2013_06 GIBSON ASSEMBLY PROJECT TEMPLATE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
|
 
Still loading...
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAH
1
DATE:
2
Project Title:
demo Gibson assembly
3
4
Oligo Design:
5
PCR band descriptionforward primerreverse primerforward Tmreverse Tmbp expectedtemplate
6
backbonepXYZ
7
insertpABC
8
9
10
Colony PCR
11
forward primerreverse primerforward Tmreverse Tmbp desiredbp pXYZbp pABC
12
13
14
15
16
17
sample below:
18
19
20
21
22
23
24
2013_10_14 Gibson - make pCM66TE - electroporation only pCM66
25
REMOVING IncP origin of transfer.agctccgcgaagtcgctcttcttgatggagcgcatggggacgtgcttggcaatcacgcgcaccccccggccgttttagcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgaccttgccaagctcgtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgcgcgggtcgtcggtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatgcgggccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagcaggtaggcctacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaag
26
Oligo Design:
27
PCR band descriptionforward primerreverse primerforward Tmreverse Tmbp expectedtemplate
28
backbone26526670.370.34250pCM66T
29
oriV insert26327070.369.1843pCM66T
30
31
263OriV-Fcctttccgacgctcaccg69.61810/10/2013
32
Colony PCR265ColE1-Fgccggatcaagagctaccaactctt70.36010/10/2013
33
forward primerreverse primerforward Tmreverse Tmbp desiredbp pCM66Tbp pCM66T266Gibson_trim_before_oriV-Rcccagcggcgagggcaaccagcccggtgagcgtcggaaagggtcaagggcacattgcccc70.32510/10/2013
34
270replace_p_264gttaccttcggaaaaagagttggtagctcttgatccggcgcaatgataccgcgagaccc10/10/2013
35
1910/10/2013
36
1910/10/2013
37
2110/10/2013
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
Loading...
 
 
 
Oligo Design
Set up PCR
RECORD PCR products, gibson assemblies, etc.
Gibson Assembly
Copy of Transformations