ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAW
1
FamilyGenusSpecific EpitethTissue No.Tissue IDCollection No./VoucherLocality Field No.Photo 1Photo 2Photo 3Photo 4Tissue LocationRack No.Tissue Box No.Plate wellTissue TypePreservation Method
Standard/Total Lenght (mm)
DateCountryState/ProvinceCityLocalityBasinTimeLatitudeLongitudeShow on map
Maximum depth (meters)
Habitat
Collection method
Collector first name 1
Collector last name 1
Collector first name 2
Collector last name 2
Collector first name 3
Collector last name 3
Collector first name 4
Collector last name 4
Collector first name5
Collector last name5
Collector first name6
Collector last name6
RemarksExtraction plateExtract wellCO1 sequence
BOLD ID (closest match)
Date of BOLD ID
2
AcanthuridaeAcanthuruscoeruleusFL0002FL0002MZUPRRP-I-00221PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-2A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-2B.JPG
OU-RH116RFL01F001A2Fin clipsEthanol182.408/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western AtlanticMorning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spearR.BetancurC.PedrazaR.RiveroE.Ribeiro7A02low quality DNALQ2016-07
3
AcanthuridaeAcanthurustractusFL0006FL0006MZUPRRP-I-00225PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-6A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-6B.JPG
OU-RH116RFL01F001A6Fin clipsEthanol161.508/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western AtlanticMorning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spearR.BetancurC.PedrazaR.RiveroE.Ribeiro7A06low quality DNALQ2016-07
4
AcanthuridaeAcanthurustractusFL0009FL0009MZUPRRP-I-00228PR-2015-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-9A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-01/FL-9B.JPG
OU-RH116RFL01F001A9Fin clipsEthanol15208/09/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western AtlanticMorning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spearR.BetancurC.PedrazaR.RiveroE.Ribeiro7A09low quality DNALQ2016-07
5
AcanthuridaeAcanthuruscoeruleusFL0024FL0024MZUPRRP-I-00243PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-24A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-24B.JPG
OU-RH116RFL01F001C4Fin clipsEthanol17708/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western AtlanticMorning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spearR.BetancurC.PedrazaD.ArcilaE.Ribeiro7B12low quality DNALQ2016-07
6
AcanthuridaeAcanthuruschirurgusFL0027FL0027MZUPRRP-I-00246PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-27A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-27B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-27C.JPG
OU-RH116RFL01F001C7Fin clipsEthanol18008/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western AtlanticMorning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spearR.BetancurC.PedrazaD.ArcilaE.Ribeiro7C03low quality DNALQ2016-07
7
AcanthuridaeAcanthurustractusFL0029FL0029MZUPRRP-I-00248PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-29A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-29B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-29C.JPG
OU-RH116RFL01F001C9Fin clipsEthanol15608/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western AtlanticMorning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: spearR.BetancurC.PedrazaD.ArcilaE.Ribeiro7C05low quality DNALQ2016-07
8
AcanthuridaeAcanthuruscoeruleusFL0088FL0088MZUPRRP-I-00305PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-88A.JPG
OU-RH116RFL01F001I8Pectoral FinEthanol134.58/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western AtlanticMorning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spearE.Ribeiro
Fisherman
7H04low quality DNALQ2016-07
9
AcanthuridaeAcanthurustractusFL0094FL0094MZUPRRP-I-00311PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-94A.JPG
OU-RH116RFL01F001J4Pectoral FinEthanol141.68/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western AtlanticMorning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spearE.Ribeiro
Fisherman
7H10low quality DNALQ2016-07
10
AcanthuridaeAcanthurustractusFL0169FL0169MZUPRRP-I-00360PR-2015-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-10/FL-169A.JPG
OU-RH116RFL01F002G9
Pectoral and pelvic Fin
Ethanol899/26/2015Puerto RicoPuerto RicoManati
Five minutes west of Los Tubos
Western AtlanticMorning18.469144° N66.462497° W
http://www.google.com/maps/place/18.469144° N66.462497° W/data=!3m1!1e3
19ReefSCUBA: spearR.BetancurD.ArcilaC.PedrazaR.Rivero
A. tractus is the correct name for the Caribbean species in the C. bahianus group.
6G03
AAAGATATCGGCACCCTTTATTTAGTATTCGGTGCTTGAGCTGGGATAGTAGGAACGGCTTTAAGTCTTCTAATCCGAGCAGAATTAAGTCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGATTTGGAAATTGATTAATTCCACTAATGATTGGAGCCCCTGACATAGCATTTCCACGAATGAATAATATGAGCTTTTGACTCTTGCCACCATCCTTCCTACTTCTACTTGCATCCTCTGCAGTAGAGTCTGGTGCTGGTACAGGATGAACAGTTTATCCCCCTTTAGCTGGTAATCTGGCACACGCAGGAGCATCTGTAGACCTGACTATTTTTTCCCTTCACCTTGCAGGTATTTCCTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCCCCCGCTACTTCCCAATATCAAACCCCTCTATTTGTATGAGCAGTATTAATTACTGCTGTTTTACTTCTTCTCTCACTTCCTGTCCTTGCTGCTGGTATTACAATACTACTCACAGACCGAAATTTAAACACTACCTTCTTTGATCCGGCAGGCGGAGGAGATCCTATTCTGTATCAGCACTTATTCTGATTCTTTG
Acanthurus bahianus or Acanthurus tractus
2016-07
11
AcanthuridaeAcanthurustractusFL0200FL0200MZUPRRP-I-00387PR-2015-13
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-200A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-200B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-200C.JPG
OU-RH116RFL01F002J10
Pectoral and pelvic Fin
Ethanol39.8410/26/2015Puerto RicoPuerto RicoLajas
Media Luna, La Parguera
Western AtlanticMorning17.93948° N67.05071° W
http://www.google.com/maps/place/17.93948° N67.05071° W/data=!3m1!1e3
6.1Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro9A12
12
AcanthuridaeAcanthuruscoeruleusFL0212FL0212MZUPRRP-I-00393PR-2015-14
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-14/FL-212A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-14/FL-212B.JPG
OU-RH116RFL01F003B2
Pectoral and pelvic Fin
Ethanol26.5510/26/2015Puerto RicoPuerto RicoLajas
El Mario, La Parguera
Western AtlanticMorning17.95282° N67.05645° W
http://www.google.com/maps/place/17.95282° N67.05645° W/data=!3m1!1e3
4.9Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro9B12
13
AcanthuridaeAcanthuruscoeruleusFL0217FL0217MZUPRRP-I-00397PR-2015-14
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-14/FL-217A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-14/FL-217B.JPG
OU-RH116RFL01F003B7
Pectoral and pelvic Fin
Ethanol33.1510/26/2015Puerto RicoPuerto RicoLajas
El Mario, La Parguera
Western AtlanticMorning17.95282° N67.05645° W
http://www.google.com/maps/place/17.95282° N67.05645° W/data=!3m1!1e3
4.9Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro9C05
14
AcanthuridaeAcanthuruschirurgusFL0288FL0288MZUPRRP-I-00464PR-2015-18
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-18/FL-288A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-18/FL-288B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-18/FL-288C.JPG
OU-RH116RFL01F003I8Pectoral FinEthanol112.712/6/2015Puerto RicoPuerto RicoLajas
Magueyes, La Parguera
Western AtlanticMorning17.97004° N67.04643° W
http://www.google.com/maps/place/17.97004° N67.04643° W/data=!3m1!1e3
2
Mangrove and sea grass
Seine netR.BetancurD.ArcilaE.RibeiroR.Rivero8A06
15
AcanthuridaeAcanthuruschirurgusFL0308FL0308MZUPRRP-I-00483PR-2015-20
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-20/FL-308A.JPG
OU-RH116RFL01F004A8Pectoral FinEthanol16212/7/2015Puerto RicoPuerto RicoLajas
Media Luna, La Parguera
Western AtlanticMorning17.93906° N67.05126° W
http://www.google.com/maps/place/17.93906° N67.05126° W/data=!3m1!1e3
2.4-8.2ReefSCUBA: spearR.BetancurD.ArcilaE.RibeiroR.Rivero8C02
16
AcanthuridaeAcanthurustractusFL0343FL0343MZUPRRP-I-00515PR-2016-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-03/FL-343A.JPG
OU-RH116RFL01F004E3Pectoral FinEthanol133.72/5/2016Puerto RicoPuerto RicoLajas
El Mario, La Parguera
Western AtlanticMorning17.95286° N67.05643° W
http://www.google.com/maps/place/17.95286° N67.05643° W/data=!3m1!1e3
5SCUBA: spearR.BetancurD.ArcilaE.RibeiroC.Pedraza8F01
17
AcanthuridaeAcanthurustractusFL0476FL0476MZUPRRP-I-00605PR-2016-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-476A.JPG
OU-RH116RFL01F005H6Pectoral FinEthanol1064/8/16Puerto RicoPuerto RicoAguadillaCrashboatWestern AtlanticMorning 18° 27.462'N 67° 9.834'W
http://www.google.com/maps/place/ 18° 27.462'N 67° 9.834'W/data=!3m1!1e3
8SCUBA: spearR.BetancurD.ArcilaE.RibeiroC.Pedraza
18
AcanthuridaeAcanthurustractusFL0481FL0481MZUPRRP-I-00610PR-2016-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-481A.JPG
OU-RH116RFL01F005I1Pectoral FinEthanol1454/8/16Puerto RicoPuerto RicoAguadillaCrashboatWestern AtlanticMorning 18° 27.462'N 67° 9.834'W
http://www.google.com/maps/place/ 18° 27.462'N 67° 9.834'W/data=!3m1!1e3
8SCUBA: spearR.BetancurD.ArcilaE.RibeiroC.Pedraza
19
AcanthuridaeAcanthuruscoeruleusFL0896FL0896INVEMAR-PEC-9583CO-2016-15
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-896A.JPG
U. Nacional de Colombia
RFL01F009J6
Pectoral and pelvic Fin
Ethanol296/8/16Colombia
San Andres & Providencia
San Andres
Shore dive near Nirvana (el velerito)
Western AtlanticMorning12.49972 N81.73233 W
http://www.google.com/maps/place/12.49972 N81.73233 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
20
AcanthuridaeAcanthuruscoeruleusFL1123FL1123MZUPRRP-I-00714PR-2016-17
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-17/FL-1123A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-17/FL-1123B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-17/FL-1123C.JPG
OU-RH116RFL01F012C3Pectoral FinEthanol1856/23/2016Puerto RicoPuerto RicoAguadilla
Crash boat beach
Western AtlanticMorning18° 27.463 N67° 9.839 W
http://www.google.com/maps/place/18° 27.463 N67° 9.839 W/data=!3m1!1e3
7ReefSCUBA: spearR.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaG.Orti
21
AcanthuridaeAcanthurusnigricansFL1318FL1318CPUM-12615MX-2016-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1318A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1318B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1318C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1318D.JPG
OU-RH116RFL01F014B9Pectoral finEthanol11112/10/2016MexicoGuerreroZihuatanejo
La Caleta de Chon
Eastern PacificAfternoon17° 36.940'N101° 33.262'W
http://www.google.com/maps/place/17° 36.940'N101° 33.262'W/data=!3m1!1e3
12Rocky reefSCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL02A02
22
AcanthuridaeAcanthurusnigricansFL1366FL1366CPUM-13008MX-2016-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-04/FL-1366A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-04/FL-1366B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-04/FL-1366C.JPG
OU-RH116RFL01F014G7Pectoral finEthanol12212/11/2016MexicoGuerreroZihuatanejoManzanilloEastern PacificAfternoon17.61980° N101.52396° W
http://www.google.com/maps/place/17.61980° N101.52396° W/data=!3m1!1e3
10Rocky reefSCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL02E02
23
AcanthuridaeAcanthurusxanthopterusFL1367FL1367CPUM-13006MX-2016-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-04/FL-1367A.JPG
OU-RH116RFL01F014G8Pectoral finEthanol14312/11/2016MexicoGuerreroZihuatanejoManzanilloEastern PacificAfternoon17.61980° N101.52396° W
http://www.google.com/maps/place/17.61980° N101.52396° W/data=!3m1!1e3
10Rocky reefSCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL02E03
24
AcanthuridaePrionuruspunctatusFL1415FL1415CPUM-12951MX-2016-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1415A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1415B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1415C.JPG
OU-RH116RFL01F015B6Pectoral finEthanol9512/12/2016MexicoGuerreroZihuatanejo
Morros de Potosi
Eastern PacificMorning17.53309° N101.48900° W
http://www.google.com/maps/place/17.53309° N101.48900° W/data=!3m1!1e3
15Rocky reefSCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL03A05
25
AcanthuridaeAcanthurusnigricansFL1435FL1435CPUM-12927MX-2016-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1435A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1435B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1435C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1435D.JPG
OU-RH116RFL01F015D6Pectoral finEthanol8212/12/2016MexicoGuerreroZihuatanejo
Morros de Potosi
Eastern PacificMorning17.53309° N101.48900° W
http://www.google.com/maps/place/17.53309° N101.48900° W/data=!3m1!1e3
15Rocky reefSCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL03C01
26
AcanthuridaePrionuruspunctatusFL1543FL1543Photo voucher onlyMX-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1543A.JPG
OU-RH116RFL02F016E4Pectoral finEthanol20512/15-17/2016MexicoMichoacanAquila
La Manzanillera; ship wreck at Faro de Bucerias
Eastern Pacific
Morning, afternoon
18.35276° N103.52207° W
http://www.google.com/maps/place/18.35276° N103.52207° W/data=!3m1!1e3
20
Rocky reef (ship wreck)
SCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.Dominguez et al. (research team)MX-2016-PL04D03
27
AcanthuridaePrionuruspunctatusFL1545FL1545CPUM-12960MX-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1545A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1545B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1545C.JPG
OU-RH116RFL02F016E6Pectoral finEthanol23012/15-17/2016MexicoMichoacanAquila
La Manzanillera; ship wreck at Faro de Bucerias
Eastern Pacific
Morning, afternoon
18.35276° N103.52207° W
http://www.google.com/maps/place/18.35276° N103.52207° W/data=!3m1!1e3
20
Rocky reef (ship wreck)
SCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.Dominguez et al. (research team)MX-2016-PL04D05
28
AcanthuridaeAcanthurusnigricansFL1567FL1567CPUM-12993MX-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1567A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1567B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1567C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1567D.JPG
OU-RH116RFL02F016G8Pectoral finEthanol11912/15-17/2016MexicoMichoacanAquila
La Manzanillera; ship wreck at Faro de Bucerias
Eastern Pacific
Morning, afternoon
18.35276° N103.52207° W
http://www.google.com/maps/place/18.35276° N103.52207° W/data=!3m1!1e3
20
Rocky reef (ship wreck)
SCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.Dominguez et al. (research team)MX-2016-PL04F03
29
AcanthuridaeAcanthurustriostegusFL1658FL1658Universidad de los AndesCO-2017-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1658A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1658B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1658C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1658D.JPG
Universidad de los Andes
RFL02F017F9Pectoral finEthanol401/23/2017ColombiaChocoNuqui
Playa Parguera, Cabo Corrientes
Eastern PacificAfternoon5.599140° N77.494697° W
http://www.google.com/maps/place/5.599140° N77.494697° W/data=!3m1!1e3
1Tide poolsClove oilR.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01A03
30
AcanthuridaeAcanthurustriostegusFL1666FL1666Universidad de los AndesCO-2017-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1666A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1666B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1666C.JPG
Universidad de los Andes
RFL02F017G7Pectoral finEthanol371/23/2017ColombiaChocoNuqui
Playa Parguera, Cabo Corrientes
Eastern PacificAfternoon5.599140° N77.494697° W
http://www.google.com/maps/place/5.599140° N77.494697° W/data=!3m1!1e3
1Tide poolsClove oilR.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01A11
31
AcanthuridaePrionuruslaticlaviusFL1681FL1681Photo voucher onlyCO-2017-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-03/FL-1681A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-03/FL-1681B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-03/FL-1681C.JPG
Universidad de los Andes
RFL02F017I2Pectoral finEthanol2901/24/2017ColombiaChocoNuqui
La Ronosa, Cabo Corrientes
Eastern PacificMorning5.58628° N77.50771° W
http://www.google.com/maps/place/5.58628° N77.50771° W/data=!3m1!1e3
10Rocky reefSCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01C02
32
AcanthuridaeAcanthurusxanthopterusFL1729FL1729Photo voucher onlyCO-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1729A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1729B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1729C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1729D.JPG
Universidad de los Andes
RFL02F018C10Pectoral finEthanol1521/24,29/2017ColombiaChocoNuqui
Piedra Wacha near Playa Parguera, Cabo Corrientes
Eastern PacificMorning5.60546° N77.49783° W
http://www.google.com/maps/place/5.60546° N77.49783° W/data=!3m1!1e3
15Rocky reefSCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01G02
33
AcanthuridaeAcanthurusxanthopterusFL1775FL1775Photo voucher onlyCO-2016-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-06/FL-1775A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-06/FL-1775B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-06/FL-1775C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-06/FL-1775D.JPG
Universidad de los Andes
RFL02F018H6Pectoral finEthanol2951/26/2017ColombiaChocoNuqui
Parguera, Cabo Corrientes
Eastern PacificMorning5.60984° N77.50069° W
http://www.google.com/maps/place/5.60984° N77.50069° W/data=!3m1!1e3
15Rocky reefSCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL02C02
34
AcanthuridaePrionuruslaticlaviusFL1905FL1905CPUM-XXX (UMSNH voucher 50531)GA-2017-PM01
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM01/FL-1905A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM01/FL-1905B.JPG
UMSNHRFL02F020A6Pectoral finEthanol2352/9/17Ecuador
Provincia de Galapagos
Marchena IslandIslote EspejoEastern PacificMorning0.31283° N90.40129° W
http://www.google.com/maps/place/0.31283° N90.40129° W/data=!3m1!1e3
8
Rocky reef and sandy bottom
SCUBA: spearD.ArcilaO.
Dominguez et al. (research team)
GA-2017-PL02A11
35
AcanthuridaeAcanthurusnigricansFL1924FL1924CPUM-XXX (UMSNH voucher 50564)GA-2017-PM03
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1924A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1924B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1924C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1924D.JPG
UMSNHRFL02F020C5Pectoral finEthanol2162/10/17Ecuador
Provincia de Galapagos
Pinta IslandPunta NerusEastern PacificAfternoon0.62766° N90.754125° W
http://www.google.com/maps/place/0.62766° N90.754125° W/data=!3m1!1e3
13
Rocky reef and sandy bottom
SCUBA: spearD.ArcilaO.
Dominguez et al. (research team)
GA-2017-PL02C06
36
AcanthuridaePrionuruslaticlaviusFL2015FL2015Photo voucher only (UMSNH tissue 49753)GA-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-02/FL-2015A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-02/FL-2015B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-02/FL-2015C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-02/FL-2015D.JPG
UMSNHRFL02F021B6Pectoral finEthanol2402/8/2017Ecuador
Provincia de Galapagos
Baltra Island (nearby)
Gordon RocksEastern PacificMorning0° 33.992'S90° 8.600'W
http://www.google.com/maps/place/0° 33.992'S90° 8.600'W/data=!3m1!1e3
15Rocky reefSCUBA: spearR.RiveroO.
Dominguez et al. (research team)
GA-2017-PL01B09
37
AcanthuridaeAcanthurusnigricansFL2046FL2046Photo voucher only (UMSNH tissue 47824)GA-2017-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-04/FL-2046A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-04/FL-2046B.JPG
UMSNHRFL02F021E7Pectoral finEthanol1802/8/2017Ecuador
Provincia de Galapagos
Baltra Island (nearby)
Canal at Seymour North Island
Eastern PacificAfternoon0° 24.057'S90° 17.412'W
http://www.google.com/maps/place/0° 24.057'S90° 17.412'W/data=!3m1!1e3
12Rocky reefSCUBA: spearR.RiveroO.
Dominguez et al. (research team)
GA-2017-PL01E04
38
AcanthuridaePrionuruslaticlaviusFL2098FL2098Photo voucher only (UMSNH tissue 47860)GA-2017-DW01
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW01/FL-2098A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW01/FL-2098B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW01/FL-2098C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW01/FL-2098D.JPG
UMSNHRFL02F021J9Pectoral finEthanol2252/11/2017Ecuador
Provincia de Galapagos
Genovesa IslandTip of islandEastern PacificAfternoon0.300094° N89.95382° W
http://www.google.com/maps/place/0.300094° N89.95382° W/data=!3m1!1e3
10Rocky reefSCUBA: spearR.BetancurE.RibeiroC.PedrazaO.
Dominguez et al. (research team)
GA-2017-PL03A08
39
AcanthuridaeAcanthurusnigricansFL2105FL2105Photo voucher only (UMSNH tissue 47856)GA-2017-DW01
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW01/FL-2105A.JPG
UMSNHRFL02F022A6Pectoral finEthanol1992/11/2017Ecuador
Provincia de Galapagos
Genovesa IslandTip of islandEastern PacificAfternoon0.300094° N89.95382° W
http://www.google.com/maps/place/0.300094° N89.95382° W/data=!3m1!1e3
10Rocky reefSCUBA: spearR.BetancurE.RibeiroC.PedrazaO.
Dominguez et al. (research team)
GA-2017-PL03B03
40
AcanthuridaeAcanthurusxanthopterusFL2281FL2281Photo voucher onlyTA-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2281A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2281B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2281C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2281D.JPG
OU-RH116RFL02F023I2Pectoral finEthanol27011/10/2017
French Polynesia
Tahiti Is.Papeete
Fish market (likely collected at Tuamotu Archipelago)
Indo-PacificMorningN/AN/AN/AR.BetancurD.Arcila
41
AcanthuridaeNasobrevirostrisFL2285FL2285Photo voucher onlyTA-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2285A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2285B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2285C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2285D.JPG
OU-RH116RFL02F023I6Pectoral finEthanol34011/10/2017
French Polynesia
Tahiti Is.Papeete
Fish market (likely collected at Tuamotu Archipelago)
Indo-PacificMorningN/AN/AN/AR.BetancurD.Arcila
42
AcanthuridaeNasolituratusFL2290FL2290Photo voucher onlyTA-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2290A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2290B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2290C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/TA-2017-02/FL-2290D.JPG
OU-RH116RFL02F023J1Pectoral finEthanol24011/10/2017
French Polynesia
Tahiti Is.Papeete
Fish market (likely collected at Tuamotu Archipelago)
Indo-PacificMorningN/AN/AN/AR.BetancurD.Arcila
43
AcanthuridaeAcanthurustractusFL2534FL2534at Magueyes Lab - waiting to be processedPR02-2022-10FernandoTBDMuscle & organsFlash-frozen tissue21.210/26/2022Puerto RicoPuerto RicoGuanica
Reef Near Arrecife Baul
Western AtlanticMorning17.920707° N66.962679° W
https://www.google.com/maps/place/17%C2%B055'14.6%22N+66%C2%B057'45.6%22W/@17.9207222,-66.9626667,1100m/data=!3m2!1e3!4b1!4m4!3m3!8m2!3d17.9207222!4d-66.9626667
13Coral reef
SCUBA: hawaiian sling
C.PedrazaM.GonzalezD.ToledoF.Melendez
44
AcanthuridaeAcanthuruschirurgusFL2538FL2538at FishLab at the University of OklahomaRFL02F026TBDMuscle & eyes
Ethanol and Flash-frozen tissue
12001/29/2023United StatesFloridaFlorida KeysWestern AtlanticMorning24°59.564 N80°25.753 W
https://www.google.com/maps/place/24%C2%B059'33.8%22N+80%C2%B025'45.2%22W/@24.9927333,-80.5671037,11z/data=!4m5!3m4!1s0x0:0xa58b320227944db0!8m2!3d24.9927333!4d-80.4292167
Hand netP.Rauch
45
AchiridaeAchiruslineatusFL1648FL1648Photo voucher onlyBR-2017-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/BR-2017-01/FL-1648A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/BR-2017-01/FL-1648B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/BR-2017-01/FL-1648C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/BR-2017-01/FL-1648D.JPG
OU-RH116RFL02F017E9Pectoral finEthanol751/12/2017Brazil
Rio Grande do Norte
NatalPraia da Redinha
Southwestern Atlantic
Morning5.751395° S35.202028° W
http://www.google.com/maps/place/5.751395° S35.202028° W/data=!3m1!1e3
5
Sandy bottom beach. It is located next to the Potengi river mouth.
Collected by local fishermen using large seine nets
E.Ribeiro
46
AchiridaeTrinectescf. xanthurusFL1767FL1767Whole specimen tissueCO-2017-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-05/FL-1767A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-05/FL-1767B.JPG
Universidad de los Andes
RFL02F018G8
Whole specimen tissue
Ethanol181/25-27/2017ColombiaChocoNuqui
Rio Partadorcito (tributary of Rio Partado)
Eastern PacificAfternoon5° 35’ 37.8" N77° 27’ 17.5" W
http://www.google.com/maps/place/5° 35’ 37.8" N77° 27’ 17.5" W/data=!3m1!1e3
2Freshwater
Seine nets and deep nets
E.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL02B06
47
AlbulidaeAlbula
nemoptera/velpes
FL0975FL0975Photo voucher onlyCO-2016-11
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-11/FL-975A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-11/FL-975B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-11/FL-975C.JPG
U. Nacional de Colombia
RFL01F010H5Pectoral FinEthanol2326/4/16ColombiaMagdalenaPueblo Viejo
Fish market at Tasajera
Western AtlanticMorningEstuarine, marine
Collected by local fishermen at either Isla de Salamanca (marine species) or at Ciénaga Grande de Santa Marta (estuarine species); gill nets (estuarine species) and hook and line (marine species).
R.BetancurJ.Narvaez
48
AlbulidaeAlbula
nemoptera/velpes
FL0976FL0976Photo voucher onlyCO-2016-11
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-11/FL-976A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-11/FL-976B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-11/FL-976C.JPG
U. Nacional de Colombia
RFL01F010H6Pectoral FinEthanol2476/4/16ColombiaMagdalenaPueblo Viejo
Fish market at Tasajera
Western AtlanticMorningEstuarine, marine
Collected by local fishermen at either Isla de Salamanca (marine species) or at Ciénaga Grande de Santa Marta (estuarine species); gill nets (estuarine species) and hook and line (marine species).
R.BetancurJ.Narvaez
49
AlbulidaeAlbulapacificaFL1332FL1332Photo voucher onlyMX-2016-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-01/FL-1332A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-01/FL-1332B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-01/FL-1332C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-01/FL-1332D.JPG
OU-RH116RFL01F014D3Pelvic finEthanol27512/10-11/2016MexicoGuerreroZihuatanejo
Fish market at Zihuatanejo (at “el muelle” - dock ). Collected on a radius of ca. 40 km from market.
Eastern PacificMorning
Near 17° 38.286'N
Near 101° 33.408'W
MarineR.BetancurE.RibeiroD.ArcilaC.PedrazaO.
Dominguez et al. (research team)
MX-2016-PL02B04
50
AlbulidaeAlbulapacificaFL1501FL1501CPUM-12923MX-2016-11
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-11/FL-1501A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-11/FL-1501B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-11/FL-1501C.JPG
OU-RH116RFL02F016A2Pectoral finEthanol19512/14/2016MexicoMichoacanLazaro CardenasPlaya AzulEastern PacificMorninghttp://www.google.com/maps/place//data=!3m1!1e35
Nearshore (at beach)
Collected by local fisherman using hook and line and spear pole.
R.BetancurE.RibeiroD.ArcilaC.PedrazaO.Dominguez et al. (research team)MX-2016-PL03H07
51
AntennariidaeAntennariusbermudensisFL0161FL0161MZUPRRP-I-00353PR-2015-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-10/FL-161A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-10/FL-161B.JPG
OU-RH116RFL01F002G1
Pectoral and pelvic Fin
Ethanol20.29/26/2015Puerto RicoPuerto RicoManati
Five minutes west of Los Tubos
Western AtlanticMorning18.469144° N66.462497° W
http://www.google.com/maps/place/18.469144° N66.462497° W/data=!3m1!1e3
19Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaR.Rivero
Originally ID as A. pauciradiatus; changed to A. bermudensis based on photo. A. bermudensis is not on BOLD. The closest match is A. striatus (99% identity) but it doesn't look like A. striatus. Antennatus coccineus and A. sanguineus are also a close match (99% identity) but those two species are not in the Caribbean.
6F07
TCATAAAGATATTGGCACTCTCTATCTTGTATTTGGGGCATGAGCCGGTATAGTAGGAACAGCCCTCAGCCTACTAATCCGTGCAGAGCTGAGCCAACCAGGTGCCCTCTTAGGCGATGACCAAATTTATAATGTTATCGTTACAGCACATGCTTTTGTTATAATCTTTTTTATAGTCATGCCAATTATAATTGGCGGATTCGGTAATTGATTAATCCCACTAATAATTGGTGCCCCAGATATAGCCTTCCCTCGAATAAACAACATAAGTTTTTGACTTCTCCCCCCGTCTTTTCTTCTCTTACTAGCGTCATCGGGGGTAGAAGCCGGAGCGGGCACAGGATGAACCGTTTATCCGCCTCTCGCGGGTAATTTAGCTCACGCCGGGGCATCCGTTGACTTAACTATCTTTTCCCTCCATCTCGCGGGTGTATCGTCCATTCTAGGGGCCATCAATTTTATTACAACTATTATTAATATAAAACCCCCTGCTCTATCACAATATCAAACACCACTCTTTGTATGAGCAGTACTAGTTACTGCTGTCCTTCTTCTCCTTTCCCTACCTGTCCTTGCTGCAGGGATTACAATATTATTAACGGACCGAAATCTTAATACAACCTTTTTCGATCCTACAGGAGGGGGAGATCCCATTCTCTACCAACACTTATTCTGATT
Antennatus coccineus
2016-08
52
AntennariidaeAntennariussp.FL1172FL1172Whole specimen tissuePR-2016-23
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1172A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1172B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1172C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1172D.JPG
OU-RH116RFL01F012H2
Whole specimen tissue
Ethanol99/2/2016Puerto RicoPuerto RicoGuanica
La Pared near Playa Santa
Western AtlanticMorning17.89863° N66.94365° W
http://www.google.com/maps/place/17.89863° N66.94365° W/data=!3m1!1e3
20Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.Rivero
53
AntennariidaeAntennatussanguineusFL1350FL1350CPUM-4994MX-2016-04OU-RH116RFL01F014F1Pectoral finEthanol2112/11/2016MexicoGuerreroZihuatanejoManzanilloEastern PacificAfternoon17.61980° N101.52396° W
http://www.google.com/maps/place/17.61980° N101.52396° W/data=!3m1!1e3
10Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL02C10
54
AntennariidaeFowlerichthysavalonisFL1356FL1356Whole specimen tissueMX-2016-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-04/FL-1356A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-04/FL-1356B.JPG
OU-RH116RFL01F014F7
Whole specimen tissue
Ethanol1412/11/2016MexicoGuerreroZihuatanejoManzanilloEastern PacificAfternoon17.61980° N101.52396° W
http://www.google.com/maps/place/17.61980° N101.52396° W/data=!3m1!1e3
10Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL02D04
55
AntennariidaeAntennatussanguineusFL1487FL1487CPUM-12938MX-2016-08
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-08/FL-1487A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-08/FL-1487B.JPG
OU-RH116RFL01F015I8Pectoral finEthanol6512/13/2016MexicoGuerreroIxtapaZacatosoEastern PacificMorning17.65417° N101.62175° W
http://www.google.com/maps/place/17.65417° N101.62175° W/data=!3m1!1e3
7Rocky reefSCUBA: spearR.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL03G05
56
AntennariidaeAntennatuscf. coccineusFL1576FL1576Whole specimen tissueMX-2016-13
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-13/FL-1576A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-13/FL-1576B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-13/FL-1576C.JPG
OU-RH116RFL02F016H7
Whole specimen tissue
Ethanol1112/16/2016MexicoMichoacanAquila
"Bajo" near La Manzanillera
Eastern PacificMorning18.37141° N103.52720° W
http://www.google.com/maps/place/18.37141° N103.52720° W/data=!3m1!1e3
20Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaO.Dominguez et al. (research team)MX-2016-PL04F12
57
AntennariidaeAntennatuscoccineusFL1611FL1611Photo voucher onlyMX-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1611A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1611B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1611C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1611D.JPG
OU-RH116RFL02F017B2Pectoral finEthanol912/15-17/2016MexicoMichoacanAquila
La Manzanillera; ship wreck at Faro de Bucerias
Eastern Pacific
Morning, afternoon
18.35276° N103.52207° W
http://www.google.com/maps/place/18.35276° N103.52207° W/data=!3m1!1e3
20
Rocky reef (ship wreck)
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.Dominguez et al. (research team)MX-2016-PL05B01
58
AntennariidaeAntennatussanguineusFL1786FL1786Universidad de los AndesCO-2016-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-06/FL-1786A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-06/FL-1786B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-06/FL-1786C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-06/FL-1786D.JPG
Universidad de los Andes
RFL02F018I7Pectoral finEthanol451/26/2017ColombiaChocoNuqui
Parguera, Cabo Corrientes
Eastern PacificMorning5.60984° N77.50069° W
http://www.google.com/maps/place/5.60984° N77.50069° W/data=!3m1!1e3
15Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL02D01
59
AntennariidaeAntennariussp.FL2376FL2376Whole specimen tissuePR-2018-08
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2376A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2376B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2376C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2376D.JPG
OU-RH116RFL02F024H6
Whole specimen tissue
Ethanol53/7/2018Puerto RicoPuerto RicoGuanica
La Pared, Guanica
Western Atlantic
Afternoon & night
17.89519° N66.97493° W
http://www.google.com/maps/place/17.89519° N66.97493° W/data=!3m1!1e3
30
Coral reef (outer reef)
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.RiveroO.DominguezPR-2018-PL01G12
60
ApogonidaeApogonmaculatusFL0011FL0011MZUPRRP-I-00230PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-11A.JPG
OU-RH116RFL01F001B1Fin clipsEthanol2708/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western AtlanticMorning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7A11low quality DNALQ2016-07
61
ApogonidaeApogonmaculatusFL0111FL0111MZUPRRP-I-00321PR-2015-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-06/FL-111A.JPG
OU-RH116RFL01F002B1
Pectoral and pelvic Fin
Ethanol37.99/1/2015Puerto RicoPuerto RicoGuanica
Near El Matal Seco
Western AtlanticMorning17°54.184 N66°58.066 W
http://www.google.com/maps/place/17°54.184 N66°58.066 W/data=!3m1!1e3
15Sand and rocks
SCUBA: clove oil
C.PedrazaR.Rivero
Fisherman
6B05low qualityLQ2016-07
62
ApogonidaePhaeoptyxsp.FL0130FL0130MZUPRRP-I-00337PR-2015-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-09/FL-130A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-09/FL-130B.JPG
OU-RH116RFL01F002C10Caudal FinEthanol21.79/14/2015Puerto RicoPuerto RicoSan Juan
Balneario Escambron
Western AtlanticMorning18°28.145 N66°5.448 W
http://www.google.com/maps/place/18°28.145 N66°5.448 W/data=!3m1!1e3
1-2Sand and rocks
SCUBA: clove oil
D.ArcilaC.PedrazaR.Rivero
Originally identified as Apogon sp. Re-identified as Phaeoptyx sp. based on CO1 sequence.
6C12
CATAAAGATATTGGCACCCTCTATCTAGTATTTGGTGCCTGGGCCGGAATGGTCGGAACAGCCCTTAGCTTGCTCATTCGGGCCGAATTAAGCCAGCCCGGGGCCCTTCTTGGCGATGACCAAATTTATAATGTAATCGTTACAGCCCACGCATTTGTAATAATCTTCTTTATAGTAATACCAATCATGATCGGGGGATTCGGGAACTGACTAATCCCGTTGATGATCGGAGCACCTGACATAGCATTCCCTCGGATAAACAATATGAGCTTCTGACTGCTGCCACCCTCATTCGTCCTCCTTCTGGCCTCTTCGGGGGTAGAAGCGGGGGCCGGGACCGGCTGAACAGTTTATCCCCCCCTTGCAGGCAACCTCGCCCACGCAGGGGCCTCTGTCGACCTGACTATTTTCTCGCTTCACCTAGCAGGTATTTCCTCTATCCTGGGGGCCATCAACTTTATCACTACAATTACTAACATAAAACCCCCTGGCATCACTCAGTACCAGACGCCCCTGTTCGTCTGGGCAGTTTTAATTACCGCCGTCCTGCTTCTTCTTTCTCTCCCTGTCCTGGCCGCTGGCATTACAATGCTGTTAACGGACCGGAACCTAAACACAACCTTCTTCGACCCCGCGGGGGGAGGGGACCCAATTCTGTACCAACACTTATTCTGATTTCTTT
Phaeoptyx conklini or Phaeoptyx pigmentaria or Apogon quadrisquamatus
2016-07
63
ApogonidaeApogon
robinsi/townsendi
FL0162FL0162MZUPRRP-I-00354PR-2015-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-10/FL-162A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-10/FL-162B.JPG
OU-RH116RFL01F002G2
Pectoral and pelvic Fin
Ethanol25.69/26/2015Puerto RicoPuerto RicoManati
Five minutes west of Los Tubos
Western AtlanticMorning18.469144° N66.462497° W
http://www.google.com/maps/place/18.469144° N66.462497° W/data=!3m1!1e3
19Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaR.Rivero
Most similar to A. robinsi (see photo) but Blast search matches A. townsendi with 100% identity. Mitochondrial introgression? Same species?
6F08
AAAGATATAGGCACCCTCTATCTAGTATTCGGTGCCTGAGCCGGAATGGTTGGGACGGCCCTTAGTCTACTCATTCGAGCAGAACTGAGCCAGCCCGGCGCCCTTCTTGGCGACGACCAAATCTACAATGTAATTGTTACGGCACATGCATTCGTAATGATTTTCTTTATAGTAATGCCAATCATGATTGGAGGCTTTGGAAACTGACTTATTCCCCTTATGATTGGGGCCCCTGACATAGCATTCCCCCGAATAAATAATATGAGCTTTTGACTCCTACCCCCCTCATTTATTCTCCTACTTGCCTCCTCTGGAGTAGAAGCGGGGGCCGGAACGGGATGAACAGTCTACCCCCCTCTTGCAGGAAATCTTGCCCATGCCGGAGCCTCTGTTGACTTAACTATTTTCTCCCTCCACCTAGCCGGTATTTCCTCAATCTTAGGCGCCATTAATTTTATTACCACTATCACAAACATGAAACCTCCCGGTATTACTCAGTACCAAACCCCCTTGTTTGTTTGGGCTGTCCTCATTACCGCCGTTCTTCTCCTCCTGTCTCTCCCTGTCCTCGCCGCTGGTATTACAATGCTTCTGACAGATCGAAACTTAAACACCACCTTTTTCGACCCTGCAGGAGGAGGAGACCCAATCCTATATCAACACTTATTCTGATTTCTTT
Apogon townsendi or Apogon planifrons
2016-07
64
ApogonidaeApogonrobinsiFL0168FL0168MZUPRRP-I-00359PR-2015-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-10/FL-168A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-10/FL-168B.JPG
OU-RH116RFL01F002G8
Pectoral and pelvic Fin
Ethanol22.19/26/2015Puerto RicoPuerto RicoManati
Five minutes west of Los Tubos
Western AtlanticMorning18.469144° N66.462497° W
http://www.google.com/maps/place/18.469144° N66.462497° W/data=!3m1!1e3
19Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaR.Rivero6G02low qualityLQ2016-07
65
ApogonidaePhaeoptyxconkliniFL0176FL0176MZUPRRP-I-00366PR-2015-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-12/FL-176A.JPG
OU-RH116RFL01F002H6Pectoral FinEthanol24.6610/19/2015Puerto RicoPuerto RicoSan Juan
Blue hole, Ocean Park
Western AtlanticMorning18° 27.810'N66° 3.164'W
http://www.google.com/maps/place/18° 27.810'N66° 3.164'W/data=!3m1!1e3
17.9Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero
Originally ID as Apogon sp. Changed to Phaeoptyx conklini based on both CO1 sequence (100% identity) and photo.
6G10
TCTAAGTATTTGGTGCCCTGGGCCGGAATGGTCGGRACAGCCCTTNAGCTTGCTCATTCGGGCCGAAATTAAGCCAGCCCGGGGCCCTTCTTGGCGATGACCNAAATTTATAATGTAATCGTTACAGCCCACGCATTTGTAATAATCTTCTTTATAGTAATACCAATCATGATCGGGGGATTCGGGAACTGACTAATCCCGTTGATGATCGGAGCACCTGACATAGCATTCCCTCGGATAAACAATATGAGCTTCTGACTGCTGCCACCCTCATTCGTCCTCCTTCTGGCCTCTTCGGGGGTAGAGGCGGGGGCCGGGACCGGCTGAACAGTTTATCCCCCCCTTGCAGGCAACCTCGCCCACGCAGGGGCCTCTGTCGACCTGACTATTTTCTCGCTTCATCTAGCAGGTATTTCCTCTATCCTGGGGGCCATCAACTTTATCACTACAATTACTAACATAAAACCCCCTGGCATCACTCAGTACCAGACGCCCCTGTTCGTCTGGGCAGTTTTAATTACCGCCGTCCTGCTTCTTCTTTCTCTCCCTGTCCTGGCCGCTGGCATTACAATGCTGTTAACGGNACCGGAAACCTAAAACACAANCCTTTYTTCGACCCCGCGGGGGGGAGGGGACCCAATTCTGTA
Phaeoptyx conklini or Phaeoptyx pigmentaria
2016-07
66
ApogonidaeApogonphenaxFL0179FL0179MZUPRRP-I-00369PR-2015-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-12/FL-179A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-12/FL-179B.JPG
OU-RH116RFL01F002H9Pectoral FinEthanol33.4110/19/2015Puerto RicoPuerto RicoSan Juan
Blue hole, Ocean Park
Western AtlanticMorning18° 27.810'N66° 3.164'W
http://www.google.com/maps/place/18° 27.810'N66° 3.164'W/data=!3m1!1e3
17.9Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero6H01
GGCACCCTCTATCTAGTATTCGGTGCCTGAGCCGGAATGGTTGGGACGGCCCTTAGTCTACTCATTCGAGCAGAACTGAGCCAGCCCGGCGCCCTTCTTGGCGACGACCAAATCTACAATGTAATTGTTACGGCACATGCATTCGTAATGATTTTCTTTATAGTAATGCCAATCATGATTGGAGGCTTTGGAAACTGACTTATTCCCCTTATGATTGGGGCCCCTGACATAGCATTCCCCCGAATAAATAATATGAGCTTTTGACTCCTACCTCCCTCATTTATTCTCCTACTTGCCTCCTCTGGAGTAGAAGCGGGGGCCGGAACGGGATGAACAGTCTACCCCCCTCTTGCAGGAAATCTTGCCCATGCCGGAGCCTCTGTTGACTTAACTATTTTCTCCCTCCACCTAGCCGGTATTTCCTCAATCTTAGGTGCCATTAATTTTATTACCACTATCACAAACATGAAACCTCCCGGTATTACTCAGTACCAAACCCCCTTGTTTGTTTGGGCTGTCCTTATTACCGCCGTTCTTCTCCTCCTGTCTCTCCCTGTCCTCGCCGCTGGTATTACAATGCTTCTGACAGATCGAAACTTAAACACCACCTTTTTCGACCCTGCAGGAGGAGGAGACCCAATCCTATATCAACACTTATTCTGATTTT
Apogon townsendi or Apogon planifrons
2016-07
67
ApogonidaeApogonmosaviFL0182FL0182MZUPRRP-I-00372PR-2015-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-12/FL-182A.JPG
OU-RH116RFL01F002I2Pectoral FinEthanol26.210/19/2015Puerto RicoPuerto RicoSan Juan
Blue hole, Ocean Park
Western AtlanticMorning18° 27.810'N66° 3.164'W
http://www.google.com/maps/place/18° 27.810'N66° 3.164'W/data=!3m1!1e3
17.9Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero6H04low qualityLQ2016-07
68
ApogonidaeAstrapogonpuncticulatusFL0189FL0189MZUPRRP-I-00377PR-2015-13
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-189A.JPG
OU-RH116RFL01F002I9
Pectoral and pelvic Fin
Ethanol19.710/26/2015Puerto RicoPuerto RicoLajas
Media Luna, La Parguera
Western AtlanticMorning17.93948° N67.05071° W
http://www.google.com/maps/place/17.93948° N67.05071° W/data=!3m1!1e3
6.1Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro9A01
69
ApogonidaeApogonmosaviFL0196FL0196MZUPRRP-I-00384PR-2015-13
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-196A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-196B.JPG
OU-RH116RFL01F002J6
Pectoral and pelvic Fin
Ethanol25.0310/26/2015Puerto RicoPuerto RicoLajas
Media Luna, La Parguera
Western AtlanticMorning17.93948° N67.05071° W
http://www.google.com/maps/place/17.93948° N67.05071° W/data=!3m1!1e3
6.1Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro9A08
70
ApogonidaeApogonmosaviFL0199FL0199MZUPRRP-I-00386PR-2015-13
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-199A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-199B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-199C.JPG
OU-RH116RFL01F002J9
Pectoral Fin and Muscle
Ethanol19.5410/26/2015Puerto RicoPuerto RicoLajas
Media Luna, La Parguera
Western AtlanticMorning17.93948° N67.05071° W
http://www.google.com/maps/place/17.93948° N67.05071° W/data=!3m1!1e3
6.1Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro9A11
71
ApogonidaeApogonmosaviFL0210FL0210MZUPRRP-I-00391PR-2015-14
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-14/FL-210A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-14/FL-210B.JPG
OU-RH116RFL01F003A10
Pectoral and pelvic Fin
Ethanol24.9710/26/2015Puerto RicoPuerto RicoLajas
El Mario, La Parguera
Western AtlanticMorning17.95282° N67.05645° W
http://www.google.com/maps/place/17.95282° N67.05645° W/data=!3m1!1e3
4.9Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro9B10
72
ApogonidaePhaeoptyxxenusFL0250FL0250MZUPRRP-I-00426PR-2015-17
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-17/FL-250A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-17/FL-250B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-17/FL-250C.JPG
OU-RH116RFL01F003E10
Pectoral and pelvic Fin
Ethanol28.311/11/2015Puerto RicoPuerto RicoLajas
Cay near Magueyes
Western AtlanticMorning17.965962° N67.048667° W
http://www.google.com/maps/place/17.965962° N67.048667° W/data=!3m1!1e3
17Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero
Approximate location based on name (Cay near Magueyes), depth (<17 m) and species list (e.g., H. chlorurus). Original coordinates were 17.95173° N, 67.00198° W but these are much more off-shore.
9F02
73
ApogonidaePhaeoptyxxenusFL0253FL0253MZUPRRP-I-00429PR-2015-17
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-17/FL-253A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-17/FL-253B.JPG
OU-RH116RFL01F003F3
Pectoral and pelvic Fin
Ethanol32.311/11/2015Puerto RicoPuerto RicoLajas
Cay near Magueyes
Western AtlanticMorning17.965962° N67.048667° W
http://www.google.com/maps/place/17.965962° N67.048667° W/data=!3m1!1e3
17Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero
Approximate location based on name (Cay near Magueyes), depth (<17 m) and species list (e.g., H. chlorurus). Original coordinates were 17.95173° N, 67.00198° W but these are much more off-shore.
9F05
74
ApogonidaeApogonmaculatusFL0359FL0359MZUPRRP-I-00531PR-2016-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-04/FL-359A.JPG
OU-RH116RFL01F004F9
Pectoral and pelvic Fin
Ethanol232/27/2016Puerto RicoPuerto RicoAguadillaCrashboatWestern AtlanticMorning 18° 27.469'N 67° 9.840'W
http://www.google.com/maps/place/ 18° 27.469'N 67° 9.840'W/data=!3m1!1e3
7.6Dock
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza8G05
75
ApogonidaeApogonmaculatusFL0361FL0361MZUPRRP-I-00533PR-2016-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-04/FL-361A.JPG
OU-RH116RFL01F004G1
Pectoral and pelvic Fin
Ethanol282/27/2016Puerto RicoPuerto RicoAguadillaCrashboatWestern AtlanticMorning 18° 27.469'N 67° 9.840'W
http://www.google.com/maps/place/ 18° 27.469'N 67° 9.840'W/data=!3m1!1e3
7.6Dock
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza8G07
76
ApogonidaeApogonmaculatusFL0363FL0363Whole specimen tissuePR-2016-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-04/FL-363A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-04/FL-363B.JPG
OU-RH116RFL01F004G3Whole specimenEthanol152/27/2016Puerto RicoPuerto RicoAguadillaCrashboatWestern AtlanticMorning 18° 27.469'N 67° 9.840'W
http://www.google.com/maps/place/ 18° 27.469'N 67° 9.840'W/data=!3m1!1e3
7.6Dock
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza8G09
77
ApogonidaeApogonmaculatusFL0366FL0366Whole specimen tissuePR-2016-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-04/FL-366A.JPG
OU-RH116RFL01F004G6Whole specimenEthanol142/27/2016Puerto RicoPuerto RicoAguadillaCrashboatWestern AtlanticMorning 18° 27.469'N 67° 9.840'W
http://www.google.com/maps/place/ 18° 27.469'N 67° 9.840'W/data=!3m1!1e3
7.6Dock
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza8G12
78
ApogonidaeApogonmaculatusFL0370FL0370Whole specimen tissuePR-2016-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-05/FL-370A.JPG
OU-RH116RFL01F004G10Whole specimenEthanol192/27/2016Puerto RicoPuerto RicoAguadillaEl NaturalWestern AtlanticMorning18° 27.763'N 67° 10.066'W
http://www.google.com/maps/place/18° 27.763'N 67° 10.066'W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza8H04
79
ApogonidaePhaeoptyxxenusFL0380FL0380MZUPRRP-I-00620PR-2016-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-05/FL-380A.JPG
OU-RH116RFL01F004H10
Pectoral and pelvic Fin
Ethanol222/27/2016Puerto RicoPuerto RicoAguadillaEl NaturalWestern AtlanticMorning18° 27.763'N 67° 10.066'W
http://www.google.com/maps/place/18° 27.763'N 67° 10.066'W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza5A04
80
ApogonidaePhaeoptyxxenusFL0416FL0416MZUPRRP-I-00623PR-2016-07
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-07/FL-416A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-07/FL-416B.JPG
OU-RH116RFL01F005B6
Pectoral and pelvic Fin
Ethanol38.93/19/2016Puerto RicoPuerto RicoSalinas
Near Cayo Matias
Western AtlanticMorning17.93625° N66.29468° W
http://www.google.com/maps/place/17.93625° N66.29468° W/data=!3m1!1e3
5
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza5D04
81
ApogonidaeApogonmaculatusFL0462FL0462Whole specimen tissuePR-2016-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-462B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-462C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-462A.JPG
OU-RH116RFL01F005G2Whole specimenEthanol16.54/8/16Puerto RicoPuerto RicoAguadillaCrashboatWestern AtlanticMorning 18° 27.462'N 67° 9.834'W
http://www.google.com/maps/place/ 18° 27.462'N 67° 9.834'W/data=!3m1!1e3
8
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
82
ApogonidaeApogonmaculatusFL0464FL0464MZUPRRP-I-00626PR-2016-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-464A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-464B.JPG
OU-RH116RFL01F005G4
Pectoral Fin and Muscle
Ethanol20.54/8/16Puerto RicoPuerto RicoAguadillaCrashboatWestern AtlanticMorning 18° 27.462'N 67° 9.834'W
http://www.google.com/maps/place/ 18° 27.462'N 67° 9.834'W/data=!3m1!1e3
8
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
83
ApogonidaeApogonplanifronsFL0543FL0543MZUPRRP-I-00655PR-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-12/FL-543A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-12/FL-543B.JPG
OU-RH116RFL01F006E3
Pectoral and pelvic Fin
Ethanol264/29/16Puerto RicoPuerto RicoLajas
La Pared, La Parguera
Western AtlanticMorning17.89847° N66.94626° W
http://www.google.com/maps/place/17.89847° N66.94626° W/data=!3m1!1e3
27.4
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro
84
ApogonidaeApogonplanifronsFL0545FL0545Whole specimen tissuePR-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-12/FL-545A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-12/FL-545B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-12/FL-545C.JPG
OU-RH116RFL01F006E5Whole specimenEthanol164/29/16Puerto RicoPuerto RicoLajas
La Pared, La Parguera
Western AtlanticMorning17.89847° N66.94626° W
http://www.google.com/maps/place/17.89847° N66.94626° W/data=!3m1!1e3
27.4
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro
85
ApogonidaePhaeoptyxpigmentariaFL0600FL0600INVEMAR-PEC-9594CO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-600A.JPG
U. Nacional de Colombia
RFL01F006J10
Pectoral and pelvic Fin
Ethanol265/31/16ColombiaMagdalenaSanta MartaEl MorroWestern AtlanticMorning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
86
ApogonidaeApogonmaculatusFL0603FL0603Whole specimen tissueCO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-603A.JPG
U. Nacional de Colombia
RFL01F007A3Whole specimenEthanol165/31/16ColombiaMagdalenaSanta MartaEl MorroWestern AtlanticMorning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
87
ApogonidaePhaeoptyxpigmentariaFL0604FL0604INVEMAR-PEC-9594CO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-604A.JPG
U. Nacional de Colombia
RFL01F007A4
Pectoral Fin and Muscle
Ethanol275/31/16ColombiaMagdalenaSanta MartaEl MorroWestern AtlanticMorning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
88
ApogonidaePhaeoptyxpigmentariaFL0606FL0606INVEMAR-PEC-9594CO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-606A.JPG
U. Nacional de Colombia
RFL01F007A6
Pectoral Fin and Muscle
Ethanol245/31/16ColombiaMagdalenaSanta MartaEl MorroWestern AtlanticMorning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
89
ApogonidaeApogonmaculatusFL0621FL0621Whole specimen tissueCO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-621A.JPG
U. Nacional de Colombia
RFL01F007C1Whole specimenEthanol155/31/16ColombiaMagdalenaSanta MartaEl MorroWestern AtlanticMorning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
90
ApogonidaeApogonmaculatusFL0626FL0626Whole specimen tissueCO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-626A.JPG
U. Nacional de Colombia
RFL01F007C6Whole specimenEthanol145/31/16ColombiaMagdalenaSanta MartaEl MorroWestern AtlanticMorning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
91
ApogonidaePhaeoptyxpigmentariaFL0632FL0632Whole specimen tissueCO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-632A.JPG
U. Nacional de Colombia
RFL01F007D2Whole specimenEthanol185/31/16ColombiaMagdalenaSanta MartaEl MorroWestern AtlanticMorning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
92
ApogonidaePhaeoptyxpigmentariaFL0634FL0634Whole specimen tissueCO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-634A.JPG
U. Nacional de Colombia
RFL01F007D4Whole specimenEthanol185/31/16ColombiaMagdalenaSanta MartaEl MorroWestern AtlanticMorning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
93
ApogonidaePhaeoptyxsp.FL0636FL0636Whole specimen tissueCO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-636A.JPG
U. Nacional de Colombia
RFL01F007D6Whole specimenEthanol175/31/16ColombiaMagdalenaSanta MartaEl MorroWestern AtlanticMorning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
94
ApogonidaePhaeoptyxxenusFL0643FL0643INVEMAR-PEC-9595CO-2016-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-04/FL-643A.JPG
U. Nacional de Colombia
RFL01F007E3
Pectoral and pelvic Fin
Ethanol255/31/16ColombiaMagdalenaSanta Marta
Playa Blanca, El Rodadero
Western AtlanticMorning11.21639 N74.23694 W
http://www.google.com/maps/place/11.21639 N74.23694 W/data=!3m1!1e3
7Reef
SCUBA: clove oil
D.ArcilaC.Pedraza
95
ApogonidaePhaeoptyxxenusFL0684FL0684Whole specimen tissueCO-2016-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-06/FL-684A.JPG
U. Nacional de Colombia
RFL01F007I4Whole specimenEthanol166/2/16ColombiaMagdalenaSanta Marta
Bahía de Gayraca, Parque Nacional Natural Tayrona
Western AtlanticMorning11° 19.720 N74° 6.936 W
http://www.google.com/maps/place/11° 19.720 N74° 6.936 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
96
ApogonidaeApogonmaculatusFL0686FL0686INVEMAR-PEC-9584CO-2016-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-06/FL-686A.JPG
U. Nacional de Colombia
RFL01F007I6
Pectoral and pelvic Fin
Ethanol516/2/16ColombiaMagdalenaSanta Marta
Bahía de Gayraca, Parque Nacional Natural Tayrona
Western AtlanticMorning11° 19.720 N74° 6.936 W
http://www.google.com/maps/place/11° 19.720 N74° 6.936 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
97
ApogonidaeApogonmaculatusFL0688FL0688INVEMAR-PEC-9584CO-2016-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-06/FL-688A.JPG
U. Nacional de Colombia
RFL01F007I8Ethanol326/2/16ColombiaMagdalenaSanta Marta
Bahía de Gayraca, Parque Nacional Natural Tayrona
Western AtlanticMorning11° 19.720 N74° 6.936 W
http://www.google.com/maps/place/11° 19.720 N74° 6.936 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
98
ApogonidaeApogonmaculatusFL0702FL0702INVEMAR-PEC-9584CO-2016-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-06/FL-702A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-06/FL-702B.JPG
U. Nacional de Colombia
RFL01F008A2Ethanol256/2/16ColombiaMagdalenaSanta Marta
Bahía de Gayraca, Parque Nacional Natural Tayrona
Western AtlanticMorning11° 19.720 N74° 6.936 W
http://www.google.com/maps/place/11° 19.720 N74° 6.936 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
99
ApogonidaeAstrapogonpuncticulatusFL0720FL0720INVEMAR-PEC-9593CO-2016-07
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-07/FL-720A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-07/FL-720B.JPG
U. Nacional de Colombia
RFL01F008B10
Pectoral , Pelvic Fin and Muscle
Ethanol316/2/16ColombiaMagdalenaSanta Marta
Bahía de Chengue, Parque Nacional Natural Tayrona
Western AtlanticMorning11° 19.278 N74° 7.932 W
http://www.google.com/maps/place/11° 19.278 N74° 7.932 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
100
ApogonidaeApogonmaculatusFL0722FL0722INVEMAR-PEC-9585CO-2016-07
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-07/FL-722A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-07/FL-722B.JPG
U. Nacional de Colombia
RFL01F008C2
Pectoral and pelvic Fin
Ethanol286/2/16ColombiaMagdalenaSanta Marta
Bahía de Chengue, Parque Nacional Natural Tayrona
Western AtlanticMorning11° 19.278 N74° 7.932 W
http://www.google.com/maps/place/11° 19.278 N74° 7.932 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza