FishDatabase
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAW
1
FamilyGenusSpeciesTissue No.
Tissue ID (UPRRP)
Collection No./VoucherLocality Field No.Photo 1Photo 2Photo 3Photo 4Tissue LocationRack No.
Tissue Box No.
Box wellTissue Type
Preservation Method
Standard/Total Lenght (mm)
DateCountryState/ProvinceCityLocalityBasinTimeLatitudeLongitudeShow on map
Maximum depth (meters)
Habitat
Collection method
Collector first name 1
Collector last name 1
Collector first name 2
Collector last name 2
Collector first name 3
Collector last name 3
Collector first name 4
Collector last name 4
Collector first name5
Collector last name5
Collector first name6
Collector last name6
RemarksExtract plateExtract wellCO1 sequence
BOLD ID (closest match)
Date of BOLD ID
2
SerranidaeCephalopholisfulvaFL0001FL0001MZUPRRP-I-00220PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-1A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-1B.JPG
UPRRP-FB236F001A1Fin clipsEthanol171.908/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaR.RiveroE.Ribeiro7A01low qualityLQ2016-07
3
AcanthuridaeAcanthuruscoeruleusFL0002FL0002MZUPRRP-I-00221PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-2A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-2B.JPG
UPRRP-FB236F001A2Fin clipsEthanol182.408/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaR.RiveroE.Ribeiro7A02low quality DNALQ2016-07
4
MonacanthidaeAluterusscriptusFL0003FL0003MZUPRRP-I-00222PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-3A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-3B.JPG
UPRRP-FB236F001A3Fin clipsEthanol247.308/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaR.RiveroE.Ribeiro7A03
TCATAAAGATATTGGCACCCTTTATATGATTTTCGGTGCCTGAGCCGGAATAGTAGGAACTGCTTTAAGCCTACTTATTCGAGCAGAACTAAGCCAACCCGGCGCCCTCCTTGGAGACGACCAAATTTATAACGTAATCGTGACAGCCCACGCTTTCGTAATGATTTTCTTTATAGTAATGCCAATCATGATCGGGGGCTTTGGAAACTGACTTATCCCCCTAATGATCGGTGCCCCTGACATAGCATTCCCTCGCATGAATAACATGAGCTTCTGACTGCTCCCGCCCTCCTTCCTGCTGCTCCTTGCGTCTTCAGGGGTCGAAGCTGGGGCCGGAACAGGATGGACTGTCTACCCCCCTCTAGCAGGCAACCTCGCCCATGCAGGAGCGTCTGTAGACCTGACAATTTTCTCTCTGCACCTAGCAGGCATTTCTTCAATCTTGGGTGCAATCAATTTTATTACAACAATCATTAACATAAAACCCCCTGCTATCTCCCAATACCAGACCCCACTATTTGTGTGAGCTGTCTTAATTACAGCCGTCCTTCTCCTCCTCTCCCTGCCAGTACTCGCCGCAGGCATTACAATGCTTCTAACCGACCGCAATCTTAACACCACCTTCTTTGACCCTGCCGGGGGAGGAGACCCCATCTTATACCAGCACCTATTTTGATTCTTT
Aluterus scriptus
2016-07
5
GerreidaeEucinostomuslefroyiFL0004FL0004MZUPRRP-I-00223PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-4A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-4B.JPG
UPRRP-FB236F001A4Fin clipsEthanol16208/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaR.RiveroE.Ribeiro7A04low quality DNALQ2016-07
6
LabridaeHalichoeresbivittatusFL0005FL0005MZUPRRP-I-00224PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-5A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-5B.JPG
UPRRP-FB236F001A5Fin clipsEthanol36.208/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaR.RiveroE.Ribeiro7A05
ATCAGAACAGATGTTGATAGAGAATAGGATCACCTCCTCCTGCGGGGTCAAAGAAAGTGGTGTTTAGATTTCGATCTGTCAGAAGCATTGTAATTCCGGCAGCGAGGACGGGGAGAGAAAGCAGGAGCAAGACGGCTGTAATCAGCACAGCTCATACAAATAGTGGGGTTTGGTATTGGGAGATAGCAGGAGGCTTCATGTTAATGATAGTTGTAATAAAGTTGATGGCCCCTAGAATTGATGAGATACCGGCTAAGTGAAGGGAGAAGATTGTTAGGTCTACAGACGCACCGGCGTGAGCAAGATTTCCTGCTAGAGGGGGATAAACCGTTCAACCAGTTCCAGCACCGGCTTCTACCCCAGAAGAGGCGAGCAGGAGAAGGAAGGAGGGAGGAAGGAGTCAGAAGCTTATGTTGTTCATTCGAGGGAAGGCCATGTCGGGGGCTCCAATCATTAGGGGAATCAGTCAGTTTCCGAATCCGCCAATCATAATTGGTATTACTATAAAGAAAATTATTACGAAAGCATGCGCTGTAACGATTACATTATAGATTTGATCGTCCCCAAGGAGAGCGCCGGGTTGGCTTAGTTCAGCCCGAATAAGCAGGCTCAAGGCCGTGCCTACCATCCCAGCTCAGGCGCCGAATACTAAATAGAGGGTGCCGATATCTTTATG
Halichoeres bivittatus
2016-07
7
AcanthuridaeAcanthurustractusFL0006FL0006MZUPRRP-I-00225PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-6A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-6B.JPG
UPRRP-FB236F001A6Fin clipsEthanol161.508/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaR.RiveroE.Ribeiro7A06low quality DNALQ2016-07
8
HolocentridaeMyripristisjacobusFL0007FL0007MZUPRRP-I-00226PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-7A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-7B.JPG
UPRRP-FB236F001A7Fin clipsEthanol126.408/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaR.RiveroE.Ribeiro 7A07low quality DNALQ2016-07
9
LabridaeThalassomabifasciatumFL0008FL0008MZUPRRP-I-00227PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-8A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-8B.JPG
UPRRP-FB236F001A8Fin clipsEthanol82.508/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaR.RiveroE.Ribeiro7A08
AAGAATCAGAACAGGTGTTGGTAAAGAATTGGGTCCCCCCCTCCAGCAGGGTCGAAGAAAGTGGTGTTAAGATTTCGGTCTGTTAAGAGCATTGTAATACCAGCGGCAAGGACTGGGAGCGAGAGGAGGAGAAGGACTGCCGTGATGAGAACAGCCCATACGAAAAGAGGCGTTTGATATTGGGAGATGGCTGGGGGTTTCATATTAATAATGGTTGTGATGAAGTTGATTGCACCTAGAATTGATGAAATCCCTGCCAAGTGAAGTGAAAAAATAGTAAGGTCAACGGATGCACCAGCATGGGCAAGGTTCCCTGCTAGGGGTGGGTAGACTGTCCAACCAGTTCCGGCCCCTGCCTCAACGCCAGAGGAGGCGAGAAGAAGAAGGAATGAGGGTGGAAGAAGTCAGAAGCTTATATTGTTCATCCGAGGGAAGGCCATGTCAGGGGCCCCAATCATTAGGGGAATTAGTCAGTTTCCGAAGCCTCCAATCATAATTGGTATTACTATAAAGAAAATTATGACGAATGCGTGGGCTGTAACGATAACGTTATAAATCTGATCGTCCCCAAGGAGGGCGCCGGGCTGGCTTAACTCTGCTCGGATGAGCAGGCTTAGGGCTGTCCCTACTATCCCGGCTCATGCGCCGAACACAAGATAGAGGGTGCCAATATCTTT
Thalassoma bifasciatum
2016-07
10
AcanthuridaeAcanthurustractusFL0009FL0009MZUPRRP-I-00228PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-9A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-9B.JPG
UPRRP-FB236F001A9Fin clipsEthanol15208/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaR.RiveroE.Ribeiro7A09low quality DNALQ2016-07
11
LabrisomidaeMalacoctenustriangulatusFL0010FL0010MZUPRRP-I-00229PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-10A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-10B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-10C.JPG
UPRRP-FB236F001A10Fin clipsEthanol4308/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7A10
TACTTAATTTTCGGTGCCTGAGCTGGAATGGTAGGCACTGCCCTGAGTCTATTGATTCGGGCAGAGCTTAGCCAACCTGGGGCCCTCCTAGGGGATGACCAAATTTATAACGTAATTGTTACCGCTCACGCTTTCGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTCGGGAACTGACTTATCCCCCTAATGATTGGAGCCCCTGACATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTTCTTCCTCCATCCTTCTTGCTTCTTTTAGCTTCCTCAGGCATTGAAGCTGGTGCCGGAACAGGTTGAACAGTATACCCCCCTCTCTCAGGAAACCTGGCCCATGCAGGTGCTTCAGTAGACCTAACAATTTTCTCTCTTCACTTAGCTGGTATCTCGTCTATCCTGGGGGCTATCAACTTCATCACCACAATCATTAACATGAAACCGCCAGCAATTTCTCAGTACCAGACACCTCTTTTCGTCTGAGCCGTGCTTATTACAGCTGTACTTCTACTTCTATCCCTCCCCGTTCTTGCTGCCGGCATTACCATGCTATTAACAGACCGAAACCTTAACACAACATTCTTCGACCCAGCTGGTGGAGGTGACCCAATTCTTTACCAACACTTGTTCTGATTCTTCGG
Malacoctenus triangulatus
2016-07
12
ApogonidaeApogonmaculatusFL0011FL0011MZUPRRP-I-00230PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-11A.JPG
UPRRP-FB236F001B1Fin clipsEthanol2708/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7A11low quality DNALQ2016-07
13
GobiidaeElacatinusprochilosFL0012FL0012MZUPRRP-I-00231PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-12A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-12B.JPG
UPRRP-FB236F001B2Fin clipsEthanol3108/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro
Originally identified as Elacatinus cf. evelynae. Re-identified as Elacatinus prochilos based on CO1 sequence. The photographs match.
7A12
CCGGGAATAGTGAGAGACTGCTTTTAGCTCTCMWTATCCGGGGCKANGANACTAAGCCAGCCCGGGGCTCTTTTAGGWGATGACCANAATTTACAATGTGATCGTTACCGCACATGCTTTTGTAATAATCTTTTTCATGRTAATACCAATTATRATTGGAGGCATCRGAAACTGATTAATTCCACTTATGATTGGTGCCCCCGACATGGCATTTCCTCGCATAAATAACATAAGCTTCTGATTACTTCCTCCCTCCTTTCTTCTGCTTCTTGCTTCCTCCGGGGTTGAAGCCGGTGCCGGTACGGGTTGAACTGWCTACCCCCCCTTAGCCGRCAACTTARCCCAKGCCGRGGNCATCCGTTGACTTAACTATCTTTTCCCTTCATTTARCGGGAATTWCTTCAATCTTAGGKGCAATCAACTTTATCACGACCATTATAAACATGAAACCTCCCGCTGTGTCCCAATATCAGACCCCCTTATTGGTGTGAGCGGTGTTAATACAGGCGGTGTCGGTGTTGTTTCACTCCCTGTCCTCGCAG
Elacatinus prochilos
2016-08
14
LabridaeHalichoerespoeyiFL0013FL0013MZUPRRP-I-00232PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-13A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-13B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-13C.JPG
UPRRP-FB236F001B3Fin clipsEthanol9408/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B01low qualityLQ2016-07
15
GobiidaePriolepishipolitiFL0014FL0014MZUPRRP-I-00233PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-14A.JPG
UPRRP-FB236F001B4Fin clipsEthanol3208/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B02low quality DNALQ2016-07
16
LabrisomidaeAcanthemblemariatriangulatusFL0015FL0015MZUPRRP-I-00234PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-15A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-15B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-15C.JPG
UPRRP-FB236F001B5Fin clipsEthanol3608/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B03
GAGTCTATTGATTCGGGCAGAGCTGAGCCAACCTGGGGCCCTTCTAGGGGACGACCAAATTTATAACGTAATWGTTACCGCTCACGCCTTCGTAATAATCTTCTTWATAGTAATGCCAATCATGATTGGAGGCTTCGGGAACTGACTCATCCCCCTAATGATTGGAGCCCCTGACATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTTCTTCCTCCGTCCTTCTTGCTTCTCTTAGCTTCCTCAGGCATTGAGGCTGGTGCCGGAACAGGTTGAACAGTATACCCCCCTCTCTCAGGAAACCTGGCCCATGCGGGTGCTTCAGTAGACCTAACAATTTTCTCTCTTCACTTAGCTGGTATTTCGTCTATCCTGGGGGCTATCAACTTCATCACCACGATTATTAACATGAAACCGCCAGCAATTTCTCAGTACCAGACACCTCTTTTCGTCTGAGCCGTGMTTATTACAGCTGTTCTTCTCCTTCTGTCCCTCCCAGTTCTTTGCTGCCGGCATTACCATGCTATTAACAGACCGAAACCTTAACACAACATTCTTCGATCCAGCTGGAGGTGGTGACCCAATTCTTTACCAGCACTTGTTCTGATTTTT
Malacoctenus triangulatus
2016-07
17
LabridaeThalassomabifasciatumFL0016FL0016MZUPRRP-I-00235PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-16A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-16B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-16C.JPG
UPRRP-FB236F001B6Fin clipsEthanol6808/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B04low quality DNALQ2016-07
18
LabridaeThalassomabifasciatumFL0017FL0017MZUPRRP-I-00236PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-17A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-17B.JPG
UPRRP-FB236F001B7Fin clipsEthanol2308/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B05
GGGCGCATGAGCCGGGATAGTAGGGACAGCCCTAAGCCTGCTCATCCGAGCAGAGTTAAGCCAGCCCGGCGCCCTCCTTGGGGACGATCAGATTTATAACGTTATCGTTACAGCCCACGCATTCGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGGATGAACAATATAAGCTTCTGACTTCTTCCACCCTCATTCCTTCTTCTTCTCGCCTCCTCTGGCGTTGAGGCAGGGGCCGGAACTGGTTGGACAGTCTACCCGCCCCTAGCAGGGAACCTTGCCCATGCTGGTGCATCCGTTGACCTTACTATTTTTTCACTTCACTTGGCAGGGATTTCATCAATTCTAGGTGCAATCAACTTCATCACAACCATTATTAATATGAAACCCCCAGCCATCTCCCAATATCAAACGCCTCTTTTCGTATGGGCTGTTCTCATTACGGCAGTCCTTCTCCTCCTCTCGCTCCCAGTCCTTGCCGCTGGTATTACAATGCTCTTAACAGACCGAAATCTTAACACCACTTTCTTCGACCCTGCTGGAGGGGGGGACCCAATTCTTTACCAACACCTGTTCTGATTCTT
Thalassoma bifasciatum
2016-07
19
LabridaeThalassomabifasciatumFL0018FL0018MZUPRRP-I-00237PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-18A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-18B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-18C.JPG
UPRRP-FB236F001B8Fin clipsEthanol2208/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B06
TAAAGAATTGGGTCCCCCCCTCCAGCAGGGGTCGAAGAAAGTGGTGTTAAGATTTCGGTCTGTTAAGAGCATTGTAATACCAGCGGCAAGGACTGGGAGCGAGAGGAGGAGAAGGGACTGCCGTAATGAGAACAGCCCATACGAAAAGAGGCGTTTGATATTGGGAGATGGCTGGGGGTTTCATATTAATAATGGTTGTGATGAAGTTGATTGCACCTAGAATTGATGAAATCCCTGCCAAGTGAAGTGAAAAAATAGTAAGGTCAACGGATGCACCAGCATGGGCAAGGTTCCCTGCTAGGGGTGGGTAGACTGTCCAACCAGTTCCGGCCCCTGCCTCAACGCCAGAGGAGGCGAGAAGAAGAAGGAATGAGGGTGGAAGAAGTCAGAAGCTTATATTGTTCATCCGAGGGAAGGCCATGTCAGGGGCCCCAATCATTAGGGGAATTAGTCAGTTTCCGAAGCCTCCAATCATAATTGGTATTACTATAAAGAAAATTATGACGAATGCGTGGGCTGTAACGATAACGTTATAAATCTGATCGTCCCCAAGGAGGGCGCCGGGCTGGCTTAACTCTGCTCGGATGAGCAGGCTTAGGGCTGTCCCTACTATCCCGGCTCATGCGCCGAACACAAGATAGAGGGTGCCAATATCTTTATGA
Thalassoma bifasciatum
2016-07
20
LabridaeThalassomabifasciatumFL0019FL0019MZUPRRP-I-00238PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-19A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-19B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-19C.JPG
UPRRP-FB236F001B9Fin clipsEthanol2308/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B07
AAGATATCGGCACCCTCTATCTTGTGTTCGGCGCATGAGCCGGGATAGTAGGGACAGCCCTAAGCCTGCTCATCCGAGCAGAGTTAAGCCAGCCCGGCGCCCTCCTTGGGGACGATCAGATTTATAACGTTATCGTTACAGCCCACGCATTCGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGGATGAACAATATAAGCTTCTGACTTCTTCCACCCTCATTCCTTCTTCTTCTCGCCTCCTCTGGCGTTGAGGCAGGGGCCGGAACTGGTTGGACAGTCTACCCACCCCTAGCAGGGAACCTTGCCCATGCTGGTGCATCCGTTGACCTTACTATTTTTTCACTTCACTTGGCAGGGATTTCATCAATTCTAGGTGCAATCAACTTCATCACAACCATTATTAATATGAAACCCCCAGCCATCTCCCAATATCAAACGCCTCTTTTCGTATGGGCTGTTCTCATTACGGCAGTCCTTCTCCTCCTCTCGCTCCCAGTCCTTGCCGCTGGTATTACGATGCTCTTAACAGACCGAAATCTTAACACCACTTTCTTCGACCCTGCTGGAGGGGGGGACCCAATTCTTTACCAACACCTGTTCTGAT
Thalassoma bifasciatum
2016-07
21
LabridaeThalassomabifasciatumFL0020FL0020MZUPRRP-I-00239PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-20A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-20B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-20C.JPG
UPRRP-FB236F001B10Fin clipsEthanol4708/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B08low quality DNALQ2016-07
22
GobiidaeRisorruberFL0021FL0021MZUPRRP-I-00240PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-21D.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-21B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-21C.JPG
UPRRP-FB236F001C1Fin clipsEthanol2508/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro
Originally identified as Tigrigobius sp. Re-identified as Risor ruber based on CO1 sequence. The photographs match.
7B09
AAAGATATCGGCACCCTCTACTAATCTTCGGTGCATGGGCCGGCATGGTGGGCACAGCGCTTAGCCTTCTAATCCGGGCTGAACTAAGCCAGCCCGGGGCTCTTTTGGGCGATGACCAAATCTATAATGTAATCGTGACCGCTCACGCCTTTGTAATAATCTTTTTTATGGTAATACCAATTATGATCGGAGGCTTTGGTAACTGGCTAATTCCACTAATGATTGGTGCGCCCGATATAGCCTTCCCCCGAATAAATAACATAAGTTTTTGATTACTGCCCCCCTCTTTTCTGCTCCTGCTTGCTTCTTCTGGTGTTGAAGCCGGGGCGGGTACTGGCTGAACCGTTTACCCTCCCCTAGCCGGAAATTTAGCCCATGCCGGGGCATCCGTCGATCTAACCATCTTCTCTCTTCATCTTGCGGGAATCTCATCAATTCTTGGAGCCATTAACTTTATTACAACCATCCTTAACATAAAACCCCCCGCGGTCTCTCAATACCAAACTCCGTTATTTGTGTGGGCTGTTTTAATTACAGCCGTGCTATTACTTCTCTCACTTCCCGTATTAGCCGCTGGCATTACAATACTTCTTACAGACCGAAACCTAAACACTGCTTTCTTCGACCCGGCAGGGGGAGGAGACCCCATCTTATATCAACACCTTTTCTGATTCTT
Risor ruber2016-08
23
LabridaeThalassomabifasciatumFL0022FL0022MZUPRRP-I-00241PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-22A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-22B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-22C.JPG
UPRRP-FB236F001C2Fin clipsEthanol5108/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B10low quality DNALQ2016-07
24
HolocentridaeMyripristisjacobusFL0023FL0023MZUPRRP-I-00242PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-23A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-23B.JPG
UPRRP-FB236F001C3Fin clipsEthanol13208/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B11low quality DNALQ2016-07
25
AcanthuridaeAcanthuruscoeruleusFL0024FL0024MZUPRRP-I-00243PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-24A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-24B.JPG
UPRRP-FB236F001C4Fin clipsEthanol17708/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B12low quality DNALQ2016-07
26
SerranidaeCephalopholisfulvaFL0025FL0025MZUPRRP-I-00244PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-25A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-25B.JPG
UPRRP-FB236F001C5Fin clipsEthanol17508/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7C01
TCAGAATAGGTGTTGGTAAAGGATTGGGTCTCCTCCACCTGCAGGGTCAAAGAAGGTGGTGTTAAGATTTCGGTCTGTTAGAAGCATTGTAATACCGGCGGCAAGGACAGGAAGGGAGAGGAGAAGAAGAACAGCTGTAATTAGGACAGCTCAAACAAATAGGGGTGTTTGATATTGAGAAATGGCAGGAGGTTTCATGTTGATAATTGTGGTAATGAAGTTGATTGCCCCCAGGATTGAGGAAATACCTGCTAAGTGTAGGGAGAAGATAGTTAGGTCAACAGAGGCACCTGCATGGGCTAGGTTACCAGCTAGGGGTGGGTAAACTGTTCAGCCAGTACCAGCACCAGCTTCTACTCCAGAGGAGGCTAGCAGAAGTAGGAAGGATGGTGGAAGGAGCCAGAAGCTTATGTTGTTCATTCGAGGGAATGCCATGTCGGGGGCACCAATTATTAATGGAATAAGTCAGTTTCCGAATCCACCGATCATAATTGGTATTACTATAAAGAAAATTATTACGAAAGCATGTGCCGTAACGATTACATTGTAGATTTGATCGTCGCCGAGTAGGGCACCGGGTTGGCTAATTTCAGCCCGATTAAGAGGCTAAGAGTTGTTCCCACTATACCGGCTCAGGCACCAAATACTAGATAAAGGGGTGCCCATATTCTTTATGATTGGTTGAA
Cephalopholis fulva
2016-07
27
HolocentridaeHolocentrusadscensionisFL0026FL0026MZUPRRP-I-00245PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-26A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-26B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-26C.JPG
UPRRP-FB236F001C6Fin clipsEthanol18308/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7C02low quality DNALQ2016-07
28
AcanthuridaeAcanthuruschirurgusFL0027FL0027MZUPRRP-I-00246PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-27A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-27B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-27C.JPG
UPRRP-FB236F001C7Fin clipsEthanol18008/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7C03low quality DNALQ2016-07
29
LabridaeHalichoerespoeyiFL0028FL0028MZUPRRP-I-00247PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-28A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-28B.JPG
UPRRP-FB236F001C8Fin clipsEthanol13508/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7C04
CACCCTTTATTTAGTATTCGGCGCCTGAGCTGGGATGGTAGGCACGGCCTTAAGCCTGCTTATTCGGGCTGAACTAAGCCAACCCGGCGCTCTCCTTGGGGATGATCAAATCTATAACGTAATCGTTACAGCGCATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGCGGATTCGGAAACTGACTGATTCCTCTAATGATTGGGGCCCCCGACATGGCCTTCCCTCGAATAAATAACATGAGCTTTTGACTTCTCCCTCCCTCATTCCTTCTCCTGCTCGCCTCTTCTGGTGTAGAGGCCGGAGCTGGAACTGGTTGAACAGTCTACCCGCCCCTAGCAGGAAATCTTGCACACGCCGGCGCATCTGTAGACCTAACAATCTTCTCCCTCCACTTAGCCGGTATTTCATCAATTTTAGGGGCCATCAACTTTATTACAACTATTATTAATATGAAGCCTCCCGCTATCTCCCAATACCAGACCCCTCTATTTGTGTGAGCTGTATTAATTACAGCCGTCTTACTTCTTCTGTCTCTCCCCGTTCTCGCTGCCGGAATTACAATGCTTCTGACAGATCGAAAATCTAAACACCACTTTCTTTGACCCTGCACGAGGAGGTGACCCCATTCTATACCAGCATCGATTCTGATATTTTCT
Halichoeres poeyi or Halichoeres garnoti
2016-07
30
AcanthuridaeAcanthurustractusFL0029FL0029MZUPRRP-I-00248PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-29A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-29B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-29C.JPG
UPRRP-FB236F001C9Fin clipsEthanol15608/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spear
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7C05low quality DNALQ2016-07
31
PomacentridaeStegastesplanifronsFL0030FL0030MZUPRRP-I-00249PR-2015-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-03/FL-30A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-03/FL-30B.JPG
UPRRP-FB236F001C10Fin clipsEthanol8808/19-20/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
3-6.7
SCUBA: spear
R.BetancurD.Arcila7C06low quality DNALQ2016-07
32
PomacentridaeMicrospathodonchrysurusFL0031FL0031MZUPRRP-I-00250PR-2015-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-03/FL-31A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-03/FL-31B.JPG
UPRRP-FB236F001D1Fin clipsEthanol11008/19-20/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
3-6.7
SCUBA: spear
R.BetancurD.Arcila7C07
ATCATAAAGATATTGGCACCCTTTATGTAGTATTTGGTGCTTGAGCCGGAATGGTAGGGACAGCCCTAAGCCTTCTCATTCNGGGCGGAACTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTACAATGTTATTGTTACCGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGCTTTGGAAACTGACTCATCCCCCTTATGATTGGAGCCCCCGACATGGCATTCCCCCGAATGAATAATATGAGCTTTTGACTCCTTCCCCCTTCATTCCTCCTTCTACTTGCCTCCTCCGGTGTCGAAGCAGGTGCGGGGACAGGATGAACCGTCTATCCTCCACTATCCGGTAACCTGGCCCACGCAGGAGCCTCTGTAGACCTAACCATCTTTTCTCTCCACCTAGCAGGTATCTCCTCTATCCTGGGAGCAATTAATTTTATTACCACAATTATTAACATGAAACCACCTGCCATCTCTCAATACCAAACCCCTCTCTTCGTATGGGCCGTACTTATTACTGCCGTCCTACTACTTTTATCTCTCCCTGTACTAGCTGCAGGAATTACCATGCTCCTGACCGATCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGAGGAGGTGACCCTATTCTATACCAGCACTTATTCTGATT
Microspathodon chrysurus
2016-07
33
Chaetodontidae
ChaetodoncapistratusFL0032FL0032MZUPRRP-I-00251PR-2015-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-03/FL-32A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-03/FL-32B.JPG
UPRRP-FB236F001D2Fin clipsEthanol7208/19-20/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
3-6.7
SCUBA: spear
R.BetancurD.Arcila7C08low quality DNALQ2016-07
34
PomacanthidaePomacanthusarcuatusFL0033FL0033MZUPRRP-I-00252PR-2015-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-03/FL-33A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-03/FL-33B.JPG
UPRRP-FB236F001D3Fin clipsEthanol18008/19-20/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
3-6.7
SCUBA: spear
R.BetancurD.Arcila7C09low quality DNALQ2016-07
35
LutjanidaeLutjanusapodusFL0034FL0034MZUPRRP-I-00253PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-34A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-34B.JPG
UPRRP-FB236F001D4Pectoral FinEthanol177.48/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: spear
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7C10
GCTCGAGCCGGNATAGTAGGCACAGCCTTAAGCCTGCTCATTCGAGCAGAGCTAAGCCAACCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGGTTCGGAAACTGACTAATCCCATTAATGATCGGAGCCCCCGACATGGCATTCCCCCGAATGAATAACATGAGCTTTTGACTTCTTCCCCCATCCTTCCTACTACTACTCGCCTCCTCTGGAGTAGAAGCCGGTGCCGGAACGGGATGAACAGTTTATCCTCCCTTAGCAGGAAATCTAGCACACGCAGGAGCGTCTGTAGACCTAACCATTTTCTCCCTCCACCTAGCGGGTGTTTCTTCAATTCTAGGGGCCATCAACTTTATTACAACAATCATCAACATGAAACCTCCCGCCATCTCACAATATCAAACACCACTATTCGTTTGAGCCGTCCTAATCACTGCTGTTCTACTTCTTCTGTCCCTTCCCGTACTAGCTGCCGGAATTACAATGCTCCTTACAGATCGAAATCTAAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTCTACCAACACCTATTCTGATT
Lutjanus apodus
2016-07
36
LabridaeSparisomavirideFL0035FL0035MZUPRRP-I-00254PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-35A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-35B.JPG
UPRRP-FB236F001D5Pectoral FinEthanol122.48/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: spear
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7C11low quality DNALQ2016-07
37
PomacentridaeMicrospathodonchrysurusFL0036FL0036MZUPRRP-I-00255PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-36A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-36B.JPG
UPRRP-FB236F001D6Pectoral FinEthanol114.88/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: spear
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero
DNA likely contaminated. Voucher is correctly ID.
7C12
CTTCCCAATATCAGGATTATTTTGGTACCAGAGTAGAGTAGGACGGCCCTAAGCCTCCTATCCGGGCAGAATTAAGCCAACCAGGCGCCCTCCTCGGAGATGATCAAATTTATAATGTAATTGTTACAGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTCGGAAATTGATTAATTCCACTAATAATTGGAGCCCCTGACATAGCATTCCCACGAATAAATAACATAAGCTTTTGACTTTTACCACCATCTTTCCTGCTTCTACTTGCATCCTCTGCAGTAGAATCTGGTGCAGGCACAGGATGAACAGTATACCCCCCTCTAGCCGGTAATCTTGCACATGCAGGAGCATCCGTAGATCTCACTATTTTCTCCCTCCACCTAGCAGGGATTTCTTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCTCCTGCTATTTCCCAATATCAAACTCCCCTGTTTGTATGAGCAGTACTAATTACCGCCGTTCTACTCCTTCTCTCACTTCCTGTTCTCGCTGCTGGAATTACAATACTACTCACAGATCGAAAACCTGAATACCACTTTCTTTGACCCAGCAGGTGGAGGAGACCCCATTTTATATCAAAATTTATTCTGATTCTTCGGTCACGTGATAAGGTATGAAAA
Acanthurus coeruleus
2016-08
38
PomacentridaeAbudefdufsaxatilisFL0037FL0037MZUPRRP-I-00256PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-37A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-37B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-37C.JPG
UPRRP-FB236F001D7Pectoral FinEthanol42.58/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D01low quality DNALQ2016-07
39
PomacentridaeStegastesleucostictusFL0038FL0038MZUPRRP-I-00257PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-38A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-38B.JPG
UPRRP-FB236F001D8
Pectoral and pelvic Fin
Ethanol41.68/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D02low quality DNALQ2016-07
40
PomacentridaeStegastesplanifronsFL0039FL0039MZUPRRP-I-00258PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-39A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-39B.JPG
UPRRP-FB236F001D9
Pectoral and pelvic Fin
Ethanol58.38/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D03low quality DNALQ2016-07
41
PomacentridaeAbudefdufsaxatilisFL0040FL0040MZUPRRP-I-00259PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-40A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-40B.JPG
UPRRP-FB236F001D10
Pectoral and pelvic Fin
Ethanol29.148/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D04
TCAGAATAAATGTTGGTAAAGAATGGGGTCTCCTCCTCCAGCTGGGTCGAAGAATGTGGTATTTAAGTTTCGGTCGGTTAGAAGTATCGTAATTCCAGCGGCTAAAACAGGAAGGGACAGAAGGAGGAGCACGGCCGTGATGAGTACGGCTCATACGAAGAGAGGAGTCTGGTATTGAGAAATAGCTGGAGGTTTCATATTAATAATAGTGGTAATAAAATTAATGGCTCCTAAAATTGAGGACACACCTGCTAAGTGGAGGGAGAAAATAGTTAAGTCAACAGAAGCTCCTGCGTGAGCTAGGTTGCCTGATAGTGGTGGGTAGACAGTTCAGCCTGTTCCTGCACCTGCTTCAACTCCGGAGGAGGCAAGAAGAAGTAGGAACGATGGGGGAAGAAGTCAGAAGCTCATATTGTTCATTCGGGGGAATGCCATATCAGGGGCACCGATCATTAGTGGGATAAGTCAGTTTCCAAACCCTCCAATTATAATTGGTATTACTATAAAGAAAATTATTACAAAGGCATGTGCCGTAACAATTACGTTGTAAATCTGGTCGTCTCCGAGGAGAGCGCCTGGTTGGCTTAGTTCTGCTCGAATAAGGAGGCTCAGGGCTGTTCCTACTATTCCAGCTCAAGCACCAAATACTAGATAGAGGGTGCCAATATCTTTATGATTG
Abudefduf saxatilis
2016-07
42
PomacentridaeMicrospathodonchrysurusFL0041FL0041MZUPRRP-I-00260PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-41A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-41B.JPG
UPRRP-FB236F001E1Pectoral FinEthanol798/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: spear
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D05
CATAAAGATATTGGCACCCTTTATCTAGTATTTGGTGCTGAGCCGGAATGGTAGGGACAGCCCTAAGCCTTCTCATTCGGGCGGAACTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTACAATGTTATTGTTACCGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGCTTTGGAAACTGACTCATCCCCCTTATGATTGGAGCCCCCGACATGGCATTCCCCCGAATGAATAATATGAGCTTTTGACTCCTTCCCCCTTCATTCCTCCTTCTACTTGCCTCCTCCGGTGTCGAAGCAGGTGCGGGGACAGGATGAACCGTCTATCCTCCACTATCCGGTAACCTGGCCCACGCAGGAGCCTCTGTAGACCTAACCATCTTTTCTCTCCACCTAGCAGGTATCTCCTCTATCCTGGGAGCAATTAATTTTATTACCACAATTATTAACATGAAACCACCTGCCATCTCTCAATACCAAACCCCTCTCTTCGTATGGGCCGTACTTATTACTGCCGTCCTACTACTTTTATCTCTCCCTGTACTAGCTGCAGGAATTACCATGCTCCTGACCGATCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGAGGAGGTGACCCTATTCTATACCAGCACTTATTCTGATTCTTC
Microspathodon chrysurus
2016-07
43
ClupeidaeHarengulasp.FL0042FL0042MZUPRRP-I-00261PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-42A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-42B.JPG
UPRRP-FB236F001E2
Pectoral Fin and Caudal muscle
Ethanol41.368/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D06low quality DNALQ2016-07
44
LabridaeScarusiseriFL0043FL0043MZUPRRP-I-00262PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-43A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-43B.JPG
UPRRP-FB236F001E3
Pectoral and pelvic Fin
Ethanol36.438/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero
Originally identified as Scarus sp. Re-identified as Scarus iseri based on CO1 sequence. Juvenile.
7D07
AATCAGAACAGGTGTTGGTAAAGAATCGGGTCTCCTCCGCCTGCAGGGTCAAAGAAAGTAGTGTTTAGATTTCGATCTGTAAGAAGCATTGTAATTCCTGCAGCGAGGACAGGAAGCGAGAGGAGAAGGAGTACGGCAGTAATTAAAACAGCCCATACGAACAGTGGGGTTTGGTACTGGGAGATGGCAGGTGGTTTTATGTTAATAATTGTTGTAATGAAGTTAATTGCCCCTAGGATAGAAGAAATTCCTGCTAGGTGAAGGGAAAAGATTGTCAGATCAACGGATGCACCTGCGTGTGCAAGATTTCCTGCTAGAGGGGGGTAAACGGTTCATCCGGTACCTGCTCCTGCTTCTACGCCAGAGGAGGCGAGTAATAGGAGAAAGGAGGGAGGGAGAAGTCAGAAGCTCATATTGTTCATTCGAGGGAAGGCCATGTCGGGTGCTCCGATCATGAGCGGGATGAGTCAGTTTCCGAAGCCTCCAATCATGATAGGCATGACTATAAAAAAGATTATTACAAATGCATGAGCTGTAACGATAACATTATAAATCTGGTCGTCTCCGAGAAGGGCCCCGGGTTGACTTAATTCAGCTCGGATGAGGAGGCTTAAGGCAGTGCCTACTATTCCGGCTCAGGCACCAAATACAAGGTAAAGGGTGCCAATATCTTTATGATT
Scarus iseri2016-08
45
PomacentridaeAbudefdufsaxatilisFL0044FL0044MZUPRRP-I-00263PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-44A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-44B.JPG
UPRRP-FB236F001E4
Pectoral Fin and Caudal muscle
Ethanol21.068/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D08
ATCAGAATAAATGCTGGTAAAGAATAGGGTCTCCTCCTCCAGCTGGGTCGAAGAATGTGGTGTTTAAGTTTCGGTCGGTTAGAAGTATTGTAATCCCAGCGGCTAAAACAGGAAGGGACAGAAGAAGAAGCACGGCCGTGATAAGTACGGCTCATACGAAAAGAGGAGTCTGGTATTGAGAAATAGCAGGAGGTTTCATATTAATAATAGTAGTGATAAAATTAATGGCTCCTAAAATTGAGGATACACCTGCTAAGTGGAGGGAGAAAATAGTTAAGTCAACAGAAGCTCCTGCGTGAGCTAGGTTGCCTGATAGCGGTGGGTAGACAGTTCAGCCTGTTCCTGCACCTGCTTCAACTCCAGAGGAGGCAAGAAGAAGTAAGAATGACGGAGGAAGAAGTCAGAAGCTCATATTGTTCATTCGGGGGAATGCCATGTCGGGGGCGCCGATCATTAGTGGGATAAGTCAGTTTCCAAACCCTCCGATCATAATTGGTATTACTATAAAGAAAATTATTACAAAGGCATGTGCCGTAACAATTACGTTGTAAATCTGGTCGTCTCCGAGGAGAGCGCCTGGTTGGCTAAGTTCTGCTCGAATAAGGAGGCTCAGGGCTGTTCCTACTATTCCAGCTCAAGCACCAAATACTAGATAGAGGGTGCCAATATCTTTATGA
Abudefduf saxatilis
2016-08
46
ClupeidaeJenkinsiamajuaFL0045FL0045Whole specimen tissuePR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-45A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-45B.JPG
UPRRP-FB236F001E5
Whole specimen
Ethanol25.648/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D09low quality DNALQ2016-07
47
HaemulidaeHaemulonaurolineatumFL0046FL0046MZUPRRP-I-00264PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-46A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-46B.JPG
UPRRP-FB236F001E6Pectoral FinEthanol143.968/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7D10low quality DNALQ2016-07
48
HaemulidaeHaemulonaurolineatumFL0047FL0047MZUPRRP-I-00265PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-47A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-47B.JPG
UPRRP-FB236F001E7Pectoral FinEthanol130.778/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7D11low quality DNALQ2016-07
49
HaemulidaeHaemulonaurolineatumFL0048FL0048MZUPRRP-I-00266PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-48A.JPG
UPRRP-FB236F001E8Pectoral FinEthanol137.88/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7D12low quality DNALQ2016-07
50
HaemulidaeHaemulonaurolineatumFL0049FL0049MZUPRRP-I-00267PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-49A.JPG
UPRRP-FB236F001E9Pectoral FinEthanol130.88/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E01low quality DNALQ2016-07
51
HaemulidaeHaemulonaurolineatumFL0050FL0050MZUPRRP-I-00268PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-50A.JPG
UPRRP-FB236F001E10Pectoral FinEthanol140.28/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E02low quality DNALQ2016-07
52
HaemulidaeHaemulonaurolineatumFL0051FL0051MZUPRRP-I-00269PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-51A.JPG
UPRRP-FB236F001F1Pectoral FinEthanol121.78/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E03low quality DNALQ2016-07
53
HaemulidaeHaemulonaurolineatumFL0052FL0052MZUPRRP-I-00270PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-52A.JPG
UPRRP-FB236F001F2Pectoral FinEthanol127.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E04low quality DNALQ2016-07
54
HaemulidaeHaemulonaurolineatumFL0053FL0053MZUPRRP-I-00271PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-53A.JPG
UPRRP-FB236F001F3Pectoral FinEthanol123.788/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E05low quality DNALQ2016-07
55
HaemulidaeHaemulonaurolineatumFL0054FL0054MZUPRRP-I-00272PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-54A.JPG
UPRRP-FB236F001F4Pectoral FinEthanol125.998/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E06low quality DNALQ2016-07
56
HaemulidaeHaemulonaurolineatumFL0055FL0055MZUPRRP-I-00273PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-55A.JPG
UPRRP-FB236F001F5Pectoral FinEthanol139.868/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E07low quality DNALQ2016-07
57
SerranidaeEpinephelusguttatusFL0056FL0056MZUPRRP-I-00274PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-56A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-56B.JPG
UPRRP-FB236F001F6Pectoral FinEthanol294.38/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E08low quality DNALQ2016-07
58
LabridaeSparisomachrysopterumFL0057FL0057MZUPRRP-I-00275PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-57A.JPG
UPRRP-FB236F001F7Pectoral FinEthanol232.18/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E09low qualityLQ2016-07
59
LabridaeBodianusrufusFL0058FL0058MZUPRRP-I-00276PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-58A.JPG
UPRRP-FB236F001F8Pectoral FinEthanol150.78/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E10low quality DNALQ2016-07
60
LabridaeSparisomavirideFL0059FL0059MZUPRRP-I-00277PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-59A.JPG
UPRRP-FB236F001F9Pectoral FinEthanol269.48/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E11low qualityLQ2016-07
61
LutjanidaeLutjanusgriseusFL0060FL0060MZUPRRP-I-00278PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-60A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-60B.JPG
UPRRP-FB236F001F10Pectoral FinEthanol243.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7E12
TCACAAAGATATCGGCACCCGTTATCTTGTATTCGGTGCTTGAGCCGGAATAGTAGGCACGGCCTTAAGCCTGCTCATTCGAGCAGAACTAAGCCAACCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGATTTGGAAACTGACTGATCCCATTAATGATCGGAGCCCCCGACATGGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCCTTCCCCCATCCTTCCTACTACTACTCGCCTCCTCTGGAGTAGAAGCCGGTGCCGGAACAGGATGAACAGTTTACCCTCCCTTAGCAGGAAATCTAGCACACGCAGGAGCATCTGTCGACCTAACCATTTTCTCCCTCCACTTAGCAGGTGTTTCTTCAATTCTAGGGGCCATCAACTTTATTACAACAATCATCAATATGAAACCCCCTGCCATCTCACAATATCAAACACCACTATTCGTTTGAGCCGTCCTAATCACTGCTGTGCTACTTCTCCTGTCCCTTCCTGTACTAGCTGCCGGAATTACAATGCTCCTTACAGACCGAAATCTAAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTTTATCAACACCTATTCTGATTCTT
Lutjanus griseus
2016-07
62
BalistidaeMelichthysnigerFL0061FL0061MZUPRRP-I-00279PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-61A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-61B.JPG
UPRRP-FB236F001G1Pectoral FinEthanol222.28/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F01low quality DNALQ2016-07
63
HaemulidaeHaemulonsciurusFL0062FL0062MZUPRRP-I-00280PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-62A.JPG
UPRRP-FB236F001G2Pectoral FinEthanol215.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F02low quality DNALQ2016-07
64
SparidaeCalamuspennaFL0063FL0063MZUPRRP-I-00281PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-63A.JPG
UPRRP-FB236F001G3Pectoral FinEthanol8/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F03low quality DNALQ2016-07
65
HaemulidaeAnisotremusvirginicusFL0064FL0064MZUPRRP-I-00282PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-64A.JPG
UPRRP-FB236F001G4Pectoral FinEthanol194.28/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F04low quality DNALQ2016-07
66
LabridaeLachnolaimusmaximusFL0065FL0065MZUPRRP-I-00283PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-65A.JPG
UPRRP-FB236F001G5Pectoral FinEthanol160.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F05low quality DNALQ2016-07
67
LutjanidaeLutjanusapodusFL0066FL0066MZUPRRP-I-00284PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-66A.JPG
UPRRP-FB236F001G6Pectoral FinEthanol221.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F06low quality DNALQ2016-07
68
PomacanthidaeHolacanthusciliarisFL0067FL0067MZUPRRP-I-00285PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-67A.JPG
UPRRP-FB236F001G7Pectoral FinEthanol168.28/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F07
ATCAGAATAAGTGCTGGTAGAGAATCGGATCCCCTCCTCCTGCGGGGTCAAAGAAGGTAGTGTTCAGGTTTCGGTCTGTTAAGAGTATTGTGATACCCGCAGCAAGGACTGGAAGGGAAAGAAGTAGCAGTACTGCAGTAATTAATACTGCTCAGACAAATAGGGGTGTCTGATACTGCGAGATGGCGGGAGGTTTCATGTTGATGATGGTTGTGATAAAGTTAATAGCCCCTAGAATTGAGGAAACCCCAGCTAAATGGAGAGAGAAGATGGTTAAATCTACTGATGCACCTGCATGCGCTAGATTGCCGGCTAGGGGAGGATATACTGTTCATCCAGTCCCGGCTCCGGCCTCAACTCCGGCGGATGCCAGGAGAAGGAGAAGGGAGGGGGGAAGGAGTCAAAAGCTTATGTTGTTCATTCGGGGGAATGCCATATCGGGGGCCCCAATTATTAGGGGAATTAGCCAGTTTCCGAATCCCCCAATTATAGCGGGTATGACCATAAAAAAAATTATTACAAATGCATGTGCTGTGACGATAACATTGTAGATTTGGTCGTCCCCAAGGAGGCTGCCTGGTTGATTTAATTCTGCTCGAATTAGTAGGCTTAAAGCTGTCCCCACTATCCAGCTCAAGC
Holacanthus ciliaris
2016-07
69
LabridaeLachnolaimusmaximusFL0068FL0068MZUPRRP-I-00460PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-68A.JPG
UPRRP-FB236F001G8Pectoral FinEthanol167.78/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F08
TCATAAAGATATTGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGCACAGCCTTGAGCCTTCTCATTCGAGCAGAACTAAGCCAACCAGGCGCCCTTCTAGGGGACGACCAGATTTATAACGTCATTGTTACGGCGCATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTTATCCCACTAATAATTGGAGCCCCTGACATGGCTTTCCCCCGAATAAACAACATAAGCTTTTGACTCCTCCCACCTTCATTTCTTCTCCTCTTGGCATCCTCAGGGGTAGAAGCCGGGGCTGGCACCGGATGAACAGTTTACCCCCCGTTAGCAGGCAATTTAGCCCATGCAGGGGCCTCTGTTGATCTAACCATCTTTTCTCTGCATCTAGCAGGCATTTCTTCAATTCTTGGAGCAATTAATTTTATTACAACCATTATTAATATGAAACCCCCCGCCATCTCCCAATATCAGACCCCGCTGTTTGTTTGGGCAGTTCTAATTACAGCAGTGCTCCTGCTCCTGTCCCTTCCTGTCCTTGCTGCTGGAATTACAATGCTCTTAACAGACCGAAACCTAAACACCACCTTCTTTGACCCCGCAGGAGGGGGAGACCCAATTCTATATCAACACCTCTTCTGA
Lachnolaimus maximus
2016-07
70
MullidaeMulloidichthysmartinicusFL0069FL0069MZUPRRP-I-00286PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-69A.JPG
UPRRP-FB236F001G9Pectoral FinEthanol207.88/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F09low quality DNALQ2016-07
71
OstraciidaeRhinesomustriqueterFL0070FL0070MZUPRRP-I-00287PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-70A.JPG
UPRRP-FB236RFL01F001G10Pectoral FinEthanol162.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F10
AATCATAAAGATATCGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGTATAGTAGGGACAGCCCTAAGCCTACTCATCCGAGCAGAACTGAGCCAACCAGGCGCTCTCCTTGGGGATGATCAGATTTACAATGTTATTGTCACGGCACATGCATTCGTGATAATTTTCTTTATAGTTATACCCATCATAATCGGAGGTTTTGGAAACTGACTAGTCCCATTAATAATTGGGGCCCCCGACATAGCATTTCCCCGAATAAATAACATAAGCTTTTGACTTCTTCCCCCTTCCTTTCTTCTTCTCCTAGCTTCATCAGGAGTTGAAGCAGGGGCAGGAACTGGTTGGACAGTTTACCCGCCCTTAGCAGGAAACCTAGCACACGCGGGAGCATCCGTAGATTTAACTATTTTTTCACTTCATCTAGCGGGAGTCTCCTCAATTCTAGGGGCTATTAATTTTATTACCACCATTATTAACATAAAACCCCCTGCTATCTCTCAATATCAAACCCCCTTATTTGTTTGGGCTGTCTTAATTACCGCCGTTCTTCTCCTCTTATCTCTACCAGTTCTTGCTGCCGGCATCACAATGCTCCTAACAGACCGAAATCTCAACACCACCTTCTTTGACCCAGCAGGAGGCGGAGACCCAATCCTCTACCAACACCTATTCTGATTCTTCG
Rhinesomus triqueter
2016-07
72
HaemulidaeHaemulonflavolineatumFL0071FL0071MZUPRRP-I-00288PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-71A.JPG
UPRRP-FB236RFL01F001H1Pectoral FinEthanol147.88/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F11low quality DNALQ2016-07
73
OstraciidaeRhinesomustriqueterFL0072FL0072MZUPRRP-I-00289PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-72A.JPG
UPRRP-FB236RFL01F001H2Pectoral FinEthanol159.98/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7F12low quality DNALQ2016-07
74
LutjanidaeLutjanusmahogoniFL0073FL0073MZUPRRP-I-00290PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-73A.JPG
UPRRP-FB236RFL01F001H3Pectoral FinEthanol203.18/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G01low quality DNALQ2016-07
75
PomacanthidaeHolacanthustricolorFL0074FL0074MZUPRRP-I-00291PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-74A.JPG
UPRRP-FB236RFL01F001H4Pectoral FinEthanol114.18/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G02low quality DNALQ2016-07
76
OstraciidaeAcanthostracionquadricornisFL0075FL0075MZUPRRP-I-00292PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-75A.JPG
UPRRP-FB236RFL01F001H5Pectoral FinEthanol161.68/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G03low quality DNALQ2016-07
77
HaemulidaeHaemulonaurolineatumFL0076FL0076MZUPRRP-I-00293PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-76A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-76B.JPG
UPRRP-FB236RFL01F001H6Pectoral FinEthanol148.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G04low quality DNALQ2016-07
78
AulostomidaeAulostomusmaculatusFL0077FL0077MZUPRRP-I-00294PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-77A.JPG
UPRRP-FB236RFL01F001H7Pectoral FinEthanol4698/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G05low quality DNALQ2016-07
79
SerranidaeCephalopholiscruentataFL0078FL0078MZUPRRP-I-00295PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-78A.JPG
UPRRP-FB236RFL01F001H8Pectoral FinEthanol216.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G06low quality DNALQ2016-07
80
LabridaeSparisomavirideFL0079FL0079MZUPRRP-I-00296PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-79A.JPG
UPRRP-FB236RFL01F001H9Pectoral FinEthanol8/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G07low quality DNALQ2016-07
81
LutjanidaeLutjanusapodusFL0080FL0080MZUPRRP-I-00297PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-80A.JPG
UPRRP-FB236RFL01F001H10Pectoral FinEthanol239.68/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G08low quality DNALQ2016-07
82
LabridaeLachnolaimusmaximusFL0081FL0081MZUPRRP-I-00298PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-81A.JPG
UPRRP-FB236RFL01F001I1Pectoral FinEthanol203.28/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G09
AAAGATATCGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGCACAGCCTTGAGCCTTCTCATTCGAGCAGAACTAAGCCAACCAGGCGCCCTTCTAGGGGACGACCAGATTTATAACGTCATTGTTACGGCGCATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTTATCCCACTAATAATTGGAGCCCCTGACATGGCTTTCCCCCGAATAAACAACATAAGCTTTTGACTCCTCCCACCTTCATTTCTTCTCCTCTTGGCATCCTCAGGGGTAGAAGCCGGGGCTGGCACCGGATGAACAGTTTACCCCCCGTTAGCAGGCAATTTAGCCCATGCAGGGGCCTCTGTTGATTTAACCATCTTTTCTCTGCATCTAGCAGGCATTTCTTCAATTCTTGGAGCAATTAATTTTATTACAACCATTATTAATATGAAACCCCCTGCCATCTCTCAATATCAGACCCCGCTGTTTGTTTGGGCAGTTCTAATTACAGCAGTGCTCCTGCTCCTGTCCCTTCCTGTCCTTGCTGCTGGAATTACAATGCTCTTAACAGACCGAAACCTAAACACCACCTTCTTCGACCCCGCAGGAGGGGGAGACCCAATTCTATATCAACACCTCTTCTGATTCTT
Lachnolaimus maximus
2016-07
83
HaemulidaeHaemulonsciurusFL0082FL0082MZUPRRP-I-00299PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-82A.JPG
UPRRP-FB236RFL01F001I2Pectoral FinEthanol2018/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G10low quality DNALQ2016-07
84
LutjanidaeLutjanusapodusFL0083FL0083MZUPRRP-I-00300PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-83A.JPG
UPRRP-FB236RFL01F001I3Pectoral FinEthanol197.48/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G11low quality DNALQ2016-07
85
LabridaeLachnolaimusmaximusFL0084FL0084MZUPRRP-I-00301PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-84A.JPG
UPRRP-FB236RFL01F001I4Pectoral FinEthanol195.38/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G12
AATCAGAAGAGGTGTTGATATAGAATTGGGTCTCCCCCTCCTGCGGGGTCGAAGAAGGTGGTGTTTAGGTTTCGGTCTGTTAAGAGCATTGTAATTCCAGCAGCAAGGACAGGAAGGGACAGGAGCAGGAGCACTGCTGTAATTAGAACTGCCCAAACAAACAGCGGGGTCTGATATTGAGAGATGGCAGGGGGTTTCATATTAATAATGGTTGTAATAAAATTAATTGCTCCAAGAATTGAAGAAATGCCTGCTAGATGCAGAGAAAAGATGGTTAGATCAACAGAGGCCCCTGCATGGGCTAAATTGCCTGCTAACGGGGGGTAAACTGTTCATCCGGTGCCAGCCCCGGCTTCTACCCCTGAGGATGCCAAGAGGAGAAGAAATGAAGGTGGGAGGAGTCAAAAGCTTATGTTGTTTATTCGGGGGAAAGCCATGTCAGGGGCTCCAATTATTAGTGGGATAAGTCAGTTTCCAAACCCTCCAATCATAATTGGCATTACTATAAAGAAAATTATTACAAATGCATGCGCCGTAACAATGACGTTATAAATCTGGTCGTCCCCTAGAAGGGCGCCTGGTTGGCTTAGTTCTGCTCGAATGAGAAGGCTCAAGGCTGTGCCCACTATTCCGGCTCAGGCACCAAATACTAGATAAAGGGTGCCAATATCTTTATGAT
Lachnolaimus maximus
2016-07
86
ScorpaenidaePteroisvolitansFL0085FL0085MZUPRRP-I-00302PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-85A.JPG
UPRRP-FB236RFL01F001I5Pectoral FinEthanol194.28/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H01low quality DNALQ2016-07
87
HolocentridaeHolocentrusrufusFL0086FL0086MZUPRRP-I-00303PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-86A.JPG
UPRRP-FB236RFL01F001I6Pectoral FinEthanol187.88/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H02low quality DNALQ2016-07
88
LutjanidaeLutjanusapodusFL0087FL0087MZUPRRP-I-00304PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-87A.JPG
UPRRP-FB236RFL01F001I7Pectoral FinEthanol212.78/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H03
ACATCACAAAAATATTGGCACCCTTTATCTCGTATTCGGTGCTTGAGCCGGAATAGTAGGCACAACMTTAAGCCCTGCTCATTCGAGCAGAGCTAAGCCAACCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGGTTCGGAAACTGACTAATCCCATTAATGATCGGAGCCCCCGACATGGCATTCCCCCGAATGAATAACATGAGCTTTTGACTTCTTCCCCCATCCTTCCTACTACTACTCGCCTCCTCTGGAGTAGAAGCCGGTGCCGGAACGGGATGAACAGTTTATCCTCCCTTAGCAGGAAATCTAGCACACGCAGGAGCGTCTGTAGACCTAACCATTTTCTCCCTCCACCTAGCGGGTGTTTCTTCAATTCTAGGGGCCATCAACTTTATTACAACAATCATCAACATGAAACCTCCCGCCATCTCACAATATCAAACACCACTATTCGTTTGAGCCGTCCTAATCACTGCTGTTCTACTTCTTCTGTCCCTTCCCGTACTAGCTGCCGGAATTACAATGCTCCTTACAGATCGAAATCTAAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTCTACCAACACCTATTCTGATTCTT
Lutjanus apodus
2016-07
89
AcanthuridaeAcanthuruscoeruleusFL0088FL0088MZUPRRP-I-00305PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-88A.JPG
UPRRP-FB236RFL01F001I8Pectoral FinEthanol134.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H04low quality DNALQ2016-07
90
HolocentridaeHolocentrusrufusFL0089FL0089MZUPRRP-I-00306PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-89A.JPG
UPRRP-FB236RFL01F001I9Pectoral FinEthanol1708/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H05low quality DNALQ2016-07
91
HaemulidaeAnisotremusvirginicusFL0090FL0090MZUPRRP-I-00307PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-90A.JPG
UPRRP-FB236RFL01F001I10Pectoral FinEthanol166.98/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H06low quality DNALQ2016-07
92
HolocentridaeHolocentrusrufusFL0091FL0091MZUPRRP-I-00308PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-91A.JPG
UPRRP-FB236RFL01F001J1Pectoral FinEthanol143.38/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H07low quality DNALQ2016-07
93
LabridaeLachnolaimusmaximusFL0092FL0092MZUPRRP-I-00309PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-92A.JPG
UPRRP-FB236RFL01F001J2Pectoral FinEthanol162.28/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H08
GAGGTGTTGATATAGAATTGGGGTCTCCCCCCCCTGCGGGGGTCGAAGAAGGTGGTGTTTAGGTTTCGGTCTGTTAATGAGCATTGTAATTCCAGCAGCAAGGACAGGAAGGGACAGGAGCAGGAGCACTGCTGTAATTAGAACTGCCCAAACAAACAGCGGGGTCTGATATTGAGAGATGGCAGGGGGTTTCATATTAATAATGGTTGTAATAAAATTAATTGCTCCAAGAATTGAAGAAATGCCTGCTAGATGCAGAGAAAAGATGGTTAGATCAACAGAGGCCCCTGCATGGGCTAAATTGCCTGCTAACGGGGGGTAAACTGTTCATCCGGTGCCAGCCCCGGCTTCTACCCCTGAGGATGCCAAGAGGAGAAGAAATGAAGGTGGGAGGAGTCAAAAGCTTATGTTGTTTATTCGGGGGAAAGCCATGTCAGGGGCTCCAATTATTAGTGGGATAAGTCAGTTTCCAAACCCTCCAATCATAATTGGCATTACTATAAAGAAAATTATTACAAATGCATGCGCCGTAACAATGACGTTATAAATCTGGTCGTCCCCTAGAAGGGCGCCTGGTTGGCTTAGTTCTGCTCGAATGAGAAGGCTCAGGCTGTGCCCACTATTCCGGCTCAGGCACCAATACTATATAAAGGGTGCC
Lachnolaimus maximus
2016-07
94
HolocentridaeHolocentrusrufusFL0093FL0093MZUPRRP-I-00310PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-93A.JPG
UPRRP-FB236RFL01F001J3Pectoral FinEthanol1708/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H09low quality DNALQ2016-07
95
AcanthuridaeAcanthurustractusFL0094FL0094MZUPRRP-I-00311PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-94A.JPG
UPRRP-FB236RFL01F001J4Pectoral FinEthanol141.68/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7H10low quality DNALQ2016-07
96
PomacanthidaeHolacanthusciliarisFL0095FL0095MZUPRRP-I-00312PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-95A.JPG
UPRRP-FB236RFL01F001J5Pectoral FinEthanol237.38/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
6A01
TTTGTTATAATTTTTTTTATGGTCATACCCGCTATAATTGGGGGGTTCGGAAACTGGCTAATTCCCCTAATAATTGGGGCCCCCGATATGGCATTCCCCCGAATGAACAACATAAGCTTTTGACTCCTTCCCCCCTCCCTTCTCCTTCTCCTAGCATCCGCCGGAGTTGAGGCCGGAGCCGGGACTGGATGAACAGTATATCCTCCCCTAGCCGGCAATCTAGCGCATGCAGGTGCATCAGTAGATTTAACCATCTTCTCTCTCCATTTAGCTGGGGTTTCCTCAATTCTAGGGGCTATTAACTTTATCACAACCATTCATCAACATGAAACCTCCCGCCATCTCGCAGTATCAGACACCCCTATTTGTCTGAGCAGTATTAATTTACTGCAGTACTGCTACTTCTTTTCCCTTCCAGTCCTTGCTGCGGGTATCACAATACTCTTAACAGACCGAAACCTGAACACTACCTTCTTTTGACCCCGCAGGAGGAGGGGATCCGATTCTCTACCAGCACTTATTCTGATTCTTTGGCCACCCAGAAGTTGAAA
Holacanthus ciliaris or Holacanthus sp. or Holacanthus bermudensis forward only
2016-07
97
LabridaeSparisomachrysopterumFL0096FL0096MZUPRRP-I-00313PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-96A.JPG
UPRRP-FB236RFL01F001J6Pectoral FinEthanol238.78/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
6A02low qualityLQ2016-07
98
LabridaeSparisomachrysopterumFL0097FL0097MZUPRRP-I-00314PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-97A.JPG
UPRRP-FB236RFL01F001J7Pectoral FinEthanol250.98/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
6A03low qualityLQ2016-07
99
PomacentridaeStegastesdiencaeusFL0098FL0098MZUPRRP-I-00315PR-2015-07
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-07/FL-98A.JPG
UPRRP-FB236RFL01F001J8Pectoral FinEthanol62.59/1/2015Puerto RicoPuerto RicoGuanicaEl Matal Seco
Western Atlantic
Morning17°54.292 N66°57.549 W
http://www.google.com/maps/place/17°54.292 N66°57.549 W/data=!3m1!1e3
10Sand and rocks
SCUBA: clove oil
C.PedrazaR.Rivero
Fisherman
Originally identified as Stegastes sp. Re-identified as Stegastes diencaeus based on CO1 sequence.
6A04
AGTATTTGGTGCCTGAGCCGGAATGGTAGGGAACAGATTAAGTCTCCTCATTTGGGCAGAAATAAACCAACCCGGGCGCTTTCCTTGGAGASGACCANAATTTATAATGTAATTGCTMCGGCGCACGCCTTCRTAATAATCTTCTTTATAGTAATACCCATCATAATCGGAGGATTCGGAAACAGGCTTATCCCCCTGATGATTGGGGCCCCTGATATGGCCTTCCCCCGTATAAACAATATAAGCGTYTGACTTCTTCCTCCTTCCTTCCTTCTTCTGCTTGCCTCTTCAGGKGTAGAAGCAGGGGCAGGAACAGGATGAACAGTCTATCCTCCACTATCTGGTAACCTAGCTCACGCAGGGGCCTCCGTTGACCTAACTATTTTCTCCCTACATTTAGCAGGAATTTCATCCATCCTAGGGGCAATCAACTTTATTACTACTATTATTAACATGAAACCCCCTTCWATCTCCCAATACCAAACCCCTCTCTTTGTATGAGCAGTTCTAATTACCGCTGTASKRYTACTCCTCTCCCTTMCCGTCTTAKCTGCYGGYATTACTATGCTCCTTTACGGACCGAAAACCTTTAATACTTACTTTCTTTGATCCTGCAGGAGGAGGAGACCCCAATCCTTTACCAACACCTTTTTCTGATT
Stegastes diencaeus
2016-08
100
CirrhitidaeAmblycirrhituspinosFL0099FL0099MZUPRRP-I-00316PR-2015-07
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-07/FL-99A.JPG
UPRRP-FB236RFL01F001J9Pectoral FinEthanol40.89/1/2015Puerto RicoPuerto RicoGuanicaEl Matal Seco
Western Atlantic
Morning17°54.292 N66°57.549 W
http://www.google.com/maps/place/17°54.292 N66°57.549 W/data=!3m1!1e3
10Sand and rocks
SCUBA: clove oil
C.PedrazaR.Rivero
Fisherman
6A05
GGCACCCTTTACCTAGTATTTGGTGCCTGAGCTGGTATAGTCGGCACGGCTCTTAGCCTTCTTATTCGGGCGGAGCTAAGCCAACCAGGTGCCCTTCTCGGGGACGACCAGATTTACAATGTTATCGTTACTGCGCACGCATTTGTTATAATTTTCTTCATAGTTATGCCAATTATAATTGGAGGCTTCGGGAACTGACTAATTCCTTTAATAATTGGAGCCCCGGACATGGCCTTCCCCCGAATAAATAACATAAGCTTCTGGCTTCTCCCCCCTTCCTTCCTTCTTCTCCTTGCATCTTCTGGCATTGAAGCCGGGGCAGGAACCGGATGGACAGTTTACCCACCTCTAGCGGGCAATCTAGCCCATGCAGGTGCATCAGTTGATCTTACCATCTTCTCGCTACATTTAGCAGGTATCTCCTCTATTTTAGGGGCTATTAACTTTATTACAACTATTATTAATATAAAACCTCCTGCTATTTCCCAATACCAGACCCCTCTGTTCGTATGAGCAGTATTAATTACTGCTGTTCTTCTTCTCCTCTCCCTCCCTGTTCTTGCTGCCGGGATTACAATGCTCTTAACAGACCGAAACCTAAACACCACCTTCTTCNGACCCTGCAGGTGGGGGAGATCCCATTCTTTACCAACACCTATTTTGATTTT
Oxycirrhites typus or Amblycirrhitus earnshawi or Amblycirrhitus pinos
2016-07
Loading...
 
 
 
FL
RB
CoF
Hypoplec