New basal Y tree SNPs from 407553 bp of resequencing for macro-haplogroups Y0, A0 and A1-T with primer sequences
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
chrstartendIDancestralderivedforward primer nameforward primer sequencereverse primer namereverse primer sequencenew haplogroupmutation commentscount testedcount derived
ChrY28863122886312L1086ATM11v2_F and DF25_FTCTCTCTGTCTGTCTCTCCCTCC M11v2_F and DF25_RAGATGGCCAGAAACATGAGC Y0A to TFound in a hg A0 WTY participant41
ChrY29354992935499L1087GTM329_FCCAGTCTTCATTCCCTCATC M329_RGCTGTCAAGGTGGATTGTTT Y0G to TFound in a hg A0 WTY participant51
ChrY29472792947279L1088CGM346/L191_FAGATGGGAAAGGCAGCCAA M346/L191_RTCTGTCCACATGTGTCCGTG Y0C to GFound in a hg A0 WTY participant51
ChrY49602214960221L1092GTV172_FTGAAAGCCAATTGAAAGTGTTTGV172_RGGGCCTTTACAACTTCATTGCY0G to TFound in a hg A0 WTY participant51
ChrY53351585335158L1094ATP95v2_FAGAAGATGATAAAGATGGTGP95v2_RCTTATTTGTTTCAGAGCAGGY0A to TFound in a hg A0 WTY participant51
ChrY68132966813296L1095GAL15/L23/L76/L79/L130/L142/L147/L192_FGGAGAATGCTTACGGACTGCTGTTGGL15/L23/L76/L79/L130/L142/L147/L192_RCATATTCTTTATCCAATCTGCCATCY0G to AFound in a hg A0 WTY participant91
ChrY68953846895384L1096GAZ724_FCTACAGCTGCAGCACAGACCZ724_RCCAATTGCTGGAGAGAGAGCY0G to AFound in a hg A0 WTY participant31
ChrY69364556936455L1102AGV156_FACACCAGTATTCCAGTGAGCAGV156_RTCCTTGAAGCAAAACCAAGAAY0A to GFound in a hg A0 WTY participant51
ChrY69399136939913L1103CTV79_FTTTATGAGGGCTTTTGCACTTV79_RGCTCCATGTTGAGTGCTCTTTTY0C to TFound in a hg A0 WTY participant51
ChrY69557586955758L1104CTV81/V82_FTTCTGTAACCAGGCAGTTGAGAV81/V82_RGAGGGAACATGATCAAGGAAACY0C to TFound in a hg A0 WTY participant41
ChrY77075337707533L1106GCP242/L234_FGCTGTTTCTCCTTCTCTGTG P242/L234_RATAAATCCCAAATCAATCAAAG Y0G to CFound in a hg A0 WTY participant51
ChrY77192147719214L1107CAV242_FGTACCAAAAACAATGCTGCTGV242_RCCTGGGATGCTCATTCCTAAY0C to AFound in a hg A0 WTY participant51
ChrY79436307943630L1109ACYSCC0000044_FGACCTCAACAATGGGTTTTG YSCC0000044_RGCCAGAGCCACAGAAGGTAGY0A to CFound in a hg A0 WTY participant51
ChrY1045753410457534L1110CTZ58v2_FGGCTGAGGCTGCTGTATCTCZ58v2_RACAGACCAAAGGGTAAAATATACGY0C to TFound in a hg A0 WTY participant41
ChrY85274138527413L1113AGP278/P326/L66/P289/P291/L183_FGCTCATTCTCTCAGGCAAG P278/P326/L66/P289/P291/L183_RGAGTTCTCCTCCCCTAAGC Y0A to GFound in a hg A0 WTY participant41
ChrY86632778663277L1114AGZ225_FCCTGAGAGAATGAGCTGTTGZ225_RGTGTGGAATTTGGCCTCCAGY0A to GFound in a hg A0 WTY participant41
ChrY1059471010594710L1115GCL64/L293v2_FTGCCTGGACCAATGAAGCTTL64/L293v2_RCAGAAGTCAAGGGCAGGAAGY0G to CFound in a hg A0 WTY participant41
ChrY1279642612796426L1117ATL24_FAATGAAAGAGTGTCTTCCTCCL24_RATGTTTCTTTTCCTTACTGAGGTCY0A to TFound in a hg A0 WTY participant31
ChrY1291792212917922L1119GAZ248_FAATCAGAAGCTGGGTGGTTGZ248_RATCCACTCCGTCGAAACATCY0G to AFound in a hg A0 WTY participant41
ChrY1300644713006447L1120TGP36/P48_FTGAAGGACAGTAAGTACACA P36/P48_RTAAGTCCATTGATCTACAGAY0T to GFound in a hg A0 WTY participant41
ChrY1300644713006447L1120TGP36/P48_FTGAAGGACAGTAAGTACACA P36/P48_RTAAGTCCATTGATCTACAGAY0T to GFound in a hg A0 WTY participant41
ChrY1300645613006456L1121AGP36/P48_FTGAAGGACAGTAAGTACACA P36/P48_RTAAGTCCATTGATCTACAGAY0A to GFound in a hg A0 WTY participant41
ChrY1300645613006456L1121AGP36/P48_FTGAAGGACAGTAAGTACACA P36/P48_RTAAGTCCATTGATCTACAGAY0A to GFound in a hg A0 WTY participant41
ChrY28383962838396L1122CTV188_FCAAGCCTCTAGGCAGATTGG+V188_RGCGGAACATTAGCATGTGTGY0C to TFound in a hg A0 WTY participant41
ChrY28383962838396L1122CTV188_FCAAGCCTCTAGGCAGATTGG+V188_RGCGGAACATTAGCATGTGTGY0C to TFound in a hg A0 WTY participant41
ChrY1411439714114397L1126AGL30/L284v2_FGGCTGAAGCAGGAGAATCACL30/L284v2_RGCTGACATGGGGAGAATCACY0A to GFound in a hg A0 WTY participant41
ChrY1411439714114397L1126AGL30/L284v2_FGGCTGAAGCAGGAGAATCACL30/L284v2_RGCTGACATGGGGAGAATCACY0A to GFound in a hg A0 WTY participant41
ChrY1788571117885711L1140GCYSC0000054_FCACACATATGTTTATTGAGGCACC YSCC0000054_RGTTGGTCATGTTCTACACACAGC Y0G to CFound in a hg A0 WTY participant41
ChrY1950269819502698L1141CTZ94_FCCGGGAGGAATGAACAACZ94_RCAAGAGCCCCACATTTTATATTCY0C to TFound in a hg A0 WTY participant31
ChrY2017669420176694L1144CTM161/M101/M145/M156/M223_FTCACAGCAGCTTCAGCAAA M161/M101/M145/M156/M223_RCCTTTTTGGATCATGGTTCTT Y0C to TFound in a hg A0 WTY participant41
ChrY2019904820199048L1146GAL4v2_FTACTGGAAATACAAACTGTGGCL4v2_RAGGAGCAGAGATACAGAGGAY0G to AFound in a hg A0 WTY participant31
ChrY2021192820211928L1147ATM44_FCTGGCACCTTCTGATATTTTGAG M44_RTGTGATTTCTATGTGTTTGAGGAC Y0A to TFound in a hg A0 WTY participant31
ChrY2032870320328703L1148CTM54_FCCTCCTCTGGTCTGGGTTT M54_RTGTGTCAGGACTGGTTCCAT Y0C to TFound in a hg A0 WTY participant31
ChrY2032921620329216L1149CTPAGES00119_FAGATAGAAGTCGGAGAAGAGG PAGES00119_RAGGTATTGACAGCACATTCC Y0C to TFound in a hg A0 WTY participant31
ChrY2037638120376381L1151GTM89/L182_FAGAAGCAGATTGATGTCCCACTM89/L182_RTCCAGTTAGGAGATCCCCTCA Y0G to TFound in a hg A0 WTY participant31
ChrY2038533820385338L1152CTM102_FAAACTGGGACACTTGTAATGAAT M102_RGTTTTTTGAGTCCTTGTTTATTCTT Y0C to TFound in a hg A0 WTY participant31
ChrY2065051920650519L1154AGYSC0000050_FCACAGAACTTAAACCAGAAGTACCYSC0000050_RGAGTAGATGTGCAGATTTGTTACC Y0A to GFound in a hg A0 WTY participant31
ChrY2138645121386451L1157GAYSC0000235_FCTGGGTAAATGCACCTGGAG YSC0000235_RCAGGGCTACCTCAAGCAGAG Y0G to AFound in a hg A0 WTY participant21
ChrY2141944921419449L1158GTYSC0000235_FCTGGGTAAATGCACCTGGAG YSC0000235_RCAGGGCTACCTCAAGCAGAG Y0G to TFound in a hg A0 WTY participant41
ChrY2152731821527318L1160AGV196_FGCAGCACAAAACTGCTGAAGV196_RTCATTTGTCCCTCACCTGAAY0A to GFound in a hg A0 WTY participant21
ChrY2202145122021451L1161TCL48/L299_FCATATGGGACAGATTCCTGGTACCL48/L299_RTACAATCTGTGGCTTATAACTGGCY0T to CFound in a hg A0 WTY participant101
ChrY2339629523396295L1162_1TCP66/P12/P18/P20/P25/P35/P64/P65/P67_FTGGATCTGATTCACAGGTAG P66/P12/P18/P20/P25/P35/P64/P65/P67_RCCAACAATATGTCACAATCTC Y0T to CFound in a hg A0 WTY participant11
ChrY2503004325030043L1162_2TCP66/P12/P18/P20/P25/P35/P64/P65/P67_FTGGATCTGATTCACAGGTAG P66/P12/P18/P20/P25/P35/P64/P65/P67_RCCAACAATATGTCACAATCTC Y0T to CFound in a hg A0 WTY participant11
ChrY2687183226871832L1163TCZ49_FGCCTAATTTGCGGGAGTTCZ49_RGTAGGTGAAGGGGCAGATTGY0T to CFound in a hg A0 WTY participant31
ChrY1622561716225617L1005AGP286_FACTGGTGTGGAATGTCTATGG P286_RAGATGTATGAAAAGCCCTGG A0A to GFound in a hg A-L896 WTY participant194
ChrY85269958526995L1112AGP278/P326/L66/P289/P291/L183_FGCTCATTCTCTCAGGCAAG P278/P326/L66/P289/P291/L183_RGAGTTCTCCTCCCCTAAGC A0A to GFound in a hg A0 WTY participant42
ChrY2722626627226266L1164CGYSC0000242_FGAATTGAACGGAAAATTATGAATC YSC0000242_RACTCCATTATCCCCCATTCC A0C to GFound in a hg A0 WTY participant22
ChrY2722638727226387L1165GAYSC0000242_FGAATTGAACGGAAAATTATGAATC YSC0000242_RACTCCATTATCCCCCATTCC A0G to AFound in a hg A0 WTY participant22
ChrY2722638827226388L1166CAYSC0000242_FGAATTGAACGGAAAATTATGAATC YSC0000242_RACTCCATTATCCCCCATTCC A0C to AFound in a hg A0 WTY participant22
ChrY1408473714084737L1000CAM210_FCACTGTCTTCCACAATGGTTG M210_RAGGTGATTTTGTATTTATCTTCCCA0C to AFound in a hg A-L896 WTY participant193
ChrY1490199414901994L1001GTYSC0000264_FTCCCCTACTCTGGGGAAG YSC0000264_RAACCTTTTTGGCCTGTTACC A0G to TFound in a hg A-L896 WTY participant163
ChrY1628361616283616L1006ATDF23v2_FGCATAGTCTCTCTGTCTGTCATCCDF23v2_RAACCACCATTACGTGCATATACCA0A to TFound in a hg A-L896 WTY participant433
ChrY1662740816627408L1008CAL499_FCACAGTTCCATGTGCTTAGGGACAL499_RGCAATGCTGAGAGGAATCAACTTAGA0C to AFound in a hg A-L896 WTY participant193
ChrY1950283419502834L1010TCZ94_FCCGGGAGGAATGAACAACZ94_RCAAGAGCCCCACATTTTATATTCA0T to CFound in a hg A-L896 WTY participant223
ChrY1994081719940817L1012CTZ12_FCGTGTGGTGGCACTTATGACZ12_RCTTCTCCTGGTCCTCCTTCCA0C to TFound in a hg A-L896 WTY participant203
ChrY2035543720355437L1016TCV19/M85/M132/M148/M149/L175_FCAGTCCAGCCTGGGCGAGV19/M85/M132/M148/M149/L175_RCCCTTACAGCTAGTAGTTAACTTCATTCCA0T to CFound in a hg A-L896 WTY participant463
ChrY2171857121718571L1018TCYSC0000027_FTCTCACATCATGATCAAACTGG YSC0000027_RTGGTGGGGGAGATTACAAAG A0T to CFound in a hg A-L896 WTY participant163
ChrY69917006991700L529.2AGPAGES00073_FGCAATTGGCTAGGGTTAGACPAGES00073_RTTTGCTGGGAAATAGCAGCT A0A to GFound in a hg A0 WTY participant. Also in hg Q112
ChrY2016601420166014L896ATM139_FTTACTGATAATGCCATATTGTTTTG M139_RTTCTCAGACACCAATGGTCCT A0A to TFound in a hg A (x V168) person. Chimp is A-1583
ChrY2702183627021836L982CAL471_FGTCTCACTTTGTTACTCAGATL471_RCAGTTAGATCCCCCATGTCCCAACA0C to AFound in a hg A-L896 WTY participant173
ChrY1300706713007067L991CAP29/P30/P47_FGGTGGGCTGTTTGAAAAAGA P29/P30/P47_RAGCCAAATACCAGTCGTCAC A0C to AFound in a hg A-L896 WTY participant203
ChrY1297938012979380L993ACL382_FACAACCACAAGGATGTACAGTCL382_RAATTAGTCGAGCATGGAGCAAGA0A to CFound in a hg A-L896 WTY participant193
ChrY1341454113414541L995TCM185_FGGAGTACCTATCACTGAATGTGCM185_RGTCATTCATTTCTGCTTGGAACA0T to CFound in a hg A-L896 WTY participant173
ChrY1353368113533683L997insdelM259_FCAGAATGTTGGTTTACTCATTGTT M259_RTCACATGCTAAGAATTAGGTTTTT A0TTA to delFound in a hg A-L896 WTY participant153
ChrY1394620013946200L998TGM218/M219/M220_FTTGTGAGTTTTTTTCCATCAATCM218/M219/M220_RTTTATTGACGATGGTATTAGAAGAG A0T to GFound in a hg A-L896 WTY participant163
ChrY1394728113947281L999CTM216_FCTCAACCAGTTTTTATGAAGCTAG M216_RGAGAGTCTGAACTAATGTGTCTTGT A0C to TFound in a hg A-L896 WTY participant193
ChrY1490225014902250L1002ATYSC0000264_FTCCCCTACTCTGGGGAAGYSC0000264_RAACCTTTTTGGCCTGTTACCA1-TA to TFound ancestral in a hg A-L896 WTY participant1612
Y0,A0,A1a-T SNPs