R86 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79X80X81X82X83X84X85X86X87X88
2
1WBT120% Non Watson-Crick Base Pairs - Effortless4299215
GGAAAUAAUAUUUAAAAUUUAUUAAUAAUACAAAUAUUAUUAAUAAAUUUUAAAUAUUUGGAGCAGUGAGUUCGCUCACUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.272
medium
91.40.050.550.30.44660.53940.72661.25580.99430.48450.01610.06670.0320.0320.0640-0.04550.0320.0160.07980.03190.06380000.063700.06360000.1270.11862.35210.84771.43911.05831.66981.28090.24430.2340.10780.0539000.0807000.05370.02690.08050-0.0450.05360.08030.03520.026700.00850.05340.10650.37060.27110.76091.1481.12710.81560.07410.17230.39510.02820.35470.0520.37230.98290.44650.58810.866400000000000000
3
2the easy20% Non Watson-Crick Base Pairs - Effortless4301487
GGAAAAGCAUAUAAUAUAUAUAUAUAUAUGAAAACAUAUAUAUAUAUAUAUUAUAUGCAAAUACGCGGCGUUCGUGCCGCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.3weak82.900.5190.2590.74080.7321.078900.7110.702900000000000000.349500000000000.347501.0252000-0.5803000000000.33990000.33800.3362000-0.57490.334301.30911.90311.24330.91860.606400.30170.30020.887800.87522.51872.67741.05270.71891.995100000000000000
4
3Raze the Roof I20% Non Watson-Crick Base Pairs - Effortless4307445
GGAAAACUCACAGUGUGCGUCUUGCUCUCAGAAAUGAUAGCAUGACACAGACUGAGAGAAACACGGUACCUUCGGGUACCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.956
medium
88.60.0190.2130.1160.42850.6050.80330.60040.40890.25180.08870.04430.06040.19860.04410.044100.0440.35130.00110.05830.05820.02290.01450.029100.01450.04360.014500.04350.08690.0290.08680.23060.44350.27060.340.07820.03580.04980.0920.05630.02810.02140.04210.0140.02810.04210.02160.0350.01460.04250.36130.182.00E-0400.02770.26840.12360.0480.06160.50120.39730.31460.29820.22580.08550.03980.06620.06610.03960.11870.18410.340.2010.18190.088500000000000000
5
4Raze the Roof II20% Non Watson-Crick Base Pairs - Effortless4307452
GGAAAACUCACUGUCUCGGUCAUCCUCUGAGAAAUGAGCGGACGACCCAGACUGUGAGAAACACGGAACCUUCGGGUUCCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.753
medium
900.0360.3920.2140.56620.56820.94720.45770.53740.27640.03560.026700.01780000.03560.05340.02670.02670.04440.026600.0320.21210.14110.07040.07040.03520.07020.0841.24960.77550.93020.86860.77450.82580.5010.62620.17090.31460.17990.210.13260.03070.11690.01530.1070.01530.01530.07630.03050.03050.045700.07610.09120.03980.03030.1060.07560.63140.6880.76710.34870.23160.07370.09440.11510.01440.08740.22890.22810.22110.23350.46980.244300000000000000
6
5Raze the Roof III20% Non Watson-Crick Base Pairs - Effortless4307459
GGUAAAGGCUCUGUCGUGUUCGAGCCUACCCAAGGGUCGGCACGAAGACGUCAGAUCCAAACACGGAUCCUUCGGGAUCCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.405
medium
85.70.0220.2460.1340.48310.31940.53740.55570.66990.21110.091100.03410.01140.02270.04540.11340.07920.00550.00560.07880.66980.11140.1778-0.0340.01110.29850.1324000.02210.28540.08770.17490.06290.62620.56480.2768-0.03390.148700.0212-0.012700.00850.0720.0212-0.0930.0211-0.01270.30260.0630.14180.06270-0.05930.04980.06250.05750.18670.02070.08280.350.49020.41910.3220.26690.06650.04640.05980.03990.03980.02620.22420.26830.23570.16240.195200000000000000
7
6Pistol20% Non Watson-Crick Base Pairs - Effortless4310332
GGAAAAUAUAUAUAUAUAUAUAUAUAUAUAGAAAUAUAUAUAUAUAUAUAUAUAUAUAGAAAGAUAUAUCUUCGGAUAUAUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.254weak78.600.4270.2131.09021.9796-1.45260.78900.13120.130900000000000000.26080000000000.51720.512900.2554000000-0.57810.25430.2533-0.572700.2523000000000.2512000.25021.22622.5850.81111.12780.44790.44460.22150.22070.65520.43371.06560.42330.83520.41482.21111.732900000000000000
8
7On target20% Non Watson-Crick Base Pairs - Effortless4314570
GGAAAACGCGGCUGCUUCUUCGACUCAGUCAAAAGACUGAGUUGAGGAGGUAGUUGUGAAUAAAUAUCUCUUCGGAGAUAUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.746
medium
94.30.0160.3310.1730.73150.77610.61420.45660.30750.07240.15260.0642-0.00680.0160.0321000.01600.00920.0160.0046-0.0182000.016000.032000.0160.04790.34321.29741.58960.79941.03580.1530.014600-0.0081000.01460.014600.014600.01460.01460.02920.08760.0647-0.01640.02910.04370.14520.07250.07030.50270.59451.0470.7831.08820.73910.38680.20480.07880.04310.05240.07860.00360.42890.09080.27130.183500000000000000
9
8The H design20% Non Watson-Crick Base Pairs - Effortless4321591
GGAUAACGCGUGUAAUUAUAUAUAUAUGCGAAAACGCAUAUAUAUAUAAUUAUGCGUGAAUAACGUGGCCUUCGGGCCGCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.245
medium
97.10.0260.2840.1550.21850.43340.75630.80480.53190.34460.120.016-0.00920.11170.0160.04780.0319-0.00930.06370.047700.0318-0.025200.06350.01590.031700.0159-0.02520-0.02520.01590.44090.93820.81860.59590.64460.13460.0048-0.010200.004800.00480.01490.02980.02980.02980.05960.02980.01490.02970.07430.00460.01940.04450.02220.0268-0.02510.04890.32790.65861.05790.66140.70270.32580.05540.11750.11990.07150.04130.09620.08480.18010.19080.41490.182100000000000000
10
9The H design20% Non Watson-Crick Base Pairs - Effortless4321593
GGAUAACGCGUGUAAUUAUAUAUAUAUGCGAAAACGCAUAUAUAUAUAAUUAUGCGUGAAUAACGUGGAAUUCGUUCCGCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.583
medium
94.30.0290.3230.1760.51170.49160.77640.65480.55280.2720.09590.02470.00260.06430.08010.0370.02970.03690.01120.01840.01120.00610.02090.01840.00250.02450.00250.01230.01470.01230.01840.00610.00860.41460.86260.74430.54530.58960.14180.01920.0076-0.0040.00760-0.010.00580.02490.01910.0076-0.01370.02090.02310.04210.02880.0460.03630.05170.03450.0230.04020.06880.42270.82650.94980.80880.77240.43890.07810.1020.04180.09090.19260.17530.23390.6330.26880.61960.493900000000000000
11
10The H design20% Non Watson-Crick Base Pairs - Effortless4321595
GGAUAACGCGUGUAAUUAUAUAUAUAUGCGAAAACGCAUAUAUAUAUAAUUAUGCGUGAAUAAAUAUAAAUUCGUUUAUAUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.272
medium
88.60.0430.4710.2570.52690.78831.03820.69920.54910.14280.17090.02850.02850.0710.02840.07090.0284000-0.0376-0.037600-0.0751000-0.0375000.028300.47731.21120.62670.68960.71860.15930.0530.02650.02650.02650-0.03740.05290.0529-0.0110.05280-0.011-0.0110.052700.05270.05260.05260.15740.08240.10450.05220.60250.97221.14540.93161.32930.7440.46550.35930.70010.2240.3360.4970.54850.81320.30760.7811.300200000000000000
12
1124BPH - 120% Non Watson-Crick Base Pairs - Effortless4323309
GGUAACGUAGGUAUAUUUAUGGAUAUUUACGAAAGUAGGUAUUUAUAGGUAUAUUUACAAAACGAAUUACUUCGGUAAUUCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.226
medium
91.40.0260.2820.1540.72880.78360.3340.68360.40620.65860.16420.1009-0.00420.05040.075500.0251-0.109100.07530.0251-0.05450.0752-0.00430.075100.0250-0.004400.0250.0250.0499-0.05430.07480.44010.29520.46390-0.0649-0.14280.14570.04850.048500.1210.1449-0.00570.0723-0.01140.07210.11990.11970.02390.11940.047700.07150.0590.14230.23630.02130.95391.04970.50140.10390.53820.14630.16770.29820.1860.13250.16450.10850.53790.32110.48780.326400000000000000
13
12Fluffy 24 Base Pair Helix20% Non Watson-Crick Base Pairs - Effortless4323336
GGAAAAGAGGGAUAUUACCCAUUAUACCAAGGAAUUGGUAUAAUGGGUAAUAUCCCUUGGAAAUCGCUAUUUCGAUAGCGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.703weak84.300.7270.3630.1880.15770.89540.38140.87720.2496000.248600.247600000000000000000000.24661.67950.71150.470700.23450.23360000.463700.231-0.2288-0.22640.66214.65990.368700.766400.19100.37970-0.21260.37740.56090.92092.30511.34381.18671.65010.23230.75460.31980.1595-0.2090.47480.41832.83961.17291.00961.882600000000000000
14
13Fluffy 24 Base Pair Helix 220% Non Watson-Crick Base Pairs - Effortless4323340
GGAAAAGACGGAUAUUACCCAUUGUACCAAGGAAUUGGUAUAAUGGGUAAUAUCCGUUGGAAAUCGCUAUUUCGGUAGCGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.806
medium
91.40.0680.7470.4070.98530.96640.98650.57870.59360.69890.4020.10940.03650.03640.01820.01820.03640-0.03880.03640.0364000.03630-0.00250.03630.07250000.03620.18060.18010.3581.73980.41470.71740.17030.16990.06790.05790.05770.10120.06740.03370.04790.29910.69925.33313.21630.29920.10860.10840.15220.0540.1347-0.01010.10750.08050.16070.20310.48421.63231.22140.99050.890.55590.1560.09620.04660.17960.49730.6111.75810.66310.3240.883300000000000000
15
14Fluffy 24 Base Pair Helix 320% Non Watson-Crick Base Pairs - Effortless4323342
GGGAAAGACGGAUAUUACGCAUUGUACGUAGAAAUACGUAUAAUGCGUAAUAUCCGUUGGAAGUCGCUAUUUCGGUAGUGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.196
medium
900.0480.5290.2890.2140.38780.79510.84830.61560.5350.23690.05920.06890.09830.01530.09810.0392-0.004400.019600.019600.0587-0.0240.01520.039100.0195000.03910.0390.11690.15550.40540.09640.51610.10960.05720.05220.14690.05690.03790.03790.03790.03781.34480.60442.71170.20840.02830.04550.08660.12090.08630.10330.03440.06220.18850.17090.24160.60761.44791.00981.21071.01730.53940.2150.12260.0070.1960.37150.661.25440.4140.35330.871500000000000000
16
15JR_24BasePair20%_Sub120% Non Watson-Crick Base Pairs - Effortless4324692
GGAAAAGUUGUUUGUUUGUUUGUUUGUUUGGAAACAAAGAAAGAAAGAAAGAAAGAACAAGAACAGUAACUUCGGUUACUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.394
medium
700.0860.9510.5190.41291.30751.14340.91230.94510.70080.1310.11610.3465-0.10150.23010.68270.23810.22550.57730.02050.3400.21950.12710.86110.53360.212700.31740.73180.62330.51230.60880.40320.49990.19930.78710.39110.67690.0929-0.09970.19221.77350.45551.00110.63050.76520.51470.2380.06351.25820.73820.28730.47711.50170.5360.91490.59592.12910.22180.94630.66870.73150.48741.31431.20780.43670.2650.16520.16470.131500.3920.38950.57880.63650.31660.840100000000000000
17
16JR_24BasePair20%_Sub220% Non Watson-Crick Base Pairs - Effortless4324737
GGAAAAGUUAUUUAUUUAUUUAUUUAUUUGGAAACAAACAAACAAACAAACAAACAACAAUAACAGUUACUUCGGUAACUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.978
medium
72.90.0860.9480.5170.43951.1451.08560.83370.58481.3390.88540.38790.45720.79910.7850.47671.03880.76540.42420.22260.50721.30581.04771.01650.64561.15380.98381.26080.76641.34130.8010.92760.30850.51070.76380.90030.60330.30350.24050.15320.27730.1520.13560.26810.18950.04460.16080.18240.21480.0990.14240.1420.10320.11440.0480.18920.18260.27410.26270.75050.65210.58730.60461.06251.03981.04270.75630.0480.1280.1060.11340.16960.11280.18910.77940.24740.43850.462400000000000000
18
17design120% Non Watson-Crick Base Pairs - Effortless4327278
GGAAAAGUUUGUUUGUUCGCUCGGCCCGUCAAAAGGCGGGUUGGGUGGGCGGGCGGGCAAAACCCGGGCCUUCGGGUUUGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.866weak800.060.6570.3580.57680.73780.48751.00530.23210.46570.14050.25110.24870.54960.27360.54230.270.268800-0.16670000000.400600000.26590.52730.90922.25280.74190.85360.242900.12120.36160.24010.11980.23870.3560.3540.58440.69340.68570.3410.11340.1132000.22560.2248000.66720.3848-0.11110.32770.21770.75270.5330.2125000.30940.66751.66961.31740.87630.57870.76210.84570.742700000000000000
19
18CGE 120% Non Watson-Crick Base Pairs - Effortless4329726
GGAAAUCCAAUCACCACUGACAUGUGACAGGAUACUGACACUUGUGAGUUGUGGAUGGUAAAACCACUCGUUCGCGAGUGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.855
medium
87.10.0440.4890.2670.42720.68050.41850.75991.36670.5340.05360.02010.19891.04410.13110.01910.0915-0.01660.11370.02610.0130.07160.52260.06440.1310.0706-0.0020.010800.02570.4710.01270.02540.20290.62761.8330.62971.17590.11210.02650.07940.36270.08180.0584-0.00620.08160.05820.0550.03170.33190.20730.01980.18030.19450.11420.12530.11370.34710.35970.07860.14560.26770.50270.77160.67120.58720.39470.08470.06350.02110.03170.02750.03170.41940.64840.45950.64210.409700000000000000
20
19Hopping20% Non Watson-Crick Base Pairs - Effortless4338158
GGAAAACCAGUCUAUUUCUAAAGAAACUUCGAAAGAACUUUGUCUACAAAUCGAAUGGAAGAACAAGGCAUUCGUGUUUUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
5.674good65.70.0830.9110.4970.36250.65910.71760.81410.72280.68410.21340.29850.62640.6150.29340.40270.49290.51810.34930.2730.1470.11870.4390.61580.77990.3580.47990.33630.32090.14820.05810.67550.53260.14820.16810.34850.38320.40341.28941.39010.66420.2050.2860.28450.20170.29260.10120.11160.33890.55240.30620.58710.70671.35820.9320.47730.96950.62121.41070.26620.32180.82481.42510.59760.8841.68610.96610.31750.31750.21390.55180.36780.16120.32710.1570.06080.10790.188300000000000000
21
20Hopping II20% Non Watson-Crick Base Pairs - Effortless4338166
GGAAAACCUUAAUAAUACGUUCCAGUUCACGAAAGAGUAGUCGACCGAAUCAUUAAGGAAGAACAGGGCUUUCGAGUUUUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.376
medium
58.60.0961.0530.5740.04130.43160.33650.660.54710.38570.07090.32180.38920.80870.70991.01250.80550.97931.18411.04990.58150.49490.41210.30870.33010.16530.28870.93361.16430.78331.32790.42520.67670.1940.5220.4350.78440.60730.49320.88750.95421.1761.08810.65290.59110.04470.29570.31450.08970.08960.2620.89361.43860.78010.65581.69711.04220.91340.95030.4320.17590.16250.42290.30010.40250.63370.47630.42190.15290.55040.48670.38930.16470.11740.26890.140.12220.367400000000000000
22
21Hopping III20% Non Watson-Crick Base Pairs - Effortless4338177
GGAAAACAGUUUGAAACCUCCUAACAGUUGGAAACAAGUGUUUGUAGCUUUGAAAAUGAAAAAAAUGUUAUUCGUGAUAUUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.901
medium
64.30.0991.0890.5940.76110.91490.89250.82640.26020.36830.20520.63240.72420.8080.82520.31280.87890.65570.99370.22030.02630.15750.28730.15630.11310.61750.56470.71240.36080.42540.44350.10790.15020.07960.53610.62380.63360.71540.35540.78340.57210.58840.35940.3230.71710.63290.60270.57530.54850.56270.31070.36960.16270.64360.42090.70810.56750.64030.54750.63470.40490.83440.45730.70131.01341.09530.94610.91661.13961.17081.37511.08321.00461.61780.82210.49860.35830.900900000000000000
23
22Simple 20% G-U Design20% Non Watson-Crick Base Pairs - Effortless4341910
GGAAAAGAGUAGGAUUGUUAUGGGUUAGACACCAGUUUAGCCUAUGAUAAUCCUACUCAGAGAGAUAUAUUUCGAUAUAUCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.245
medium
94.30.0310.3670.1990.56490.90530.95520.76060.62160.72550.04470.03840.03070.0140.01530.0230.0153-0.02430.01840.00310.03060.03060.0031-0.00230.0123-7.00E-040.01840.00760.0534-0.0212-0.0120.03510.01070.31921.56540.30570.23521.08820.10220.0044-0.00370.0820.04140.01850.02130.02340.04250.02340.02550.03530.07760.04440.04230.02820.0352-0.0120.01470.02116.00E-040.02810.02810.12720.28680.9580.70431.10220.79380.07420.22030.09640.16180.09760.25580.38891.24050.38650.23060.979200000000000000
24
2324BsPr-20%nonWC--I20% Non Watson-Crick Base Pairs - Effortless4344969
GGAAAACCUAAAUUUAACAUUAAAUUUAACAAAAGUUAGGUUUAAUGUUAGGUUUAGGAAAAAGGCGCAGUUCGCUGCGCCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.78weak87.10.0130.4430.228-0.03051.28660.896500.31850.44270.1262000.126000.12570000-0.142500.1255000000.12520000.49680.85741.2010.45251.734200.08850000.229500.11450.11430.114100.11390000000.3398-0.02850000.19620.77731.19780.64650.63980.52860.10550.41930.51970.4130.41030.30620.80591.18560.97710.62451.033900000000000000
25
2424BsPr-20%nonWC--II20% Non Watson-Crick Base Pairs - Effortless4345024
GGAAAACCGCAAUUUAACGUUAAAUUUACCGAAAGGUAGGUUUAACGUUAGGUUGUGGAAUAACGCGCAGUUCGCUGCGCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.457
medium
88.60.0180.1990.1090.15340.72980.79180.23670.3690.30670.02000.02-0.01360-0.00360.03000.02-0.033600.0200.0200.02-0.03350-0.0136000.01990.03990.2580.11890.0594-0.013700.05930.01980.01980.039500.039500000.01970.07880-0.03350.07870.07860-0.01380.0196-0.0080.01960.11740.36960.78250.58850.60570.09380.22440.13060.20460.00380.11130.16650.35870.71820.37950.39740.56900000000000000
26
2524BsPr-20%nonWC--III20% Non Watson-Crick Base Pairs - Effortless4345034
GGAAAACGGCAACGCAACGUUUAAUUUCCCGAAAGGUAGGUUUAACGUUGGGUUGGCGAAUAACGCCCAGUUCGCUGGGCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.431
medium
82.90.0360.3950.2150.39060.5790.75080.65670.37670.13020.05420.3770.34280-0.02360.03210.21340.63360.03170.0211-0.00250-0.00250.02110.10520.29320.12540.08350.12220.29020.26830.061800.08240.15810.42460.30410.14160.1010.18120.24070.0930.27890.09940.07940.07930.15830.0160.019800.01980.03950.0160.11430.77770.09710.01940.03880.03880.4999-0.00430.20630.64421.24630.65140.88950.21620.42940.10720.07140.05350.07120.12440.25070.7710.37560.60130.662800000000000000
27
26Viers 24 Base Pair Helix20% Non Watson-Crick Base Pairs - Effortless4347448
GGAAAACGGUGGGUGGGUGGGUGGGUGGGCAAAAGUUUAUUUAUUUAUUUAUUUAUUGAAGAACGGAUUAUUCGUGGUUUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.839weak62.90.2722.9891.63-0.4048001.81930001.7673000001.7182003.25540001.585900-0.40221.5463005.008713.78523.29810.81373.48610.75412.54683.39761.32980.65780.65095.023500.2631.39351.88591.08481.06611.0482.67122.85391.84583.48352.50673.95861.88512.03973.10023.69642.73320.30312.30141.65781.90671.07070.26650.22040.78271.27752.68830.96232.31572.01621.74171.6941.24493.521900000000000000
28
27The hoglahoo 2020% Non Watson-Crick Base Pairs - Effortless4349423
GGAAAAGCGUGUGAGUGCUACGCCUGCAGCAAAAGCUGUAGGUGUAGCGCUCGCAUGCAAGAAGAGUGCCUUCGGGCACUCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.572
medium
91.40.030.3730.2010.59360.86990.8680.60790.67350.46480.03930.01960.03920.019600.0588000.01960-0.02650.019600000.01960.03910.03910.01950.0195-0.02650.01260.30120.96781.12180.91651.49340.0360.01800.03590.09910.0358-0.05270.03580.03580.053700-0.034800.017900000.035700.03660.03570.09470.54140.97710.90680.84581.02510.51260.07170.33050.00630.2320.40640.30850.22220.27410.51690.368100000000000000
29
28Venti20% Non Watson-Crick Base Pairs - Effortless4349435
GGAAAAGCGUGUGAGUGCUACGCCUGCACGAAAACGUGUAGGUGUAGCGCUCGCAUGCAAGAAGAGUGUCUUCGGACACUCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.519
medium
91.40.0190.2960.1570.60480.77880.7650.6890.55050.67510.05580.01860.0279-0.02730.01860.046400.01860.00930.01850.01390.0139-0.002-0.00680.00930.00930.00930.01850.00930.0049-0.00440.0093-0.00440.2350.90340.73940.42630.88960.157400-0.0010.02130.04370.0175-0.00980.02130.03490.01740.03480.0125-0.0185-0.00490.00870.00870.00380.02610-0.05160.02610.09540.00470.68580.64170.84510.8780.87430.19310.01850.14540.20690.0670.17470.20180.54390.33530.33780.246900000000000000
30
29Going there20% Non Watson-Crick Base Pairs - Effortless4349437
GGAAAAGCGUGUGAGUACUACGUCUGCAGCAAAAGCUGUAGAUGUAGUGCUCGCAUGCAAGAAGAGUCUCUUCGGAGACUCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.867
medium
98.60.020.3840.2020.67411.34890.99940.650.3190.87830.04080.02040.02040.020400.02040.02040.0611-0.02290.02040.02030.0407-0.0229000.02030.0203000-0.002600.02030.32321.14971.67361.33991.4430.09180.01830.01830.01830.03660.0366-0.02280.05040.01830.03660.0912000.03650.03650.01820.01820.018200.0182-0.00460.01360.05450.04060.68830.71011.24761.14080.90590.18780.01530.19880.04970.1980.05160.10690.66080.2850.34760.313500000000000000
31
3024 Base Pair Helix20% Non Watson-Crick Base Pairs - Effortless4355558
GGAAAACAGACAGACUAGACCUCUAGCUACGAAAGUAGCUAGAGGUCUAGUCUGUCUGGAAACGCGCUACUUCGGUAGCGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.321weak7000.8440.422-0.75230.76180.7525000.74350.7346000.726000000000.717600000000001.402601.37150.67820.670900.663600-0.095900003.11750.9280.59360.5879000.5824000.5769000.571600.56640.56121.10250.546400.54161.58310.5232000.51882.48982.853.68511.71551.26042.845600000000000000
32
31AD caput II20% Non Watson-Crick Base Pairs - Effortless4356121
GGAAAACUUUUCUAUGUAUAUCAAUGUUCCGAAAGGAACAUUGAUAUACAUAGAAAAGAAUAGGUGUGUCUUCGGACACACAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.359weak81.400.5680.284-0.46470.14821.18950.2961.16160.85910000000000000000000.2850000000.28370.83960000.554700.276100.274900.27370.2725000.540200.00770.2666000.265500.2643000.26320.5222.26281.77641.53441.15820.91290.89960.44661.52441.070.42511.24941.8190.9943-0.85410.579800000000000000
33
32just a try20% Non Watson-Crick Base Pairs - Effortless4366080
GGAAAAGAAAAUAAAAUAAAAUAAAAUAAUGAAAAUUAUUUUAUUUUAUUUUAUUUUCGAAAACUUAUUGUUCGCAAUAAGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.43
medium
91.40.0730.8070.440.87210.92561.08170.77681.050.47360.28290.0941000.2812000.1869000.12370.123200.092700-0.12490.18490000.36760.18330.51020.53942.25232.57371.07860.57390.6363.23933.57010.08820.140600.21010000.0700.016700.13930.06960.06950.34550.13790.27460.20520.06830.17041.08021.2121.4710.94470.8080.12410.18550.12340.52020.274200.36341.65070.40370.39260.846400000000000000
34
33AM120% Non Watson-Crick Base Pairs - Effortless4374268
GGAAAAGUUUUAUAUUUAAUAAAAUAAAUAGAAAUAUUUAUUUUAUUAAAUAUAAAACAAGAACAUAAAUUUCGAUUUAUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.651weak88.600.4380.2190.90831.48320.77090.61060.15230.75210000000.15010.14970000.1493000.1490.1486000000-0.192200.14831.02070.43440.85670.28430-0.1916000.14180.1415000000000.14120.14080.14050.14020.13990.139600.13920.08620.95531.14491.05620.7111.19410.49860.6170.48970.24390.36370.48110.59561.20960.91760.38131.793700000000000000
35
34JR_20%NWCBP_Sub420% Non Watson-Crick Base Pairs - Effortless4381172
GGAAAACGCCUUGGGACAUGAGUAAGAAGGGAAACCGGUCCAUUUAUGUUAAGGAACGAAAUACUCGUACUUCGGUGCGAGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
6.131good700.0850.940.5130.44960.66740.79830.80320.70980.34460.19780.57570.1130.10040.53840.35490.48650.43640.48740.37430.24740.84590.34920.69991.09470.92660.96761.03490.76351.06441.20550.39570.18690.35930.6470.85190.69680.49690.09370.00690.37930.6480.32830.2380.24371.47361.2821.22761.10821.38940.68030.38870.59281.36220.63650.19690.10480.19040.23320.15270.03690.03790.76970.65730.57320.45540.46480.07370.03310.03680.01690.05360.05020.13270.68740.33680.39570.554100000000000000
36
35Some effortness20% Non Watson-Crick Base Pairs - Effortless4385479
GGAAAAGAUAUGUAUAUGUAUAUGUAUAUGGAAACAUGUAUAUGUACAUGUAUAUGUCAAGAAGCAUGGCUUCGGCCAUGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.474
medium
95.70.0320.3470.1891.55131.33471.1540.70370.55510.56780.11270.11250.03750-0.05340000000-0.015900.02160-0.01580.074700.03730.05860.0372-0.1220.05840.16920.69550.18250.3989-0.049900.0362-0.016600.10830.03610.07210.0360.0360.0360.03590.03590.035900.035900.03590.14310.03580.14270.05350.08900.6510.8831.05590.73760.93630.45940.03280.16360.35770.04490.06490.57840.66750.3580.85881.278500000000000000
37
36Meechl 20pct20% Non Watson-Crick Base Pairs - Effortless4392094
GGAAAAGUCUUAUCAGUCGUUCUCAACCAGGAGACAGGUUGUGAACCACAGAUAAGUCAAUAAGUCAUACUUCGGUAUGACAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
5.205good88.60.0480.5270.2880.50180.82940.78420.61480.62360.80770.28170.19670.0183-0.02120.00940.00840.01870.00940.3170.19510.10550.21720.05080.0323-0.00990.02770.01840.00920.03690.01840.03680.04530.34760.71241.94510.95171.20950.86610.48650.440.0490.00650.03270.00650.06360.03260.04070.07320.0650.01450.13380.24820.13320.52650.08170.06360.04770.05160.04970.17010.39880.51610.73621.37550.80281.15211.08550.14880.12090.04440.07450.04430.05130.14830.61320.23330.2550.400500000000000000
38
37Peterson - 20% non W/C20% Non Watson-Crick Base Pairs - Effortless4393670
GGAAAGAUUUCUUUCUUUCUUUCUUUCUUCAAAAGGAGAGAGAGAGAGAGAGAGAGAUAAAAGAGAGGAGUUCGCUUCUUUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.499
medium
85.70.0520.570.3110.7271.43591.11970.4990.45990.90630.34660.13830.06910.03450.034500000.0689000-0.0660.06890.06880-0.06590000.06870.20541.20860.33391.68340.76560.50740.12660.12630.0631000.063-0.1312000.0630.1257-0.0027-0.0027-0.002700.06260.12490.06240.12450.06220.06210.18590.73470.42561.36760.62581.98740.94041.09740.65150.9620.38760.3160.14510.46890.61890.51150.3561.01850.933900000000000000
39
38Effortless is a Relative Term20% Non Watson-Crick Base Pairs - Effortless4393833
GGAAGAAGGGUUUUAGGGAUUUUGGGAUUUGUGUGGGUUUUAGGGUUUUUGGGAUUUUGUGACUCUCUCGUUCGCGAGAGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
7.469good67.10.0810.8890.4850.3840.45970.52460.39120.30450.31590.18550.16120.16360.21890.44470.37470.5690.63640.22280.20050.11570.37350.90490.6230.69130.78150.23040.18420.14740.32640.86930.72690.91540.5860.74450.55140.7690.2160.20820.25720.82460.46510.45720.89121.06590.57090.29610.40260.65020.36510.55340.4880.6840.31030.31740.39150.86751.53870.92560.84460.81430.43390.53060.33510.58310.5010.23670.38020.02620.05390.04330.10080.09690.34060.8730.34180.84350.476800000000000000
40
39GeoPointer 120% Non Watson-Crick Base Pairs - Effortless4397540
GGAAAAGUAUUAUUAUUUUAUGGGAUUUAGGAAACUGGGUUUUAUGGGAUGGUGGUGCGAAAGCGGCGUAUUCGUACGUUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.906
medium
67.10.1041.140.6220.64380.80190.82850.65750.52641.20710.38270.24170.83520.91310.97191.11420.87310.89510.84870.76360.92390.91230.7091.3110.46950.30450.34790.37170.96380.28861.0491.030.37340.41860.84050.97460.65480.60950.30310.22530.29170.6110.63020.58830.79761.4531.03191.40140.43970.33320.40710.460.94590.25420.44610.87890.37730.45650.40350.55230.26280.32740.49580.73410.62440.66520.36170.23750.38020.18040.15750.3710.3730.69120.63860.38830.5240.697900000000000000
41
4020% Heavy - Jieux - 20% Non Watson-Crick Base Pairs - Effortless20% Non Watson-Crick Base Pairs - Effortless4397629
GGAAAAGCACACAGUCAGGCAGCCUGCGAGGAAACUCACAGCCUGGCUGUCUGAGUGCAAUAAGGACGUCUUCGGACGUCCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.077
medium
84.30.0360.3970.2170.40811.09540.86290.50610.50880.47080.103300.02580.04360.35870.20430.27520.31150.1889000.04810.34790.0250.07490.07010.12440.02490.09940.17340.17290.02470.02470.09860.01960.60950.2670.35630.08520.0481-0.01110.15640.21480.20820.02380.09490.11840.09460.03540.50390.046800.04070.18030.08680.15610.31160.57170.05710.13680.3106-0.02030.35731.10770.6830.88650.54530.28830.0179-0.03730.08440.12630.14710.38620.84550.26640.51210.38300000000000000
42
4120% Medium - Jieux - 20% Non Watson-Crick Base Pairs - Effortless20% Non Watson-Crick Base Pairs - Effortless4397702
GGAAAAGCUAACUAUCAUGCAUCCUACGAGGAAACUCAUAGCAUGGAUGUUAGAUAGCAAUAAGGAGCUCUUCGGAGCUCCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.544
medium
82.90.0390.4280.2340.66660.72660.63720.84940.67870.40690.1636-0.04420.12250.36520.27870.04030.04030.10060.16060.0160.075900.3186-0.0441-0.00430.31680.03960.0790.35360.11770.1174-0.0441-0.00490.03910.11710.69450.34530.38130.10820.0760.03190.56390.55880.40710.06690.07380.1840.09180.01840.690.144900.02850.07230.13630.14380.07180.1791-0.09550.22480.17740.15180.39481.09250.85550.77050.34560.39660.62170.03270.0490.09250.13530.40350.59560.25870.41430.321100000000000000
43
4220% Lite - Jieux - 20% Non Watson-Crick Base Pairs - Effortless20% Non Watson-Crick Base Pairs - Effortless4397767
GGAAAAGCUGACUGUCAUGCAUCCUGCGAGGAAACUCAUAGCGUGGGUGUUAGAUAGCAAUAAGGACCUCUUCGGAGGUCCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.115
medium
82.90.0620.6820.3720.73910.95840.92990.98950.68930.87170.69510.52950.13230.3811.12620.02810.09190.16810.11190.0140.56790.63730.252400.1090.10880.02720.05430.081400.02710.08120.05410.1080.28220.63110.57960.49650.20840.15590.30561.97441.72491.35450.14220.09790.58880.09360.02340.02640.0730.04960.04660.12190.94870.81310.11240.19660.06210.0750.20.2470.51841.63271.06891.03050.6120.12220.16240.08110.04060.06070.08080.15120.92330.33460.40960.213300000000000000
44
43BTest 20%20% Non Watson-Crick Base Pairs - Effortless4397858
GGAAAACGGCGGGCGGGCGGGCGGGCGGGCGAAAGUUUGUUUGUUUGUUUGUUUGUUGAAUAAAUAUAUGUUCGCAUAUAUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.083weak58.600.8540.427-2.39350.57491.677800.5543000.5493000000.54450.5397000.5351000-2.306801.04311.5261.0008001.91670.45950.45611.77220.43991.2921000.8496000.83811.63190001.20010.397501.550.38510.38270.38040.75151.1071.4416-4.6295-3.2147-0.5222.2953-3.82451.27779.00E-041.36021.47520.87260.57630.8526-0.82850.55310.54820.54341.69790.2549-0.0954-0.090100000000000000
45
4420% milk20% Non Watson-Crick Base Pairs - Effortless4409017
GGAAAAGAUAUUGAAGUUGUUGAUUGAUUGAAAACGGUCGGUCGGCGGCUUCGAUGUCAUUUGCAUGCUCUUCGGAGUAUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.703
medium
97.10.030.3260.1780.62590.79280.67030.54350.43330.35430.05370.12090.05350.08770.0670.07240.06010.01350.1090.01640.02180.03270.01210.08280.01880.00250.04880.04460.05120.02830.10920.13170.44280.74971.00190.75480.44780.53020.16740.16170.07510.04040.0350.05990.12460.0427-0.0010.09970.08440.01527.00E-040.02480.02480.06960.10870.01980.05920.14050.05650.12270.13220.10040.91710.53880.71510.46840.67090.05470.05070.02730.09620.06360.01340.08250.33730.1750.29630.202900000000000000
46
4520% non-WC20% Non Watson-Crick Base Pairs - Effortless4409700
GGAAAAUAUAUAUAUAUAUGUAUAUAUAUAGAAAUGUAUGUAUAUAUAUGUGUAUAUAAGAAAGUAUGUGUUCGCAUAUGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.534
medium
85.70.0460.5060.2760.91950.99251.26030.8210.093300.13960.0465-0.019700.04640.04640.09260.046300.13850.046100.04610000.04610-0.020.09190.09180.18310.14150.40740.62720.79610.63470.79930.64140.06210.12770.1699-0.0699-0.15400.0423000.08450.0422-0.08840.04220.16820.01880.0420.1023-0.02330.18490.16620.10080.10040.39940.97631.40011.81720.86270.80150.61940.15390.97130.27340.52250.3840.86060.75170.77420.27260.822700000000000000
47
46WC neighbors20% Non Watson-Crick Base Pairs - Effortless4420790
GGAAAACGCGGCUGCCCACUCGAGGGAGUCAAAAGACUCACUUGAGGUGGUAGUUGUGAAUAAAUAUGUCUUCGGACAUAUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.466
medium
91.40.0350.3810.2080.380.54610.72080.50660.42080.18650.10860.05810.02720.04640.06180.04630.00770.07710.02310.03080.10.4353-0.00390.007600.03050.01530.01530.05330.02290.00760.00740.00750.26871.16321.73290.73770.75660.04930.04930.016600.03510.14720.0350.0280.0280.05840.04190.09770.2940.269600.02310.05520.10560.07110.07220.04790.11520.10340.24570.67411.0850.94051.25380.6660.23090.09760.06110.06830.08670.04950.0690.39470.14260.14390.146900000000000000
48
47Default title20% Non Watson-Crick Base Pairs - Effortless4428087
GGAAAAGUGUAUAUGUAUAUGUAUAUGUACGAAAGUAUAUGUAUAUGUAUAUGUAUACGAAAGCAUAUAGUUCGCUGUGUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
5.6good87.10.0420.4630.2530.33490.98741.02460.90450.66921.04050.45170.260.0289-0.00960.02240.05120.0160.04160.02560.02560.03510.0159-0.00320.00630.02550.0223-0.0096-0.01620.02220.02550.03180.02220.01270.05080.19640.5960.35550.52260.12310.14080.15620.08240.60280.18340.18090.06760.03860.04810.15170.01030.0920.03820.0358-0.00480.15710.0960.06390.07110.10870.05630.02360.02080.69791.1160.79980.93180.59960.26630.94030.16710.98330.73030.97540.60050.56870.3570.41950.40700000000000000
49
4820%nwcbpe20% Non Watson-Crick Base Pairs - Effortless4441324
GGAGAACGGCAUCUAUCUUCAUGUCACAGCGAAAGCUGUGGCAUGGAGGUGGAUGUCGAAAGACCCGCUGUUCGCGGUGGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
14.107strong95.70.0130.2070.110.3810.50890.37150.57650.45110.18720.0250.01380.00260.00440.00320.0040.0040.01230.01210.01580.01310.00830.00750.00380.00250.00340.0010.01340.01250.00457.00E-040.00530.00420.01880.06420.35230.16790.21190.01560.00740.003-0.00130.00840.01260.00590.00490.00890.00520.00690.01990.00850.01620.01850.00670.00780.00580.0350.01520.05360.02550.02240.16550.55190.61870.34560.57280.43950.08360.00890.01770.01650.05880.43580.91480.79270.3320.47030.375100000000000000
50
4920%nwcbpe-220% Non Watson-Crick Base Pairs - Effortless4441351
GGAGAACGGCAUCUAUCUUCGUGUCACAGCGAAAGCUGUGGCAUGAAGGUGGAUGUCGAAAGACGCGCUGUUCGCGGUGCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
12.091strong92.90.010.2020.1060.44810.57010.43340.57150.43860.24040.02590.0253-0.0016.00E-040.00310.0022-0.0031-0.00260.00830.0168-1.00E-040.00380.00370.00240.01120.00230.00360.0206-0.00220.00310.00590.00150.00370.00620.05380.35260.17470.17750.02310.00880.00460.00230.00370.00670.0074-0.00330.01130.00760.0030.01680.00440.00950.01770.00350.00830.00990.02850.02030.05220.0260.02370.13480.56080.64790.40270.54980.30660.10610.07370.04170.05720.62690.22610.56250.70140.40270.3740.398500000000000000
51
5020%nwcbpe-320% Non Watson-Crick Base Pairs - Effortless4441363
GGAGAACGGCAUCUAUCUUCGUGUCGCAGCGAAAGCUGUGACAUGAAGGUGGAUGUCGAAAGACGGGCUGUUCGCGGUCCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
11.573strong95.70.0130.1920.1030.44640.54840.39430.53490.44690.21710.02010.00410.00339.00E-040.0050.00780.00220.01460.01730.01730.00530.0053-0.00280.00260.00670.00330.00710.001-1.00E-040.00290.0010.00230.00480.01240.06480.35970.14680.20360.01540.00740.00660.00126.00E-040.00980.0085-0.00370.00230.00890.00740.01510.00930.01360.02360.01130.0060.01780.02530.02990.02710.01470.01330.13040.51670.59410.41350.45910.36180.06060.03370.06740.04310.06470.12740.70550.77880.36090.43950.502400000000000000
52
51Smylla 0220% Non Watson-Crick Base Pairs - Effortless4447784
GGAGAAGCUGCUGAUUAUACUACGUAUGCAGAAAUGUAUAUGUAGUGUAGUCAGUAGCAGAAAAGGUAUCUUCGGAUGCUUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
5.209good92.90.0160.1830.10.49490.51710.41110.47720.45530.43540.05110.0040.0083-0.00160.0055-0.00440.00830.01230.0222-0.01620.00830.01460.00690.00670.001700.0024-0.00320.00280.00830.00950.02760.00950.06190.0990.30290.15150.24510.05120.01420.03040.0120.02710.01140.0320.01080.013-0.00380.01140.01730.01350.01670.02160.01670.00650.01190.02270.04860.04690.02850.0220.01990.32010.98070.48610.52110.56360.23380.1990.13920.11350.13160.08310.07440.2760.14710.16940.113800000000000000
53
52Winterwater196 120% Non Watson-Crick Base Pairs - Effortless4450255
GGACAAUUUUUUAUUUUGGGAUUUUAGGUUCACAGAUUUAGGGUUUUAGGGUGAGGGAACACAUUAGCGUUUCGGCGUUGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
6.737good54.30.1231.3580.7410.38820.66090.63130.24560.78821.05160.81710.92890.87560.83371.1331.05041.17480.76870.61991.16740.20550.32180.34820.39641.05321.06760.88340.99181.15120.5881.02190.61880.55770.34740.2050.73570.38030.43950.83891.59020.76951.46881.14410.68080.40530.56370.70370.7660.89181.27821.53840.76590.50670.82910.73990.39720.78020.49090.37440.28770.55210.67150.5330.42270.73060.31731.25131.1971.15811.07450.37940.37180.56020.4360.69120.29020.23190.632800000000000000
54
53Default title20% Non Watson-Crick Base Pairs - Effortless4451698
GGAAAAUAAUUAGGAGAGGUUAUUGAUUUGAAAACGGGUUAGUGAUUUUUUUUGGUUAAAUAAGGGUGGAUUCGUUUAUUCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.781
medium
700.1521.6670.9090.94451.21051.01921.15220.48380.55810.28170.60820.52060.8661.40610.59760.41271.02560.41730.82930.31050.680.19680.46190.72820.95830.62640.45571.15131.74170.84061.42010.58941.02621.441.11230.81580.68020.23720.26990.49590.49760.28460.58791.60590.45750.37570.85392.04820.90610.62581.22381.2170.71430.64112.20370.72891.08031.77581.53431.27981.10990.62531.39160.92841.1160.87960.66251.67842.44090.27590.83481.04491.41391.5330.85210.88651.103200000000000000
55
54Default title20% Non Watson-Crick Base Pairs - Effortless4451738
GGAAAAUAAUUAGGAGAGGUUAUUGGUUUGAAAACGGAUUAGUGAUUUUUUUUGGUUAAAUAAGUUAGGCUUCGGUUUGGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
5.072good700.1371.5030.820.62271.2540.81620.74310.47410.68430.67250.67740.5990.80021.27690.65180.3580.77250.33820.37880.32960.74420.18030.22980.45760.30840.80220.18890.43860.78911.05441.21450.53861.35970.90411.08410.53880.70660.21360.45950.75341.00441.041.28541.06890.59590.4390.72592.02560.76310.80331.1661.27040.5860.88931.41520.64671.2411.18861.33181.22841.26220.81961.28931.11421.19991.11370.84121.6330.90560.72970.78920.58980.43210.51270.84950.50071.127800000000000000
56
55I guess this works?20% Non Watson-Crick Base Pairs - Effortless4452857
GGAAGACUAUAUAUAUAUAUAUAUAUAUAGAAAACUAUAUAUAUAUAUAUAUAUAUAGAGAGAGUAUAUAUUCGUAUAUACAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.623weak82.90.0230.6090.3160.08930.53850.53390.35390.69970.17440.17390.34590.3440.171500.1711000000.170600.1701000000000.33840.33651.47820.48880.5807-0.26850.15960.1592-0.108600.31590.3143000000.156700000.156400-0.26620.311100.04450.6130.9061.32980.61011.00311.40060.69240.412701.34571.89161.2151.47731.19470.95591.25471.073100000000000000
57
56sleepless night in italy20% Non Watson-Crick Base Pairs - Effortless4456689
GGAAAACUAUAUAUAUGUAUAUAUGUAUAGGAAACUGUAUAUGUGUAUAUGUAUGUAGAAGAAGAGAUAUUUCGAUAUUUCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.498
medium
88.60.0380.4220.230.96450.80140.90360.61810.60870.33630.0168-0.01620.0671-0.06650.03350.033500.03350000.10030.10020.033400.033400.03330.06660.09980.03320.06640.09910.06610.16490.4570.43840.37120.0645-0.00180.19270.06420.1280.0320.19140.12730.12710.06350.06340.15810.15770.12590.12560.12540.03130.06260.121-0.03490.1245-0.06980.1510.61360.65260.69210.73980.83020.95650.41730.35770.13150.65710.44130.75140.53961.58930.46910.07790.66800000000000000
58
57GU locomotive20% Non Watson-Crick Base Pairs - Effortless4462626
GGAAAAGCUUUUUUUUUUUUUUUUUUUUUGGAAACGGAGGGAGGGAGGGAGGGAGGGUCAAAAGUUUGGGUUCGCUUAGGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0weak61.406.2883.1440000000000-61.785261.785230.902820.6041000-30.9028015.4539012.36360010.303208.8314007.72760006.8696.18220000005.620213.247804.12157.2734-20.6041-15.4539-8.9289-14.4090-7.72765.954-0.6437-3.5326-2.8471.39750.07442.19032.57612.4736.62425.37614.37154.08284.83851.05683.4902-1.22673.65040.4975-2.38770.51473.658300000000000000
59
58Sheared20% Non Watson-Crick Base Pairs - Effortless4464607
GGAAAAGCUAUCGAAGUGUUACGAGUGCUCGAAAGAGUACGAGUGAUACGGAGAUGGCAAAGACCGUCACUUCGGUGACGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.96
medium
92.90.0250.2750.150.16780.86810.82820.57510.61930.944100.01990.12510.03960.013-0.05320.01980.3540.15690.03920.01960.0196-0.0266-0.00700.01960.01960.09770.03910.01950.019500.0390.01950.07080.52120.15410.13450.05760.038400.03830.05750.03090.15270.07630.01910.0191-0.01490.07610.095-0.00750.03790.03040.25660.169400.09390.07510.05620.04840.0110.65130.7150.53550.67950.61910.070600.04420.08810.04410.12290.14010.8890.23220.31650.372300000000000000
60
59Non-canonical cWW20% Non Watson-Crick Base Pairs - Effortless4469948
GGAAAAGUCGACGCUGACCUGUUGUAUGACGAAGGUUAUACUCCAGGUCUUCGUUGACAAAAGCCACGUCUUCGGACGUGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.089
medium
97.10.0190.2140.1170.33390.47270.49590.53810.47460.63820.0405-0.00780.0120.012-0.019800.0240.06410.0120.0180.0060.0120-0.01980.03590.02390.04780.03590.02800.03580.02390.0239-0.01980.2770.58560.17940.88650.14140.0690.00640.0147-0.00830.01150.00320.1260.01150.014600.01140.04890.00310.00310.03430.0456-0.008300.03420.0031-0.00830.02890.08560.79790.59180.3680.54550.26480.07590.07780.01080.02370.02160.02160.0560.47310.25760.18390.214800000000000000
61
60Awesome20% Non Watson-Crick Base Pairs - Effortless4473472
GGAAAAGGGCGGCGGGCGGGCGGGCGGGCGGAAAUGUUUGUUUGUUUGUUUGUUGUUUGAAAAGUUUGUGUUCGCGCGGGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.467
medium
77.10.111.2150.6620.3291.27051.08810.28760.5980.312900.37210.0620.12380.06180.061-0.0630.36770.24410.18260.11810.1210.06040.91930.3809-0.03540.48171.71560.35220.22160.52982.1260.2950.41911.56921.03110.96542.440.49830.2931.05511.25650.58470.21360.9090.6160.40480.2060.85660.70270.32260.31710.52930.63740.70310.05650.21730.19760.56070.81160.42780.43311.58632.15141.32480.86141.48850.73160.86630.83030.981.41090.42171.1840.87890.86720.87860.970100000000000000
62
61Awesome20% Non Watson-Crick Base Pairs - Effortless4473478
GGAAAAGGGCGGCGGGCGGGCGGGCGGGCGGAAAUGUUUGUUUGUUUGUUUGUUGUUUGAAAAGUUGGUGUUCGCGCCGGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.39
medium
77.10.11.1050.6030.2260.64430.74680.5550.55010.1220.12180.1215-0.11850-0.17550.4220.1203-0.11520.358200.11920.35550.35350.64020.17340.1158-0.00161.22770.1040.4450.33191.3965-0.45780.21071.01450.50131.10451.45390.09770.38841.14361.01110.73960.45880.54570.63020.33540.17821.05120.40990.57610.25660.31390.31121.07770.16540.13660.43170.07620.23470.57480.62742.07581.78491.53151.70912.21640.32310.78811.08430.63170.49580.78061.21321.51570.93750.71461.25800000000000000
63
62Awesome20% Non Watson-Crick Base Pairs - Effortless4473486
GGAAAAGGGCGGCGGGCGGGCGGGCGGGCGGAAAUGUUUGUUUGUUUGUUUGUUGUUUGAAAAGGUGUUGUUCGCGACACCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.355weak65.701.1570.579-0.18372.42251.57391.53480.758000000.74880.7399000000000-1.007401.44510.71420.706100.7496000.66790.66081.29391.26740.62730.621000.614800.60870.6028-0.9605002.04023.0481.08880.12420.53040.5259-0.41010.51710-0.91771.51331.954-0.8207-0.04883.74541.97250.32541.38022.76990.34431.8864-0.17461.15341.56343.3794.01350.9295-0.02960.97600000000000000
64
63Non Watson-Crickish (GA Proximity 3 UC)20% Non Watson-Crick Base Pairs - Effortless4478521
GGAAAAGUCGUUAAGUAGCUAUCUACUAUCGAAAGAUGGUCGAUAGAUACGUAAUGACAAUAACGUACACUUCGGUGUACGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.62
medium
91.40.0220.2450.1340.46040.81780.65770.61520.63140.70170.05170.04650.01030.07220.01320.03090.1080.32230.0205-0.03550.01560.0714-0.0177-0.01770.0129000.0510.01020.01020.02040.0407-0.01770.01020.05350.38390.19140.1908-0.01530.02240.00470.020.08010.04230.050.020.03990.020.010.00450.15910.02430.01990.05950.13860.05930.0790.07110.04930.01020.04920.1520.36250.82840.890.79870.50890.13390.05070.01930.02760.04230.11560.15650.44810.18110.25380.278400000000000000
65
64design20% Non Watson-Crick Base Pairs - Effortless4479885
GGAAAACGCGGCCGCGCCGCGCCCGCGCGGAAAACCGCGCGGGCGCGGCGCGGCCGCGAAGAAGCGGCGGUUCGCCGCCGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0weak82.904.492.24561.744530.892600000000000000000000000000000000000000000000030.902800000000020.604115.453912.363630.910914.26684.415910.91-55.27748.430605.15208.83214.12168.83216.3417.025600000000000000
66
65design 220% Non Watson-Crick Base Pairs - Effortless4479892
GGAAAACGCGGCCGCGCCGCGCCCGCGCGGAAAACCGCGCGGGCGCGGCGCGGCCGCGAAGAAGCGGCGCUUCGGCGCCGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0weak77.105.4022.70100000000000000000000000000000000000000000000000000000000061.78520030.902820.60410015.4539012.363627.476211.240424.04253.2539012.88016.869400000000000000
67
66design 320% Non Watson-Crick Base Pairs - Effortless4479894
GGAAAACGCGGCCGCGCCGCGCCCGCGCGGAAAACCGCGCGGGCGCGGCGCGGCCGCGAAGAAGCCGCGCUUCGGCGCGGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0weak82.904.3132.157000000000000000000000000000000000000000000000000000000000000061.785230.9028000041.212808.831418.54665.6202-33.964414.267200000000000000
68
67Default title20% Non Watson-Crick Base Pairs - Effortless4480270
GGAGAAAUAUAUAUAUAUAUAUAUAUAUAUAAAGAUAUAUAUAUAUAUAUAUAUAUAUAAGAACGUAUAUUUCGAUAUACGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.822weak82.900.6130.3070.41220.40160.40130.85331.05430-0.180700.279900-0.18010-0.1796000-0.17910000.139600000-0.03931.36240.54021.70721.15971.07620.12641.05570.49280.3674-0.05580.243500.24250.121000.120800.1206000000-0.17750.120300.47760.70821.98710.54591.14271.91610.9434-0.1750.41650.20750.61640.20480.50780.50362.13931.05150.67391.382500000000000000
69
68AUfocus20% Non Watson-Crick Base Pairs - Effortless4481486
GGAAAAGAGGGAGGGAGGAGGGAGGGAUUUGAAAGGGUUUUUUUUUUUUUUUUUUUUUAAAAGGGAGUAUUUCGAUAUUUUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.237weak64.302.6491.32400-4.35580000000000000000000000.1536-2.88580000000000.4197-2.527412.0667-3.83316.6243-2.3882-2.04939.64827.442111.061110.62259.5545.30312.10912.59780.85401.93041.0837-0.10440.7921.0382-4.00861.20660.39292.36460.01071.23641.6313-1.23682.68853.09392.40973.12353.05523.90321.1461-0.03961.67700000000000000
70
69GU Look Lovely20% Non Watson-Crick Base Pairs - Effortless4490153
GGAAAAGAGAUUGCAUAACGUUAAGCAUGUGAGAGCAUGCUUGACGUUGUGCAGUUUCAAAAAGCCUGUCUUCGGACAGGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.338
medium
92.90.0260.2910.1590.34290.85150.9140.60970.53830.52590.12540.03270.05450.04350.01090.03260.0217-0.01500.05430.01090-0.01500.02170.0326-0.004200000.01080.03250.31280.90350.26460.26870.48620.156400.0417000.0104000.041700.00580.020800.01040.02080.04160.01040.03120.083-0.0150.05180.01710.06210.18690.87880.98810.7330.58540.64150.19670.12480.01380.07130.0670.17180.48140.49770.22830.5470.302100000000000000
71
70Where is my previous design ?20% Non Watson-Crick Base Pairs - Effortless4490713
GGAAAAGGGCCCGGGCCCGGGCCCGGGCCCGAAAGGGCCCGGGCCCGGGCCCGGGCCCAAAGAGGCCGGCUUCGGCCGGCCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0weak78.603.6671.833000000000000000000000000000000000000000000000000000000000000000000061.805620.604124.727117.6629013.738115.455600000000000000
72
71Default title20% Non Watson-Crick Base Pairs - Effortless4492533
GGAAAAGUCAUAGUGCUCGCUUGGCGUCGGAAAACUGAUGCCAGGUGGGUACUGUGGCGAAAAGAUGUGGUUCGCCGCGUCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
9.217good91.40.0340.3730.2030.590.68160.75270.52590.48531.07360.03160.06080.03330.04750.03730.02430.0350.01460.01460.00490.01460.00970.00610.00490.03280.01210.00730-0.00390.01940.0010.00540.14280.46620.83230.95761.15860.95940.16540.35440.03620.04230.04230.0111-0.00160.00730.00280.01780.02890.01610.01890.04050.01170.04830.03160.01110.0420.02270.01670.01230.0480.03320.46060.79050.74710.76940.81130.1640.24260.2190.20990.13920.23880.16960.54470.23520.44830.47900000000000000
73
72Default title20% Non Watson-Crick Base Pairs - Effortless4492537
GGAAAAGUCAUAGUGCUCGCUUGGCGUCGGAAAACUGAUGCCAGGUGGGUACUGUGGCGAAAAGAUCUGGUUCGCCGGGUCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
7.512good97.10.0270.3590.1930.52340.66190.79940.75570.52111.08170.07190.02520.03820.01830.03050.00920.01070.00710.0178-0.00130.00530.003600.00890.00740.00710.02130.00710.00410.02330.00560.0020.15930.47830.81640.951.14821.01390.14720.35990.05030.02750.01630.01120.00330.0126-0.00360.01950.02740.01260.01730.01730.02090.07770.02270.00430.03880.05810.01250.01710.05140.03370.45720.90370.85790.81890.70380.13290.14510.08990.05570.08560.13720.15950.56750.16460.53830.539800000000000000
74
73Non Watson-Crickish (GA Proximity 2 UC)20% Non Watson-Crick Base Pairs - Effortless4493682
GGAAAAGUCGUUAAGUGCAUAUCUACUAUCGAAAGAUGGUCGAUAUGAACGUAAUGACAAUAACGAUCACUUCGGUGAUCGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.54
medium
92.90.0230.2580.140.52670.50140.98880.59210.62160.8063-0.00110.02810.0350.05830.02330.01160.13250.35680.10820.11940.14060.03870.01150.01150.011500.01140.03430-0.04420.03430.03430.01140.03430.09120.44550.17330.17270.03370.00790.02250.03760.02240.03360.02240.02630.0224-0.00730.02240.00390.00390.27820.07780.05920.18810.09940.03670.06230.04410.0440.0550.09480.26340.83320.68820.95590.38420.14730.07240.0620.06190.06190.11320.12240.3580.25390.25650.341800000000000000
75
74Non Watson-Crickish (GA Proximity 1 UC - 20%)20% Non Watson-Crick Base Pairs - Effortless4493719
GGAAAAGUCGUUAAGGCUAUAUCUACUAUCGAAAGAUGGUCGAUAUAGACGUAAUGACAAUAACGUUCACUUCGGUGAACGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.233
medium
900.0240.2620.1430.46750.49681.05080.58950.41930.70070.05010.0572-0.00850.00580.01430.08560.22040.10340.31050.090.01410.01410.02810.019500.014100.126300-0.02270.04210.035-0.02440.03330.41710.08830.12960.02770.0376-0.02270.01880.02760.05520.05510.01380.02750.01860.01380.00490.02750.05490.19170.01840.13680.24450.04520.10830.09470.02240.10790.05590.45441.11540.74130.87390.28220.10140.21470.06310.02520.03780.05040.16330.53760.14960.36580.404100000000000000
76
75A Little Cloudy20% Non Watson-Crick Base Pairs - Effortless4499785
GGAAAAUCUAGUGAUCGCGUGAGUUGUUCAGACAUGGAUAAUUUAUGUGGUCAUUGGAGAUAAAUAACUAUUCGUAGUUAUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.92
medium
92.90.0350.3820.2080.55940.72390.73130.71870.36880.59190.071400.08140.0610.03050.00510.03560.0102-0.017800.01020.01020.01020.02030.01650.01010.05070.02030.02030.01330.0436-0.0038-0.01270.37280.77041.41940.30121.21320.21660.09390.01880.04690.07040.02810.06540.04670.09330.07920.02790.02790.01870.03720.09280.02780.00930.02780.01390.06010.07850.09680.2160.08250.31950.92890.67651.0990.83250.34180.16820.09140.05410.04560.04550.39580.75960.22090.63130.833100000000000000
77
76Default title20% Non Watson-Crick Base Pairs - Effortless4500054
GGAGAGUAAUAAUAUAAUAUAAUAUAAUAUAAGAAUAUUAUAUUAUAUUAUAUUAUUAGAGAGAUAUUUAUUCGUAAAUAUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.95weak92.90.0540.5910.3230.43630.61460.30640.30490.36370.95490.23780.11870.11850.1182000000000000-0.00620.1178000.117600.23420.92292.43781.30171.13130.8370.31230.10390.207100.103400-0.0202000-0.02020000.1029-0.123-0.12270.102700.10250.10240.30560.50520.67531.36531.05450.35341.02890.92150.15320.72530.27080.26960.3130.83791.17360.42881.05620.993300000000000000
78
77cis & trans Sugar Edge?20% Non Watson-Crick Base Pairs - Effortless4503110
GGAAAAGUUCCUCUAUUGUGUUGCAUUUUAAACAAGAAGGGCGGAGCGGCAGAGAAACAAAAGCCUAUUCUUCGGAGUAGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.88
medium
700.0840.9240.5040.48870.8310.94151.03530.98461.22780.27350.39010.32820.08620.03450.32580.36820.3610.79060.44920.14970.40110.36070.75770.77940.5991.25520.72341.66141.04951.40591.161.32011.47510.92190.44860.2150.56830.28620.59210.84210.33660.23960.39750.21730.19270.22750.54340.36050.17640.11150.440.63990.43760.79220.72940.6180.37911.05370.5190.2090.18070.35910.4440.24120.30560.24890.01660.0410.02050.10860.12250.07360.14850.62980.26050.53760.321600000000000000
79
78Mission n░120% Non Watson-Crick Base Pairs - Effortless4505366
GGAAAAGGGCCCGGGCCCGGGCCCGGGCCCGAAAGGGCCCGGGCCCGGGCCCGGGCCCGAAAAGGCCGACUUCGGUCGGCCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0weak77.104.0962.04800000000000000000000000000000000000000000000000000000000000061.785241.20820015.453900012.363641.2155-48.76970-20.1508-16.482100000000000000
80
79Fiskers 20% D120% Non Watson-Crick Base Pairs - Effortless4507465
GGAAAAGCGUUAGCACCGACCAUCGUUCAGGAAACUGUACUAUGCUCAGUACUAUCGCAAAAAGUCUAGGUUCGCCUAGACAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.666
medium
98.60.0260.2910.1590.80160.74860.96310.45450.51940.6260.05430.02330.07750.04860.06680.06670.02320.05780.08080.00770.04620.05760.08830.0690.01250.07650.02680.09550.06290.1180.0570.00940.03980.08720.18230.45480.37730.47050.0530.05910.04180.14770.05150.04410.11420.15450.10220.16820.09850.07980.01940.1230.09390.01120.10810.05430.02950.1220.07560.06120.08630.06970.49420.58610.61270.63320.84880.13770.10750.02990.07010.06330.10030.11680.39370.11820.44490.408900000000000000
81
80Fiskers 20% D220% Non Watson-Crick Base Pairs - Effortless4507515
GGAAAAGCGAUACAUGCCUCGUACCAUGUCGAAAGACUUGUUACCAGACAAGUACCGCAAAAAGUCAUGGUUCGCCAUGACAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.489
medium
900.0290.3150.1720.61650.68590.77370.66190.4550.64370.04450.01860.04440.10030.03930.03840.05420.1950.11920.08430.05490.06390.05230.06630.0320.07510.06960.0290.03250.07760.10030.06340.07410.04330.12990.53940.24980.2180.0310.04460.03070.06410.06680.06120.06680.18830.32760.06870.07960.07130.0930.08470.08720.12530.28140.04040.07410.22210.08610.03480.16080.20160.58560.6230.75790.57580.99730.16290.06690.03720.00220.03670.06490.19150.4810.18930.34110.522900000000000000
82
81Fiskers 20% D320% Non Watson-Crick Base Pairs - Effortless4507571
GGAAAACCGUAUGAUGCCUCGUAACAUUCCGAAAGGAUUGCUACCAGACAACAUCCGGAAAAAGUCUUGGUUCGCCAAGACAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.535
medium
91.40.0240.2630.1430.38430.66480.80790.44870.44320.42640.01350.02270.04380.02180.1610.05360.05170.33420.04230.04980.02660.01440.05090.11490.05620.04520.05610.0770.0330.00881.00E-040.05920.0131-0.00210.10060.41690.20010.10050.00850.02790.03440.02590.00850.0710.05810.07290.05470.05020.08540.07060.05130.16620.0630.1990.1350.06060.02710.04430.019-0.01370.00980.16770.50720.62340.70850.47670.74670.14890.09720.08220.080.02570.08380.10330.52240.18160.53190.568700000000000000
83
82Default title20% Non Watson-Crick Base Pairs - Effortless4509940
GGAAAACUUCGGGUUCGGGUUCGGGCUUUCGAAAGAGGGUUUGGGCUUGGGCUUGGAGAAUAAGCCCGGCUUCGGCCGGGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.938weak900.0350.3870.2110.90521.08850.79550.67140.53250.440600.08800.087900000.08770.0876000.261700.005500.0870000.00540.0053000.25920.26230.17130.174700000.25490.084800.16920.08450.0844000.33570.083800.08370.083600.12510.12490.24870.16670.16470.08230.57011.11880.94080.85260.30850.61090.22820.076-0.08080.15160.15120.5990.95021.22690.92421.321800000000000000
84
83A Little Cloudy20% Non Watson-Crick Base Pairs - Effortless4510802
GGAGAACGUGUAAUAUAGUCGUCGUGAUUGGAAACGGUUAUGAUGAUUGUGUUAUACGCGAAACUCGCAGUUCGCUGCGAGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
5.271good95.70.0150.1630.0890.3710.48990.33070.50290.43210.21260.03230.02490.0201-0.008-0.00790.01530.01770.02480.02560.0210.01170.02710.00950.0010.01520.00710.00240.0190.00950.00910.0380.05450.08620.15350.24180.32880.21310.16480.04590.10670.0310.02980.04950.03930.03470.01930.01240.0170.00340.01870.01610.0340.03690.00170.02760.0460.01690.04530.03090.02230.030.05060.09690.27430.51790.38530.14380.06240.02860.0130.02520.02260.03520.12410.55070.24350.34890.355200000000000000
85
84One solution20% Non Watson-Crick Base Pairs - Effortless4514051
GGAAAGGGUUAUUAUAUUUAUUGUUGGAUUAAAAGGUUUAAUAAUAAAUAUAAUAAUCAAAAGCUAUAGCUUCGGUUGUGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.469
medium
85.70.0670.7380.4030.37460.86670.87020.56560.34180.5085000000.084600.0845-0.103700000.16860000.08420.08410.33440.2498-0.02041.03945.50251.31010.86120.56890.35351.11090.75440.20510.13640.70460.20130.0670.06700.13360.1333-0.1030.06660.19910.06630.13230.19790.19720.06570.093500.06540.06530.58241.04961.06280.89340.86770.60060.07711.15891.06650.90881.22490.38730.16550.38390.21860.2241.068300000000000000
86
85Default title20% Non Watson-Crick Base Pairs - Effortless4517845
GGAAAACGUAUAUGUGUAUGUACAUGUAUCAAAAGAUGUAUGUAUGUGCAUGUGUACGCACAGCGUAUGCUUCGGUGUAUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
7.545good900.0380.4130.2250.56181.01460.88740.71460.48870.22980.04220.02650.02050.12090.01660.08350.07080.03470.02880.02880.03880.05290.02850.02870.01070.01490.0714-0.0013-0.00990.09280.05450.04610.12710.59721.05191.75450.94591.06440.13920.13080.11440.13830.08670.06730.07040.07680.03350.09250.04610.07160.02370.0318-0.0050.07140.07770.19570.05680.09140.04530.04550.0620.12570.30430.68830.28280.5470.26370.22050.50950.530.80310.4910.25950.28640.45260.38620.31330.377200000000000000
87
86ViennaUCT Design 120% Non Watson-Crick Base Pairs - Effortless4520667
GGAAAAGUCAUCUGCAGUAUGUCGCAUAGGAGGCCCUGUCCGUCAUGCAGCAGUCGACGAAAACUAGACCUUCGGGUCUAGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.912
medium
88.60.0350.3880.2120.620.79150.81740.5840.78860.820.02970.04950.06130.27550.38830.0391-0.00270.0070.04390.33870.07950.07940.11920.07760.1250.05760.03550.06710.09570.12420.11150.12370.10450.33090.72340.96590.8410.70720.09480.07140.05890.16010.17370.03540.08850.04060.08830.06170.08810.07550.06150.13660.30520.0610.06960.09990.25530.30570.43690.09380.08520.07660.56980.82180.83080.51520.37480.07620.00810.04390.04020.04820.08420.03970.19490.12360.28910.118800000000000000
88
87ViennaUCT Design 220% Non Watson-Crick Base Pairs - Effortless4520673
GGAAAAGUAUAUUAUCCAUCUACACAGUGCACGAGCAAUGUGUAGCCGGAUGAUGUGCAAAAGGCUGGUCUUCGGAUCGGCAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.441
medium
95.70.0320.3550.1940.38270.67930.65350.47060.44410.59750.08540.08830.12740.04630.04240.05250.00770.04190.003800.01430.18130.09730.03470.01130.01390.02250.02770.03140.02450.15870.04140.08260.15111.68080.36520.83711.47540.22890.06990.12040.2210.02780.06940.02140.01260.00630.01130.0440.13810.05260.01250.0150.03380.07820.05550.11230.05220.08330.08310.11010.13040.91350.62540.59150.41430.6450.11080.07160.04980.0640.05390.06380.20240.28790.15640.48380.24200000000000000
89
88ViennaUCT Design 320% Non Watson-Crick Base Pairs - Effortless4520675
GGAAAACCUAUGCCGUUUCACCGCGAGUACGACGGUAUUUGCCGCGAGACCGUAUAGGAAAAGGUCUACCUUCGGGUAGACAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
5.8good91.40.0330.3580.1950.27270.66640.62740.51370.30440.23530.04370.00920.03680.06920.0370.07690.02190.05650.04120.05660.13160.07740.11450.28160.19390.10350.00340.02250.10780.19250.08940.0770.07020.03890.93950.96440.27491.32910.35570.07230.36140.25480.25480.13620.16340.12080.13220.12580.12650.1020.10830.08460.04680.02010.02810.05270.07760.18960.12530.10150.10140.26210.56350.60510.58710.31390.86510.14840.10850.03750.03560.06540.04290.08190.25780.1350.27240.130300000000000000
90
89ViennaUCT Design 420% Non Watson-Crick Base Pairs - Effortless4520688
GGAAAACUCAUCGGCAGCUGUCGCCGUCACGUUAGCGACUGUGACCGCCGUCGAUGCGAAUAACCUGAUCUUCGGAUCAGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
7.015good91.40.0330.3580.1950.53730.42740.84640.48930.38910.28860.07040.08250.01780.0149-0.0015-0.00150.0096-8.00E-040.00560.04640.02450.03340.02290.025900.00740.00440.00740.04250.04990.04060.03080.49620.67750.94960.99860.91770.9850.27980.2410.0570.04170.04690.06140.10350.01670.06340.03150.01330.04480.01440.01330.03660.03990.04980.05120.03940.05590.06950.10190.27750.6690.64930.97480.74670.70320.51030.07940.04270.03970.02440.04970.02220.09210.51580.16020.26950.144300000000000000
91
90ViennaUCT Design 520% Non Watson-Crick Base Pairs - Effortless4520693
GGAAAACCGUCGGAGCAUCGUUACGAUCACUGAUGUGCUCGUGUUGAUGCGCUGUCGGAAAGACACUUACUUCGGUAAGUGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
8.75good88.60.0390.430.2350.54370.66740.6340.53940.40890.36540.01360.02640.01750.07620.01450.03280.19270.23750.01120.02390.01910.00320.04770.31560.45260.33660.02710.0187-0.0030.04060.04050.02810.04980.08921.82731.8751.35281.06120.09540.0560.0490.04340.0140.01120.02370.05160.30940.60270.35750.01630.060.01770.02720.01760.25480.07040.13240.07680.07940.02270.03090.13670.61740.62520.44820.67630.5870.14090.0630.01890.04030.04160.08870.11730.53030.20860.33850.325600000000000000
92
91ViennaUCT Design 620% Non Watson-Crick Base Pairs - Effortless4520697
GGAAAACUGGGAUAACGCAGUAUUAUCCGCGGAGGCCGAUGAUGCCGGGUUAUCGCAGAAAAGCCACAUCUUCGGAUGUGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
4.654
medium
900.0420.460.2510.3810.58660.90020.60310.47020.33140.02740.02270.01390.3870.06290.09880.04490.02710.04480.01361.14140.08310.12220.07410.06530.11320.08640.06910.09490.0340.06030.060.3090.06750.37471.29970.46361.04410.60030.19190.09370.0960.20650.11760.1420.13280.14720.07890.03060.03350.2450.72840.20740.04520.06940.19210.06140.05141.27350.11720.14670.28470.93820.87990.45410.50510.50240.08240.08230.03840.06810.00860.02790.07670.6380.28160.32120.272100000000000000
93
92ViennaUCT Design 720% Non Watson-Crick Base Pairs - Effortless4520705
GGAAAACCGUGUCUAUAUAACGCGCGCUCGGAGACGACCACGGGUUAUGUCAACAUGGAAAGACUAGCGCUUCGGCGCUAGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
2.901
medium
84.30.0360.3940.2150.44740.75230.76590.57680.37870.36230.04260.042600.056700.12730.34770.26080.58930.18090.22370.05940.07540.06160.06160.68320.04770.09450.08090.08780.32780.05360.05340.13990.3180.51250.44960.35010.10960.15490.20580.12840.15370.04410.03840.03130.66240.11880.03060.07550.15580.08040.27430.17170.22160.17150.19680.04580.32930.08690.15470.29580.62150.61040.53550.8650.5290.13690.03420.02590.00320.11370.05680.20660.50490.27890.36070.164900000000000000
94
93ViennaUCT Design 820% Non Watson-Crick Base Pairs - Effortless4520709
GGAAAACACGUGAGCGGUGUAGUCAUGUGGUAGUCCUCAUGUCUGCUCCGGGCACGUGGAAAACCGAGUCUUCGGACUCGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
7.784good95.70.030.4120.2210.5180.41760.71140.40830.41590.24720.04980.0109-0.00190.0039-5.00E-040.02790.1220.4090.0130.0060.0470.02810.02110.01620.02160.03450.03020.01670.01290.00810.01290.03010.03760.28674.0581.51.21031.05040.11870.04010.02990.01390.04110.02990.00640.05590.00640.00750.02610.00710.02680.007400.04460.87360.17260.00990.02190.03420.01830.03530.04570.36270.73710.91120.62230.56060.04170.04550.07570.0110.04060.02950.11010.52890.16660.22310.178500000000000000
95
94first design20% Non Watson-Crick Base Pairs - Effortless4526116
GGAAGCGUAUUUAGAGUUAGAUUUAGCUACAAAAGUAGUUAGAUUUAGCUUUAGAUACAAUGGUGUGUUCUUCGGAACACGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.326
medium
95.70.0340.3760.2050.79450.87940.71240.68630.31210.44410.08770.01780.04070.02350.02380.01160.01160.011600.03480.01160.0123-0.01690.03470-0.0056-0.01710.0015-0.09030.011500.02960.06910.25841.25771.87870.96231.23290.08370.07320.03520.03130.0560.07290.03510.0520.0519-0.03390.06230.06970.03190.02070.0310.0450.11340.11320.02420.01390.13330.10940.04440.13280.65551.0170.26070.90290.92360.7490.21610.10510.11890.10920.04670.07820.40710.15090.15660.239400000000000000
96
95first design20% Non Watson-Crick Base Pairs - Effortless4526122
GGAAGCGUAUUUAGAGUUAGAUUUAGCUACAAAAGUAGUUAGAUUUAGCUUUAGAUACAAUGGUGUGAUCUUCGGAUCACGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.739
medium
98.60.040.4430.2420.31690.89370.64350.73530.50840.47770.05330.03550.03550.0237-0.00880.04730.01180.08260.02360.03540.0662-0.0030.02060.0235-0.00440.0470.0176-0.0017-0.074800.01170.03510.14010.21451.34262.25461.12631.530.10910.03050.0360.02040.04680.09620.00380.05170.1286-0.01230.06180.00720.03440.01030.02050.00460.14340.13160.060.0510.10180.04370.05160.03860.66091.06640.42471.09611.25530.91930.19580.08520.13750.07570.11870.12310.46810.27910.34870.218500000000000000
97
96first design20% Non Watson-Crick Base Pairs - Effortless4526124
GGAAGCGUAUUUAGAGUUAGAUUUAGCUACAAAAGUAGUUAGAUUUAGCUUUAGAUACAAUGGUCAGAUCUUCGGAUCUGGAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
3.816
medium
98.60.0390.4240.2310.9691.14410.80650.7080.37680.67410.03830.02190.02710.03280.00520.010900.0873-0.00580.04360.05370.02610.02680.0434-0.0392-0.00580.02710.0679-0.019-0.00580.0050.01580.07550.18761.27762.07071.13661.38180.17760.09690.0194-0.00690.03670.05670.04620.04820.03170.04130.03850.0232-0.05210.03150.05750.0670.06690.04610.11430.05710.0880.17050.05680.12760.73151.11230.35241.08020.93520.8750.01820.08730.05180.12910.0860.1030.65020.19890.31160.235300000000000000
98
97Non Watson-Crick 120% Non Watson-Crick Base Pairs - Effortless4528087
GGAUAAUAUUUUUUUUUUUUUUUUUUUUUUAAAAGGAAGAAGAAGAAAGAAAGAAAUAAUAAAGUAUAUGUUCGUAUGUACAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.001weak68.606.7063.353000061.78520-8.137920.7087-3.22120.6041-5.834110.122907.4557025.455818.03168.83199.36728.134703.09120005.62045.1526.86946.18257.2735005.012801.6275.0703-4.23541.3441.31542.5235-0.9627-0.86282.2081.08471.066002.06083.864100.951201.8455-2.604200.8961.741603.685-0.58543.68013.47331.9442-0.55310.9048-0.26250.5725-3.00E-042.11370.39581.7019-0.15892.59413.275500000000000000
99
98Usai s Trigger20% Non Watson-Crick Base Pairs - Effortless4528624
GGAAAAUAUAUAUAUAUAUAUAUAUAUAUAUUCGUAUAUAUAUAUAUAUAUAUAUAUAAUAACAAUUAAAUUCGUUUAAUUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
0.813weak87.10.070.7750.4230.40431.1354-0.90350.72330.21450.49650.14150.14120.140900.14060-0.20880-0.20810-0.20740000000-0.06650-0.2060.27920.13931.36240.93921.94910.89640.42840.37790.25090.24990.12470.371800.24690.1232000.1230.36670.1220.0192-0.306000.36310.12080.12060.24020.11990.27240.61890.88690.92452.27461.2730.74080.72271.11530.99751.07811.05970.71411.66771.66780.84470.9521.163600000000000000
100
99Usai s Tower20% Non Watson-Crick Base Pairs - Effortless4528629
GGAAAAUAUAUAUAUAUAUAUAUAUAUAUAUUCGUAUAUAUAUAUAUAUAUAUAUAUAAUAACAAAUUUUUUCGAAAAUUUAAAAGAAACAACAACAACAAC
......((((((((((((((((((((((((....)))))))))))))))))))))))).....(((((((....))))))).....................
1.182
medium
77.10.0730.7990.4360.73390.48331.09040.70100.11660.116400.34720-0.260300-0.1299-0.129600.11550000000000.23020.34340.56711.09350.33171.92821.335101.02850.38120.50580.101000.100800.17250-0.15580.10.099900.099700-0.12770.09950.0994-0.02830.19780.26590.7451.62591.06171.39871.66821.07911.34221.15231.00581.57491.23470.8621.69861.52830.78070.12041.852600000000000000
Loading...
Main menu