New basal Y tree SNPs from 407553 bp of resequencing for macro-haplogroups Y0, A0 and A1-T with primer sequences
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
|
 
Still loading...
ABCDEFGHIJKLMNO
1
chrstartendIDancestralderivedforward primer nameforward primer sequencereverse primer namereverse primer sequencenew haplogroupmutation commentscount testedcount derived
2
ChrY28863122886312L1086ATM11v2_F and DF25_FTCTCTCTGTCTGTCTCTCCCTCC M11v2_F and DF25_RAGATGGCCAGAAACATGAGC Y0A to TFound in a hg A0 WTY participant41
3
ChrY29354992935499L1087GTM329_FCCAGTCTTCATTCCCTCATC M329_RGCTGTCAAGGTGGATTGTTT Y0G to TFound in a hg A0 WTY participant51
4
ChrY29472792947279L1088CGM346/L191_FAGATGGGAAAGGCAGCCAA M346/L191_RTCTGTCCACATGTGTCCGTG Y0C to GFound in a hg A0 WTY participant51
5
ChrY48409034840903L1091GTL461_FTAATAGCTTCTTACTTGTGCATTTCAACL461_RGGCCTAGTTATTGTATATGGGGACY0G to TFound in a hg A0 WTY participant51
6
ChrY49602214960221L1092GTV172_FTGAAAGCCAATTGAAAGTGTTTGV172_RGGGCCTTTACAACTTCATTGCY0G to TFound in a hg A0 WTY participant51
7
ChrY53351585335158L1094ATP95v2_FAGAAGATGATAAAGATGGTGP95v2_RCTTATTTGTTTCAGAGCAGGY0A to TFound in a hg A0 WTY participant51
8
ChrY68132966813296L1095GAL15/L23/L76/L79/L130/L142/L147/L192_FGGAGAATGCTTACGGACTGCTGTTGGL15/L23/L76/L79/L130/L142/L147/L192_RCATATTCTTTATCCAATCTGCCATCY0G to AFound in a hg A0 WTY participant91
9
ChrY68953846895384L1096GAZ724_FCTACAGCTGCAGCACAGACCZ724_RCCAATTGCTGGAGAGAGAGCY0G to AFound in a hg A0 WTY participant31
10
ChrY69032176903217L1097CTV149_FGCAGCTTGCTTTCTTTATCTAGGV149_RACTGAAACACTTTTATCTCCCCGY0C to TFound in a hg A0 WTY participant51
11
ChrY69116616911661L1100CTV16_FGGTTCAGAATCCTCTGGCACTAV16_RACAAGAGTTACAAGACCGGGAAY0C to TFound in a hg A0 WTY participant51
12
ChrY69364556936455L1102AGV156_FACACCAGTATTCCAGTGAGCAGV156_RTCCTTGAAGCAAAACCAAGAAY0A to GFound in a hg A0 WTY participant51
13
ChrY69399136939913L1103CTV79_FTTTATGAGGGCTTTTGCACTTV79_RGCTCCATGTTGAGTGCTCTTTTY0C to TFound in a hg A0 WTY participant51
14
ChrY69557586955758L1104CTV81/V82_FTTCTGTAACCAGGCAGTTGAGAV81/V82_RGAGGGAACATGATCAAGGAAACY0C to TFound in a hg A0 WTY participant41
15
ChrY77075337707533L1106GCP242/L234_FGCTGTTTCTCCTTCTCTGTG P242/L234_RATAAATCCCAAATCAATCAAAG Y0G to CFound in a hg A0 WTY participant51
16
ChrY77192147719214L1107CAV242_FGTACCAAAAACAATGCTGCTGV242_RCCTGGGATGCTCATTCCTAAY0C to AFound in a hg A0 WTY participant51
17
ChrY77761447776144L1108CAL34_FGTTACCATCTGTTACCTATAGCCTTGGL34_RCACTTTCCCCTAAAGGGAATCY0C to AFound in a hg A0 WTY participant41
18
ChrY79436307943630L1109ACYSCC0000044_FGACCTCAACAATGGGTTTTG YSCC0000044_RGCCAGAGCCACAGAAGGTAGY0A to CFound in a hg A0 WTY participant51
19
ChrY1045753410457534L1110CTZ58v2_FGGCTGAGGCTGCTGTATCTCZ58v2_RACAGACCAAAGGGTAAAATATACGY0C to TFound in a hg A0 WTY participant41
20
ChrY83281368328136L1111CTL515_FGTTCAGTGTTCTTCAAGCCATTTGTTAGTCL515_RGGGCATTGAAGGGGAAGACATCGY0C to TFound in a hg A0 WTY participant51
21
ChrY85274138527413L1113AGP278/P326/L66/P289/P291/L183_FGCTCATTCTCTCAGGCAAG P278/P326/L66/P289/P291/L183_RGAGTTCTCCTCCCCTAAGC Y0A to GFound in a hg A0 WTY participant41
22
ChrY86632778663277L1114AGZ225_FCCTGAGAGAATGAGCTGTTGZ225_RGTGTGGAATTTGGCCTCCAGY0A to GFound in a hg A0 WTY participant41
23
ChrY1059471010594710L1115GCL64/L293v2_FTGCCTGGACCAATGAAGCTTL64/L293v2_RCAGAAGTCAAGGGCAGGAAGY0G to CFound in a hg A0 WTY participant41
24
ChrY1279642612796426L1117ATL24_FAATGAAAGAGTGTCTTCCTCCL24_RATGTTTCTTTTCCTTACTGAGGTCY0A to TFound in a hg A0 WTY participant31
25
ChrY1291792212917922L1119GAZ248_FAATCAGAAGCTGGGTGGTTGZ248_RATCCACTCCGTCGAAACATCY0G to AFound in a hg A0 WTY participant41
26
ChrY1300644713006447L1120TGP36/P48_FTGAAGGACAGTAAGTACACA P36/P48_RTAAGTCCATTGATCTACAGAY0T to GFound in a hg A0 WTY participant41
27
ChrY1300644713006447L1120TGP36/P48_FTGAAGGACAGTAAGTACACA P36/P48_RTAAGTCCATTGATCTACAGAY0T to GFound in a hg A0 WTY participant41
28
ChrY1300645613006456L1121AGP36/P48_FTGAAGGACAGTAAGTACACA P36/P48_RTAAGTCCATTGATCTACAGAY0A to GFound in a hg A0 WTY participant41
29
ChrY1300645613006456L1121AGP36/P48_FTGAAGGACAGTAAGTACACA P36/P48_RTAAGTCCATTGATCTACAGAY0A to GFound in a hg A0 WTY participant41
30
ChrY28383962838396L1122CTV188_FCAAGCCTCTAGGCAGATTGG+V188_RGCGGAACATTAGCATGTGTGY0C to TFound in a hg A0 WTY participant41
31
ChrY28383962838396L1122CTV188_FCAAGCCTCTAGGCAGATTGG+V188_RGCGGAACATTAGCATGTGTGY0C to TFound in a hg A0 WTY participant41
32
ChrY1411439714114397L1126AGL30/L284v2_FGGCTGAAGCAGGAGAATCACL30/L284v2_RGCTGACATGGGGAGAATCACY0A to GFound in a hg A0 WTY participant41
33
ChrY1411439714114397L1126AGL30/L284v2_FGGCTGAAGCAGGAGAATCACL30/L284v2_RGCTGACATGGGGAGAATCACY0A to GFound in a hg A0 WTY participant41
34
ChrY1510624015106240L1129CTL86_FGGCATTTCTCTCAATCAGGAGTTGGCL86_RCAAGATAAGTCTTTTTGGGTGTAGTAAAACTCY0C to TFound in a hg A0 WTY participant31
35
ChrY1510624015106240L1129CTL86_FGGCATTTCTCTCAATCAGGAGTTGGCL86_RCAAGATAAGTCTTTTTGGGTGTAGTAAAACTCY0C to TFound in a hg A0 WTY participant31
36
ChrY1788571117885711L1140GCYSC0000054_FCACACATATGTTTATTGAGGCACC YSCC0000054_RGTTGGTCATGTTCTACACACAGC Y0G to CFound in a hg A0 WTY participant41
37
ChrY1950269819502698L1141CTZ94_FCCGGGAGGAATGAACAACZ94_RCAAGAGCCCCACATTTTATATTCY0C to TFound in a hg A0 WTY participant31
38
ChrY2017669420176694L1144CTM161/M101/M145/M156/M223_FTCACAGCAGCTTCAGCAAA M161/M101/M145/M156/M223_RCCTTTTTGGATCATGGTTCTT Y0C to TFound in a hg A0 WTY participant41
39
ChrY2019904820199048L1146GAL4v2_FTACTGGAAATACAAACTGTGGCL4v2_RAGGAGCAGAGATACAGAGGAY0G to AFound in a hg A0 WTY participant31
40
ChrY2021192820211928L1147ATM44_FCTGGCACCTTCTGATATTTTGAG M44_RTGTGATTTCTATGTGTTTGAGGAC Y0A to TFound in a hg A0 WTY participant31
41
ChrY2032870320328703L1148CTM54_FCCTCCTCTGGTCTGGGTTT M54_RTGTGTCAGGACTGGTTCCAT Y0C to TFound in a hg A0 WTY participant31
42
ChrY2032921620329216L1149CTPAGES00119_FAGATAGAAGTCGGAGAAGAGG PAGES00119_RAGGTATTGACAGCACATTCC Y0C to TFound in a hg A0 WTY participant31
43
ChrY2037638120376381L1151GTM89/L182_FAGAAGCAGATTGATGTCCCACTM89/L182_RTCCAGTTAGGAGATCCCCTCA Y0G to TFound in a hg A0 WTY participant31
44
ChrY2038533820385338L1152CTM102_FAAACTGGGACACTTGTAATGAAT M102_RGTTTTTTGAGTCCTTGTTTATTCTT Y0C to TFound in a hg A0 WTY participant31
45
ChrY2065051920650519L1154AGYSC0000050_FCACAGAACTTAAACCAGAAGTACCYSC0000050_RGAGTAGATGTGCAGATTTGTTACC Y0A to GFound in a hg A0 WTY participant31
46
ChrY2137836921378369L1156CGL510_FCTTTGGCTAAAGTAGTGTGACTATTGCL510_RGTCCAGCAAGTTTGTGCCTTTAATTGY0C to GFound in a hg A0 WTY participant31
47
ChrY2138645121386451L1157GAYSC0000235_FCTGGGTAAATGCACCTGGAG YSC0000235_RCAGGGCTACCTCAAGCAGAG Y0G to AFound in a hg A0 WTY participant21
48
ChrY2141944921419449L1158GTYSC0000235_FCTGGGTAAATGCACCTGGAG YSC0000235_RCAGGGCTACCTCAAGCAGAG Y0G to TFound in a hg A0 WTY participant41
49
ChrY2143105421431054L1159ATL27_FGTTATAAGTGTGGAAAGGAGGTCL27_RCTATTATGCTACTTTCTGCCACTACY0A to TFound in a hg A0 WTY participant21
50
ChrY2152731821527318L1160AGV196_FGCAGCACAAAACTGCTGAAGV196_RTCATTTGTCCCTCACCTGAAY0A to GFound in a hg A0 WTY participant21
51
ChrY2202145122021451L1161TCL48/L299_FCATATGGGACAGATTCCTGGTACCL48/L299_RTACAATCTGTGGCTTATAACTGGCY0T to CFound in a hg A0 WTY participant101
52
ChrY2339629523396295L1162_1TCP66/P12/P18/P20/P25/P35/P64/P65/P67_FTGGATCTGATTCACAGGTAG P66/P12/P18/P20/P25/P35/P64/P65/P67_RCCAACAATATGTCACAATCTC Y0T to CFound in a hg A0 WTY participant11
53
ChrY2503004325030043L1162_2TCP66/P12/P18/P20/P25/P35/P64/P65/P67_FTGGATCTGATTCACAGGTAG P66/P12/P18/P20/P25/P35/P64/P65/P67_RCCAACAATATGTCACAATCTC Y0T to CFound in a hg A0 WTY participant11
54
ChrY2687183226871832L1163TCZ49_FGCCTAATTTGCGGGAGTTCZ49_RGTAGGTGAAGGGGCAGATTGY0T to CFound in a hg A0 WTY participant31
55
ChrY82780678278068DYS449delinsDYS449_FTGGAGTCTCTCAAGCCTGTTCTATDYS449_RACAGCAAACTCCACTTCCAGGY0ins TThttp://www.ncbi.nlm.nih.gov/pmc/articles/PMC270273911
56
ChrY1622561716225617L1005AGP286_FACTGGTGTGGAATGTCTATGG P286_RAGATGTATGAAAAGCCCTGG A0A to GFound in a hg A-L896 WTY participant194
57
ChrY81470598147059L986AGL309_FGACATTATGGATTTAATGCTTAAACACATCCL309_RCTGTTACCTTTAAATGAGCAGAAAGACA0A to GFound in a hg A-L896 WTY participant194
58
ChrY27701542770154P305GAPAGES00052-fCACGTGAGTCCATCCTTGAC PAGES00052-rGGAATTGGACACATTCATTAACCC A0G to A2514
59
ChrY85269958526995L1112AGP278/P326/L66/P289/P291/L183_FGCTCATTCTCTCAGGCAAG P278/P326/L66/P289/P291/L183_RGAGTTCTCCTCCCCTAAGC A0A to GFound in a hg A0 WTY participant42
60
ChrY2722626627226266L1164CGYSC0000242_FGAATTGAACGGAAAATTATGAATC YSC0000242_RACTCCATTATCCCCCATTCC A0C to GFound in a hg A0 WTY participant22
61
ChrY2722638727226387L1165GAYSC0000242_FGAATTGAACGGAAAATTATGAATC YSC0000242_RACTCCATTATCCCCCATTCC A0G to AFound in a hg A0 WTY participant22
62
ChrY2722638827226388L1166CAYSC0000242_FGAATTGAACGGAAAATTATGAATC YSC0000242_RACTCCATTATCCCCCATTCC A0C to AFound in a hg A0 WTY participant22
63
ChrY1408473714084737L1000CAM210_FCACTGTCTTCCACAATGGTTG M210_RAGGTGATTTTGTATTTATCTTCCCA0C to AFound in a hg A-L896 WTY participant193
64
ChrY1490199414901994L1001GTYSC0000264_FTCCCCTACTCTGGGGAAG YSC0000264_RAACCTTTTTGGCCTGTTACC A0G to TFound in a hg A-L896 WTY participant163
65
ChrY1628361616283616L1006ATDF23v2_FGCATAGTCTCTCTGTCTGTCATCCDF23v2_RAACCACCATTACGTGCATATACCA0A to TFound in a hg A-L896 WTY participant433
66
ChrY1662740816627408L1008CAL499_FCACAGTTCCATGTGCTTAGGGACAL499_RGCAATGCTGAGAGGAATCAACTTAGA0C to AFound in a hg A-L896 WTY participant193
67
ChrY1950283419502834L1010TCZ94_FCCGGGAGGAATGAACAACZ94_RCAAGAGCCCCACATTTTATATTCA0T to CFound in a hg A-L896 WTY participant223
68
ChrY1994081719940817L1012CTZ12_FCGTGTGGTGGCACTTATGACZ12_RCTTCTCCTGGTCCTCCTTCCA0C to TFound in a hg A-L896 WTY participant203
69
ChrY2035543720355437L1016TCV19/M85/M132/M148/M149/L175_FCAGTCCAGCCTGGGCGAGV19/M85/M132/M148/M149/L175_RCCCTTACAGCTAGTAGTTAACTTCATTCCA0T to CFound in a hg A-L896 WTY participant463
70
ChrY2171857121718571L1018TCYSC0000027_FTCTCACATCATGATCAAACTGG YSC0000027_RTGGTGGGGGAGATTACAAAG A0T to CFound in a hg A-L896 WTY participant163
71
ChrY2008148420081484L1055GAPAGES00020_FAAATCTCAATAACCTGGTCTCCC PAGES00020_RATGAGTCCTGTTAAAAGGATTAAGTG A0G to AFound in a hg A-L896 WTY participant92
72
ChrY69917006991700L529.2AGPAGES00073_FGCAATTGGCTAGGGTTAGACPAGES00073_RTTTGCTGGGAAATAGCAGCT A0A to GFound in a hg A0 WTY participant. Also in hg Q112
73
ChrY2016601420166014L896ATM139_FTTACTGATAATGCCATATTGTTTTG M139_RTTCTCAGACACCAATGGTCCT A0A to TFound in a hg A (x V168) person. Chimp is A-1583
74
ChrY2702183627021836L982CAL471_FGTCTCACTTTGTTACTCAGATL471_RCAGTTAGATCCCCCATGTCCCAACA0C to AFound in a hg A-L896 WTY participant173
75
ChrY71215057121505L984GTZ246_FCTTTAAATGTGTCCCAGACATTCTAAZ246_RGAAGGTCATGACATAATGGTAAGA0G to TFound in a hg A-L896 WTY participant183
76
ChrY1300706713007067L991CAP29/P30/P47_FGGTGGGCTGTTTGAAAAAGA P29/P30/P47_RAGCCAAATACCAGTCGTCAC A0C to AFound in a hg A-L896 WTY participant203
77
ChrY1297938012979380L993ACL382_FACAACCACAAGGATGTACAGTCL382_RAATTAGTCGAGCATGGAGCAAGA0A to CFound in a hg A-L896 WTY participant193
78
ChrY1341454113414541L995TCM185_FGGAGTACCTATCACTGAATGTGCM185_RGTCATTCATTTCTGCTTGGAACA0T to CFound in a hg A-L896 WTY participant173
79
ChrY1353368113533683L997insdelM259_FCAGAATGTTGGTTTACTCATTGTT M259_RTCACATGCTAAGAATTAGGTTTTT A0TTA to delFound in a hg A-L896 WTY participant153
80
ChrY1394620013946200L998TGM218/M219/M220_FTTGTGAGTTTTTTTCCATCAATCM218/M219/M220_RTTTATTGACGATGGTATTAGAAGAG A0T to GFound in a hg A-L896 WTY participant163
81
ChrY1394728113947281L999CTM216_FCTCAACCAGTTTTTATGAAGCTAG M216_RGAGAGTCTGAACTAATGTGTCTTGT A0C to TFound in a hg A-L896 WTY participant193
82
ChrY68481916848191V148GAACATGGCCCAAAGTAATCCTCGGAAAACAGCAAACATTCTTCAA0G to AApprox hg: A1b1043
83
ChrY69031516903151V149TGGCAGCTTGCTTTCTTTATCTAGGACTGAAACACTTTTATCTCCCCGA0T to GApprox hg: A1b833
84
ChrY69378916937891V154AGGTTTTGCAAGTTTCCAGCAGTCAGCTAACAAGTGGTAGAATGTGAA0A to GApprox hg: A1b483
85
ChrY69597936959793V157ATTGAGTGAGTGGTTCTTGTCACCACTTGCCCCAAACACTGAACA0A to TApprox hg: A1b431
86
ChrY1478619914786199V165GAV165v2_F+CAGCCAACTTGGTCAAGGACV165v2_R+TTAGGATTTTCATCCCACAGGA0G to AApprox hg: A1b62
87
ChrY1480226014802260V166GACACATCAAAGTCAGCATCTGGTATGCTATCTCATTTCTTCCCGCA0G to AApprox hg: A1b713
88
ChrY1610849616108496V167TCCAGCAGCCTGGAATGTAGAAATCCAAGAGAGAATGAGTGTTCCTA0T to CApprox hg: A1b562
89
ChrY49606004960600V172GATGAAAGCCAATTGAAAGTGTTTGGGGCCTTTACAACTTCATTGCA0G to AApprox hg: A1b733
90
ChrY49913384991338V173TGGACATCGTAAATAGTTCAATTCTGGAGAATTGAAAGACACTTGAATAACAATCGA0T to GApprox hg: A1b703
91
ChrY69066156906615V176CTTTCGTCCTCATGCAAAATGTAGAACAGCAGACACTAAAGACGCAA0C to TApprox hg: A1b531
92
ChrY69232296923229V177ATGCAGAGGGATCTTTTCCTACCTCATCTCCCTACACCTGTGAACCA0A to TApprox hg: A1b743
93
ChrY29325832932583V190GCACCAGTTTTGCAGGAACCACGTCCGCACCTACATCCACTTA0G to CApprox hg: A1b803
94
ChrY2152695521526955V196GTGCAGCACAAAACTGCTGAAGTCATTTGTCCCTCACCTGAAA0G to TApprox hg: A1b463
95
ChrY76524577652457V223AGAGGGCCCACTCCCTAGAATACTTAGCCTGCCCTCACATTCA0A to GApprox hg: A1b1143
96
ChrY76563157656315V225CTTGAGAGGTCGATGTCGAGTGGGGAACAAAGTTTCCCTCTGA0C to TApprox hg: A1b673
97
ChrY76666337666633V229GAACCAGGAGGGCACAGTACAACCTGTGGGCAGATTCATTTTA0G to AApprox hg: A1b753
98
ChrY77044757704475V233CTGCATTTTATTTAGGTGGGGTTTTGTCTTTGGGTGATTTGGAAA0C to TApprox hg: A1b813
99
ChrY77143537714353V239GAACGTGCTCCCACAATACCATACCCAAAACAGCTTTTCAGCA0G to AApprox hg: A1b823
100
ChrY1490225014902250L1002ATYSC0000264_FTCCCCTACTCTGGGGAAGYSC0000264_RAACCTTTTTGGCCTGTTACCA1-TA to TFound ancestral in a hg A-L896 WTY participant1612
Loading...
 
 
 
Y0,A0,A1a-T SNPs