The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
Project Title:
demo Gibson assembly
Oligo Design:
PCR band descriptionforward primerreverse primerforward Tmreverse Tmbp expectedtemplate
Colony PCR
forward primerreverse primerforward Tmreverse Tmbp desiredbp pXYZbp pABC
sample below:
2013_10_14 Gibson - make pCM66TE - electroporation only pCM66
REMOVING IncP origin of transfer.agctccgcgaagtcgctcttcttgatggagcgcatggggacgtgcttggcaatcacgcgcaccccccggccgttttagcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgaccttgccaagctcgtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgcgcgggtcgtcggtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatgcgggccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagcaggtaggcctacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaag
Oligo Design:
PCR band descriptionforward primerreverse primerforward Tmreverse Tmbp expectedtemplate
oriV insert26327070.369.1843pCM66T
Colony PCR265ColE1-Fgccggatcaagagctaccaactctt70.36010/10/2013
forward primerreverse primerforward Tmreverse Tmbp desiredbp pCM66Tbp pCM66T266Gibson_trim_before_oriV-Rcccagcggcgagggcaaccagcccggtgagcgtcggaaagggtcaagggcacattgcccc70.32510/10/2013
Oligo Design
Set up PCR
RECORD PCR products, gibson assemblies, etc.
Gibson Assembly
Copy of Transformations
Main menu