 - ps 1
85
86
TE_qPCR_029aDr_cd11b_F2CAGAGACTGTCTTGGTCAGATTGAC
Dr cd11b q(RT)-PCR forward primer - spans intron5-6 - ps 2
87
TE_qPCR_029bDr_cd11b_R2GTCATTGGAGTACTGTGCAATGGCDr cd11b q(RT)-PCR reverse primer - exon7 - ps 2
88
89
TE_qPCR_030aDr_il4_FGCAGGAATGGCTTTGAAGGGDr il4 q(RT)-PCR forward primer
90
TE_qPCR_030bDr_il4_RGCAGTTTCCAGTCCCGGTATDr il4 q(RT)-PCR reverse primer
91
92
TE_qPCR_031aDr_il6_FGCTATTCCTGTCTGCTACACTGGDr il6 q(RT)-PCR forward primer
93
TE_qPCR_031bDr_il6_RTGAGGAGAGGAGTGCTGATCCDr il6 q(RT)-PCR reverse primer
94
95
TE_qPCR_032aDr_duox_F1CGTGGCCTTTGGTTATCATGTGTG
Dr duox q(RT)-PCR forward primer - spans intron3-4 - ps 1
96
TE_qPCR_032bDr_duox_R1GCCGTCACGTGATTCACCTGTG
Dr duox q(RT)-PCR reverse primer - spans intron4-5 - ps 1
97
98
TE_qPCR_033aDr_duox_F2CCACTGCCAGTGAGTGGTTGG
Dr duox q(RT)-PCR forward primer - spans intron15-16 - ps 2
99
TE_qPCR_033bDr_duox_R2GATCGTACTCTTTGGGGATCTTCAGDr duox q(RT)-PCR reverse primer - exon16 - ps 2
100
Loading...
 
 
 
STE qPCR Primers
STE mouse qPCR primers
cloning primers
in situ cloning primers
genotyping primers