Account Options>

  1. Sign in
2013_06 GIBSON ASSEMBLY PROJECT TEMPLATE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
$
%
123
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
|
 
Still loading...
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAH
1
DATE:
2
Project Title:
3
Oligo Design:
4
PCR band descriptionforward primerreverse primerforward Tmreverse Tmbp expectedtemplate
5
backbone
6
insert
7
8
9
10
11
12
13
sample below:
14
15
16
17
18
19
20
2013_10_14 Gibson - make pCM66TE - electroporation only pCM66
21
REMOVING IncP origin of transfer.agctccgcgaagtcgctcttcttgatggagcgcatggggacgtgcttggcaatcacgcgcaccccccggccgttttagcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgaccttgccaagctcgtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgcgcgggtcgtcggtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatgcgggccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagcaggtaggcctacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaag
22
Oligo Design:
23
PCR band descriptionforward primerreverse primerforward Tmreverse Tmbp expectedtemplate
24
backbone26526670.370.34250pCM66T
25
oriV insert26327070.369.1843pCM66T
26
27
263OriV-Fcctttccgacgctcaccg69.61810/10/2013
28
265ColE1-Fgccggatcaagagctaccaactctt70.36010/10/2013
29
266Gibson_trim_before_oriV-Rcccagcggcgagggcaaccagcccggtgagcgtcggaaagggtcaagggcacattgcccc70.32510/10/2013
30
270replace_p_264gttaccttcggaaaaagagttggtagctcttgatccggcgcaatgataccgcgagaccc10/10/2013
31
1910/10/2013
32
1910/10/2013
33
2110/10/2013
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
Loading...
 
 
 
Oligo Design
Set up PCR
RECORD PCR products, gibson assemblies, etc.
Gibson Assembly