PRIMERS, plasmids, freezer stocks, etc.
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
NumberPrimer NameSequencefor sequencing?Forward?Tm (finnzyme)Warning?bpOrder SubmittedCommentsOrder file nameOrder file locationextra notes
2FLS_reverse_8GCCggaACCACCggtGCCGCCggaCTCCAGGGCGTGAAFALSEFALSE10/21/2011FLS was WRONG: Re-made & re-ordered it2011_10_20_Primer_order_translation_fusion_Try1Macwrong but I forget why
3ADH_forward_8tccGGCGGCaccGGTGGTtccGGCGGCCATCATCGGCAFALSEFALSE10/21/20112011_10_20_Primer_order_translation_fusion_Try1Macomitted 14 bp!!
4ACS_reverse -- BEFORE ACS!!CCTTCTTAATGTTATACAGTGTTATRUEFALSE54.310/21/20112011_10_20_Primer_order_translation_fusion_Try1Mac
6FLS_reverse_8GCCggaACCACCggtGCCGCCggaCTCCAGGGCGFALSEFALSE?Corrected FLS_reverse_8; gave Erick the broken tube.Mac
7VRattaccgcctttgagtgagcTRUEFALSE63.5*Works like VF2 does in pCM66Mac
9VF_J1GCTTTCGCTAAGGATGATTTCTGGTRUETRUE67.8Tm=58; starts right before BioBrick prefixMac
18FLS-610-FCAGAACGCCCGGTCATTGTTRUETRUE68.7numbering starts from ATG on gene, and counts to starting bp of primer2011_12_25_Primer_Order_verify_translation_fusion_productMac
19ADH-220-FTTGATGCCACTAGCGCAGGTRUETRUE68F is for forward, R is for reverse. (This is different from L/R above)2011_12_25_Primer_Order_verify_translation_fusion_productMac
24DHAK-894-FCCGGTTCAGACCATTGCGTRUETRUE68.1*18WARNING - non-specific sequencing in 10-208678147 when the priming sequence was verified2011_12_25_Primer_Order_verify_translation_fusion_productMac
25GBD-end-FCTCCGAAGGCAAGCACCATRUETRUE681/8/2012start primer to verify insert of Berkeley Scaffolds2012_01_08-primers-to-verify-scaffoldsMac
26TrrnB-start-RtgttcgggcccaagcttcTRUEFALSE691/8/2012reverse primer to verify insert of Berkeley Scaffolds (ordered with F letter; later changed to R because it goes backward!)2012_01_08-primers-to-verify-scaffoldsMac
27ADH_F_8-v2GCCggaACCACCggtGCCGCCggaAGCAAACGTAAAGTGGCCATFALSEFALSE441/17/2012fixed version of primer3: primer3 was missing 14 bp!!
29SH3-FLS-FTTTCTTCGAATTCGCGGCCGCTTCTAGAGatgCCGCCGCCGGCGCTGCCGCCGAAAAGAAGGAGAGGTAGCGGCGCGATGATCACGGGCGFALSEFALSE85901/17/20121st useless base missing: to make 90 bp to make order cheaper! BioBrick prefix, start, Janet's SH3 design, GSG linker, FLS
32FLS-R-biobricksGTTTCTTCctgcagcggccgctactagtaCTCGAGTCATTACTCCAGGGCGFALSEFALSE75571/17/2012includes 2 stop codons, & NotI between stops and BioBrick suffix. Reverse complement!
33ADH-R-biobricksGTTTCTTCctgcagcggccgctactagtaTCATTAAGCTGCCTCACCAGCFALSEFALSE75501/17/2012includes 2 stop codons, no NotI, yes biobricks. Reverse complement!
34FLS_rev_8-v3GCCggaACCACCggtGCCGCCggaCTCCAGGGCGCCAGATTGFALSEFALSE82422/7/2012improved (20 bp of homology instead of 10) to reduce mispriming
35ADH_F_8-v3tccGGCGGCaccGGTGGTtccGGCAGCAAACGTAAAGTGGCCATFALSEFALSE80442/7/2012correct sequence for homologous region
36GibBrP-J23100GTTTCTTCGAATTCCTGCTGCGGAGATCTTTGACGGCTAGCTCAGTCFALSEFALSE72472/24/2012extra bps + GibsonBrickPrefix + 18 bp of J23100
37FLS-8AA-GibBrSCAAAGAAGCTCGAGAACCCTGTTGGATCCaccaccggtgccgccggaCTCCAGGGCGCCAGATTGAAFALSEFALSE82672/24/2012reverse: 18 bp FLS w/o stop codons +GibsonBrick suffix
38GibBrP-ADH-noStrtGTTTCTTCGAATTCCTGCTGCGGAGATCTAGCAAACGTAAAGTGGCCFALSEFALSE72472/24/2012extra bps + Gibson Brick prefix+ 18 AA of ADH w/o start codon
39ADH-GibBrSCAAAGAAGCTCGAGAACCCTGTTGGATCCTCATTAAGCTGCCTCACCFALSEFALSE72472/24/2012reverse of: 18 bp of ADH + 2 stop codons + GibsonBrick suffix + extra cutting bps
42lacI-seq-insertgattcattaatgcagctggcacTRUETRUE65.79222/27/2012actually primer 124 is better for this purpose: you usually miss a little bit of what comes after lacI
43FLS-BamHI-FGCACGCCCGGACCCAGCTGATTTAGFALSEFALSE81252/2/2012for site-directed mutagenesis to make them BglBrick-firendly
44FLS-BamHI-RCTAAATCAGCTGGGTCCGGGCGTGCFALSEFALSE81252/2/2012for site-directed mutagenesis to make them BglBrick-firendly
45DHAK-BglII-FCCCAAGCACCGAAGACCTCATTAGCFALSEFALSE77252/2/2012for site-directed mutagenesis to make them BglBrick-firendly
46DHAK-BglII-RGCTAATGAGGTCTTCGGTGCTTGGGFALSEFALSE77252/2/2012for site-directed mutagenesis to make them BglBrick-firendly
47DHAK-BamHI-FGAAAGTCCTGGACCCTATCCCAAGCFALSEFALSE77252/2/2012for site-directed mutagenesis to make them BglBrick-firendly
48DHAK-BamHI-RGCTTGGGATAGGGTCCAGGACTTTCFALSEFALSE77252/2/2012for site-directed mutagenesis to make them BglBrick-firendly
49ACS-BamHI-FCCTTGGCGGACCCGGGTGTCGFALSEFALSE81212/2/2012for site-directed mutagenesis to make them BglBrick-firendly
50ACS-BamHI-RCGACACCCGGGTCCGCCAAGGFALSEFALSE81212/2/2012for site-directed mutagenesis to make them BglBrick-firendly
51FLS_rev_6accactagtactaccgccctccagggcgccFALSEFALSE80.4303/7/2012Tm for homology region = 58.8 (12 bp); Tm for linker = 54.7 (21 bp) via Finnzyme calculator. Whole sequence Tm = 80.4
52ADH_F_6ggcggtagtactagtggtagcaaacgtaaagtggcFALSEFALSE75.2353/7/2012Tm for linker = 54.7 (21 bp) via Finnzyme calculator. Tm for homology region = 56.9 (17 bp); Whole sequence Tm = 75.2
53FLS_rev_6-controlaccactagtactaccgccttatcactccagggcgFALSEFALSE73.4343/7/2012Tm for homology region = 58.7 (16 bp); Tm for linker = 54.7 (21 bp) via Finnzyme calculator. Whole sequence Tm = 73.4
54ADH_F_6-controlggcggtagtactagtggtaggaggtaaaacatatgagcaaacgtaaagtgFALSEFALSE78.4503/7/2012Tm for linker = 54.7 (21 bp) via Finnzyme calculator. Tm for homology region = 58.3 (18 bp); Whole sequence Tm = 78.4
55SH3-ADH-add-EloRBSGTTTCTTCtctagagTAACACTGTATAACATTAAGAaaagaggagaaataCTAGAGatgCCGCCGCFALSEFALSE663/20/2012Add Elowitz RBS (BBa_B0034) in front since cloning didn't work well. 10 bp homology with PDZ-FLS; use with VR to make part. These include a spacer that I don't need (I found out after the fact)
57J23110-ACS-promoter-FTTCTTCGAATTCGCGGCCGCTTCTAGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCAGGAGGTAAAAAAAATGAGCFALSEFALSE4/12/2012For changing the pLac promoter to J23110. Tm for homologour region on ACS-DHAK is 57oC by Finnzymes.
60VR-RCgctcactcaaaggcggtaatTRUEFALSE63.5*reverse complement of VR. Works backward in pCM66
61GBD-ACS-Gibson3-VR-RC-alternateGCTAATCTAACTAACTAACCCTTAGTGACTCgFALSEFALSE?? On 7/20/2012 I tried to figure out what this primer is and have no idea. Doesn't match anything
62inside_GBD_FGTGCTCTGATGCACGTTATTRUETRUE59Tm by finnzymes. One of two primers to verify gibson cloning
63ACS_38_RGATTGATAAGGCAACGGTCCTRUEFALSE63.6used with primer 62 on potential Gibson assembly, this --> 156 bp & shouldn't prime on un-modified template. **Use in conjuction with primer 59 and/or VF2 (as a positive control)
64Eut-440-FttaaactttaccctgtgtgaTRUETRUE55.35205/22/2012 ishordered by Amanda
65Eut-1213-FagtgtgccgtcgctaTRUETRUE57.88155/22/2012 ish
66Eut-1944-FcagtgggcgaacgatTRUETRUE59155/22/2012 ishuse VF2 & VR to complete sequencing coverage
67GA-1-p1-2012_06atttctcctcttttgtgctcagtatcttgttatccgctcacaatgtcaattgttatccgctcacaattAGATCTCCGCAGCAGGAATTCFALSEFALSE90sew new FLS & ADH ec_ADH_sol with PDZ & SH3 into a new pSB3K3 vector: see red notebook for planning
76pGA3K3-pre-prefix-FaatccttagctttcgctaaggatTRUETRUE62.52works on pGA1C3, too!
78replace-p68ttgtgagcggataacaattgacattgtgagcggataacaagatactgagcacaaaagaggagaaatactagATGGCGATGATCACGGGCGFALSEFALSE73.9690had "scar" before prefix wrong
79replace-p70AACACTGTATAACATTAAGAaaagaggagaaaTACTAGATGAGCAAGCGTAAAGTGGCGAFALSEFALSE60needed to remove 3 bp before ADH start so RBS is stronger
88Gbsn-ec_ADH_sol-higher exp_FTAGATAACACTGTATAACATTAAGAGGGGGTAGCATAGTTATGAGCAAGCGTAAAGFALSEFALSE6556the Tm that can bind to the reverse direction has Tm = 52.5 (shortened so this is the case).
90Gbsn-ec_ADH_3K9D-higher_exp_FACTGTATAACATTAAGAATATCAAAAGGGAGGACCGGatgCATATGAGCCTGGAAGATAAFALSEFALSE64605' end of the primer mis-anneals but Tm = 48.
96FLS_LT09-163-RCATAACCTTCCGCAGCGTTRUEFALSE64.318Primer 77 is 43-R, but I'll order this one anyway
Plasmid Stocks
Strain Stocks
competent cells
oligo prices
Gibson Assemblies Attempted
Primers - Master Copy
primers to order
Others' Primers
PCR validation
Reusable Gibson Building Blocks