ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAW
1
FamilyGenusSpecific EpitethTissue No.Tissue IDCollection No./VoucherLocality Field No.Photo 1Photo 2Photo 3Photo 4Tissue LocationRack No.
Tissue Box No.
Plate wellTissue Type
Preservation Method
Standard/Total Lenght (mm)
DateCountryState/ProvinceCityLocalityBasinTimeLatitudeLongitudeShow on map
Maximum depth (meters)
Habitat
Collection method
Collector first name 1
Collector last name 1
Collector first name 2
Collector last name 2
Collector first name 3
Collector last name 3
Collector first name 4
Collector last name 4
Collector first name5
Collector last name5
Collector first name6
Collector last name6
RemarksExtraction plateExtract wellCO1 sequence
BOLD ID (closest match)
Date of BOLD ID
2
BelonidaeAblenneshiansFL1517FL1517Photo voucher onlyMX-2016-10OU-RH116RFL02F016B8Pectoral finEthanol43012/14/2016MexicoMichoacan
Lazaro Cardenas
Fish market at Lazaro Cardenas (“mercado del rio")
Eastern PacificMorninghttp://www.google.com/maps/place//data=!3m1!1e3
Includes mostly estuarine and marine fishes, but some are freshwater (e.g., ictalurids). Some photo vouchers only.
Collected by local fishermen.
R.BetancurE.RibeiroD.ArcilaC.PedrazaO.Dominguez et al. (research team)MX-2016-PL04B01
3
PomacentridaeAbudefdufsaxatilisFL0037FL0037MZUPRRP-I-00256PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-37A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-37B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-37C.JPG
OU-RH116RFL01F001D7Pectoral FinEthanol42.58/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D01low quality DNALQ2016-07
4
PomacentridaeAbudefdufsaxatilisFL0040FL0040MZUPRRP-I-00259PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-40A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-40B.JPG
OU-RH116RFL01F001D10
Pectoral and pelvic Fin
Ethanol29.148/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D04
TCAGAATAAATGTTGGTAAAGAATGGGGTCTCCTCCTCCAGCTGGGTCGAAGAATGTGGTATTTAAGTTTCGGTCGGTTAGAAGTATCGTAATTCCAGCGGCTAAAACAGGAAGGGACAGAAGGAGGAGCACGGCCGTGATGAGTACGGCTCATACGAAGAGAGGAGTCTGGTATTGAGAAATAGCTGGAGGTTTCATATTAATAATAGTGGTAATAAAATTAATGGCTCCTAAAATTGAGGACACACCTGCTAAGTGGAGGGAGAAAATAGTTAAGTCAACAGAAGCTCCTGCGTGAGCTAGGTTGCCTGATAGTGGTGGGTAGACAGTTCAGCCTGTTCCTGCACCTGCTTCAACTCCGGAGGAGGCAAGAAGAAGTAGGAACGATGGGGGAAGAAGTCAGAAGCTCATATTGTTCATTCGGGGGAATGCCATATCAGGGGCACCGATCATTAGTGGGATAAGTCAGTTTCCAAACCCTCCAATTATAATTGGTATTACTATAAAGAAAATTATTACAAAGGCATGTGCCGTAACAATTACGTTGTAAATCTGGTCGTCTCCGAGGAGAGCGCCTGGTTGGCTTAGTTCTGCTCGAATAAGGAGGCTCAGGGCTGTTCCTACTATTCCAGCTCAAGCACCAAATACTAGATAGAGGGTGCCAATATCTTTATGATTG
Abudefduf saxatilis
2016-07
5
PomacentridaeAbudefdufsaxatilisFL0044FL0044MZUPRRP-I-00263PR-2015-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-44A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-04/FL-44B.JPG
OU-RH116RFL01F001E4
Pectoral Fin and Caudal muscle
Ethanol21.068/30/2015Puerto RicoPuerto RicoGuanicaPlaya la Jungla
Western Atlantic
Afternoon17.944319° N66.964879° W
http://www.google.com/maps/place/17.944319° N66.964879° W/data=!3m1!1e3
0.5-3Mangrove
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.RibeiroR.Rivero7D08
ATCAGAATAAATGCTGGTAAAGAATAGGGTCTCCTCCTCCAGCTGGGTCGAAGAATGTGGTGTTTAAGTTTCGGTCGGTTAGAAGTATTGTAATCCCAGCGGCTAAAACAGGAAGGGACAGAAGAAGAAGCACGGCCGTGATAAGTACGGCTCATACGAAAAGAGGAGTCTGGTATTGAGAAATAGCAGGAGGTTTCATATTAATAATAGTAGTGATAAAATTAATGGCTCCTAAAATTGAGGATACACCTGCTAAGTGGAGGGAGAAAATAGTTAAGTCAACAGAAGCTCCTGCGTGAGCTAGGTTGCCTGATAGCGGTGGGTAGACAGTTCAGCCTGTTCCTGCACCTGCTTCAACTCCAGAGGAGGCAAGAAGAAGTAAGAATGACGGAGGAAGAAGTCAGAAGCTCATATTGTTCATTCGGGGGAATGCCATGTCGGGGGCGCCGATCATTAGTGGGATAAGTCAGTTTCCAAACCCTCCGATCATAATTGGTATTACTATAAAGAAAATTATTACAAAGGCATGTGCCGTAACAATTACGTTGTAAATCTGGTCGTCTCCGAGGAGAGCGCCTGGTTGGCTAAGTTCTGCTCGAATAAGGAGGCTCAGGGCTGTTCCTACTATTCCAGCTCAAGCACCAAATACTAGATAGAGGGTGCCAATATCTTTATGA
Abudefduf saxatilis
2016-08
6
PomacentridaeAbudefdufsaxatilisFL0332FL0332MZUPRRP-I-00505PR-2016-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-02/FL-332A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-02/FL-332B.JPG
OU-RH116RFL01F004D2Pectoral FinEthanol79.52/5/2016Puerto RicoPuerto RicoLajas
La Pared, La Parguera
Western Atlantic
Morning17.88754° N67.00356° W
http://www.google.com/maps/place/17.88754° N67.00356° W/data=!3m1!1e3
20
SCUBA: spear
R.BetancurD.ArcilaE.RibeiroC.Pedraza8E02
7
PomacentridaeAbudefduftaurusFL0730FL0730INVEMAR-PEC-9714CO-2016-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-06/FL-730A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-06/FL-730B.JPG
U. Nacional de Colombia
RFL01F008C10Pectoral FinEthanol1656/2/16ColombiaMagdalenaSanta Marta
Bahía de Gayraca, Parque Nacional Natural Tayrona
Western Atlantic
Morning11° 19.720 N74° 6.936 W
http://www.google.com/maps/place/11° 19.720 N74° 6.936 W/data=!3m1!1e3
15Reef
SCUBA: spear
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
8
PomacentridaeAbudefdufsaxatilisFL0868FL0868INVEMAR-PEC-9713CO-2016-14
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-14/FL-868A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-14/FL-868B.JPG
U. Nacional de Colombia
RFL01F009G8
Pectoral and pelvic Fin
Ethanol376/8/16Colombia
San Andres & Providencia
San Andres
South of San Luis
Western Atlantic
Morning12.50224 N81.71740 W
http://www.google.com/maps/place/12.50224 N81.71740 W/data=!3m1!1e3
0.5Tide poolsClove oilD.ArcilaC.PedrazaR.Rivero
9
PomacentridaeAbudefdufsaxatilisFL0877FL0877INVEMAR-PEC-9713CO-2016-14
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-14/FL-877A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-14/FL-877B.JPG
U. Nacional de Colombia
RFL01F009H7
Pectoral and pelvic Fin
Ethanol226/8/16Colombia
San Andres & Providencia
San Andres
South of San Luis
Western Atlantic
Morning12.50224 N81.71740 W
http://www.google.com/maps/place/12.50224 N81.71740 W/data=!3m1!1e3
0.5Tide poolsClove oilD.ArcilaC.PedrazaR.Rivero
10
PomacentridaeAbudefduftaurusFL1030FL1030INVEMAR-PEC-9715CO-2016-18
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-18/FL-1030A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-18/FL-1030B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-18/FL-1030C.JPG
U. Nacional de Colombia
RFL01F011C10Pectoral FinEthanol166/11/16Colombia
San Andres & Providencia
San Andres
Mangrove near La Armada
Western Atlantic
Morning12.55434 N81.70188 W
http://www.google.com/maps/place/12.55434 N81.70188 W/data=!3m1!1e3
2MangroveClove oilC.PedrazaA.AceroR.Rivero
11
PomacentridaeAbudefduftaurusFL1050FL1050INVEMAR-PEC-9716CO-2016-19
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-19/FL-1050A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-19/FL-1050B.JPG
U. Nacional de Colombia
RFL01F011E10
Pectoral and pelvic Fin
Ethanol256/11/16Colombia
San Andres & Providencia
San Andres
Near Universidad Nacional
Western Atlantic
Morning12.53687 N81.70714 W
http://www.google.com/maps/place/12.53687 N81.70714 W/data=!3m1!1e3
0.5Tide poolsClove oilC.PedrazaR.RiveroA.Acero
12
PomacentridaeAbudefduftaurusFL1052FL1052INVEMAR-PEC-9716CO-2016-19
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-19/FL-1052A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-19/FL-1052B.JPG
U. Nacional de Colombia
RFL01F011F2
Pectoral and pelvic Fin
Ethanol226/11/16Colombia
San Andres & Providencia
San Andres
Near Universidad Nacional
Western Atlantic
Morning12.53687 N81.70714 W
http://www.google.com/maps/place/12.53687 N81.70714 W/data=!3m1!1e3
0.5Tide poolsClove oilC.PedrazaR.RiveroA.Acero
13
PomacentridaeAbudefduftroscheliiFL1313FL1313CPUM-12599MX-2016-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1313A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1313B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1313C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1313D.JPG
OU-RH116RFL01F014B4Pectoral finEthanol12512/10/2016MexicoGuerreroZihuatanejo
La Caleta de Chon
Eastern PacificAfternoon17° 36.940'N101° 33.262'W
http://www.google.com/maps/place/17° 36.940'N101° 33.262'W/data=!3m1!1e3
12Rocky reef
SCUBA: spear
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL01E02
14
PomacentridaeAbudefduftroscheliiFL1553FL1553CPUM-12974MX-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1553A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1553B.JPG
OU-RH116RFL02F016F4Pectoral finEthanol12812/15-17/2016MexicoMichoacanAquila
La Manzanillera; ship wreck at Faro de Bucerias
Eastern Pacific
Morning, afternoon
18.35276° N103.52207° W
http://www.google.com/maps/place/18.35276° N103.52207° W/data=!3m1!1e3
20
Rocky reef (ship wreck)
SCUBA: spear
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.Dominguez et al. (research team)MX-2016-PL04E01
15
PomacentridaeAbudefdufconcolorFL1664FL1664Universidad de los AndesCO-2017-01
Universidad de los Andes
RFL02F017G5Pectoral finEthanol251/23/2017ColombiaChocoNuqui
Playa Parguera, Cabo Corrientes
Eastern PacificAfternoon5.599140° N77.494697° W
http://www.google.com/maps/place/5.599140° N77.494697° W/data=!3m1!1e3
1Tide poolsClove oilR.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01A09
16
PomacentridaeAbudefdufconcolorFL1671FL1671Universidad de los AndesCO-2017-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1671A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1671B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1671C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-01/FL-1671D.JPG
Universidad de los Andes
RFL02F017H2Pectoral finEthanol301/23/2017ColombiaChocoNuqui
Playa Parguera, Cabo Corrientes
Eastern PacificAfternoon5.599140° N77.494697° W
http://www.google.com/maps/place/5.599140° N77.494697° W/data=!3m1!1e3
1Tide poolsClove oilR.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01B04
17
PomacentridaeAbudefduftroscheliiFL1721FL1721Universidad de los AndesCO-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1721A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1721B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1721C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1721D.JPG
Universidad de los Andes
RFL02F018C2Pectoral finEthanol1221/24,29/2017ColombiaChocoNuqui
Piedra Wacha near Playa Parguera, Cabo Corrientes
Eastern PacificMorning5.60546° N77.49783° W
http://www.google.com/maps/place/5.60546° N77.49783° W/data=!3m1!1e3
15Rocky reef
SCUBA: spear
R.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01F06
18
PomacentridaeAbudefduftroscheliiFL1734FL1734Universidad de los AndesCO-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1734A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1734B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1734C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1734D.JPG
Universidad de los Andes
RFL02F018D5Pectoral finEthanol1201/24,29/2017ColombiaChocoNuqui
Piedra Wacha near Playa Parguera, Cabo Corrientes
Eastern PacificMorning5.60546° N77.49783° W
http://www.google.com/maps/place/5.60546° N77.49783° W/data=!3m1!1e3
15Rocky reef
SCUBA: spear
R.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01G07
19
PomacentridaeAbudefduftroscheliiFL1978FL1978CPUM-XXX (UMSNH voucher 52696)GA-2017-PM09
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM09/FL-1978A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM09/FL-1978B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM09/FL-1978C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM09/FL-1978D.JPG
UMSNHRFL02F020H9Pectoral finEthanol1152/15/17Ecuador
Provincia de Galapagos
Santa Cruz Island
El EdenEastern PacificMorning0.557864° S90.539539° W
http://www.google.com/maps/place/0.557864° S90.539539° W/data=!3m1!1e3
12
Rocky reef and sandy bottom
SCUBA: spear
D.ArcilaO.
Dominguez et al. (research team)
GA-2017-PL02G12
20
PomacentridaeAbudefduftroscheliiFL2045FL2045
Photo voucher only (UMSNH tissue 47825)
GA-2017-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-04/FL-2045A.JPG
UMSNHRFL02F021E6Pectoral finEthanol1352/8/2017Ecuador
Provincia de Galapagos
Baltra Island (nearby)
Canal at Seymour North Island
Eastern PacificAfternoon0° 24.057'S90° 17.412'W
http://www.google.com/maps/place/0° 24.057'S90° 17.412'W/data=!3m1!1e3
12Rocky reef
SCUBA: spear
R.RiveroO.
Dominguez et al. (research team)
GA-2017-PL01E03
21
PomacentridaeAbudefduftroscheliiFL2096FL2096
Photo voucher only (UMSNH tissue 47852)
GA-2017-DW01
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW01/FL-2096A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW01/FL-2096B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW01/FL-2096C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW01/FL-2096D.JPG
UMSNHRFL02F021J7Pectoral finEthanol1512/11/2017Ecuador
Provincia de Galapagos
Genovesa Island
Tip of islandEastern PacificAfternoon0.300094° N89.95382° W
http://www.google.com/maps/place/0.300094° N89.95382° W/data=!3m1!1e3
10Rocky reef
SCUBA: spear
R.BetancurE.RibeiroC.PedrazaO.
Dominguez et al. (research team)
GA-2017-PL03A06
22
PomacentridaeAbudefdufconcolorFL2210FL2210CPUM-XXX (UMSNH voucher 50205)GA-2017-DW13
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW13/FL-2210A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW13/FL-2210B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW13/FL-2210C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW13/FL-2210D.JPG
UMSNHRFL02F023B1Pectoral finEthanol1222/15/2017Ecuador
Provincia de Galapagos
Isabela Island
Punta Albemarle (North Isabela)
Eastern PacificAfternoon0.15476° N91.36767° W
http://www.google.com/maps/place/0.15476° N91.36767° W/data=!3m1!1e3
3
Rocky reef and mangrove
SCUBA: spear
R.BetancurE.RibeiroC.PedrazaO.
Dominguez et al. (research team)
GA-2017-PL04C02
23
PomacentridaeAbudefduftroscheliiFL2213FL2213CPUM-XXX (UMSNH voucher 50204)GA-2017-DW13
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW13/FL-2213A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW13/FL-2213B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW13/FL-2213C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-DW13/FL-2213D.JPG
UMSNHRFL02F023B4Pectoral finEthanol1252/15/2017Ecuador
Provincia de Galapagos
Isabela Island
Punta Albemarle (North Isabela)
Eastern PacificAfternoon0.15476° N91.36767° W
http://www.google.com/maps/place/0.15476° N91.36767° W/data=!3m1!1e3
3
Rocky reef and mangrove
SCUBA: spear
R.BetancurE.RibeiroC.PedrazaO.
Dominguez et al. (research team)
GA-2017-PL04C05
24
PomacentridaeAbudefdufsaxatilisFL2417FL2417MZUPRRP-I-00879PR-2018-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-12/FL-2417A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-12/FL-2417B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-12/FL-2417C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-12/FL-2417D.JPG
OU-RH116RFL02F025B7Gill, Pectoral finEthanol1253/9/2018Puerto RicoPuerto RicoLajas
Cayo Margarita (leeward)
Western Atlantic
Morning17.91473° N67.11003° W
http://www.google.com/maps/place/17.91473° N67.11003° W/data=!3m1!1e3
8
Rocky/sandy reef (inner reef)
SCUBA: spear
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.RiveroO.
Dominguez
PR-2018-PL02C07
25
PomacentridaeAbudefdufsaxatilisFL2461FL2461MZUPRRPPR-2018-19
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-19/FL-2461A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-19/FL-2461B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-19/FL-2461C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-19/FL-2461D.JPG
OU-RH116RFL02F025G1
Pelvic, pectoral fins
Ethanol235/7/2018Puerto RicoPuerto RicoLajasCayo Enrique
Western Atlantic
Morning18.467620° N66.087069° W
http://www.google.com/maps/place/18.467620° N66.087069° W/data=!3m1!1e3
<1Tide pools
Clove oil; hand picked
R.BetancurA.AceroC.PedrazaA.
Santaquiteria
PR-2018-PL02G03
26
LabrisomidaeAcanthemblemariatriangulatusFL0015FL0015MZUPRRP-I-00234PR-2015-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-15A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-15B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-02/FL-15C.JPG
OU-RH116RFL01F001B5Fin clipsEthanol3608/15/2015Puerto RicoPuerto RicoManati
Manati, Los Tubos
Western Atlantic
Morning18.470551° N66.449018° W
http://www.google.com/maps/place/18.470551° N66.449018° W/data=!3m1!1e3
10
Rocky-sandy bottoms
SCUBA: clove oil
R.BetancurC.PedrazaD.ArcilaE.Ribeiro7B03
GAGTCTATTGATTCGGGCAGAGCTGAGCCAACCTGGGGCCCTTCTAGGGGACGACCAAATTTATAACGTAATWGTTACCGCTCACGCCTTCGTAATAATCTTCTTWATAGTAATGCCAATCATGATTGGAGGCTTCGGGAACTGACTCATCCCCCTAATGATTGGAGCCCCTGACATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTTCTTCCTCCGTCCTTCTTGCTTCTCTTAGCTTCCTCAGGCATTGAGGCTGGTGCCGGAACAGGTTGAACAGTATACCCCCCTCTCTCAGGAAACCTGGCCCATGCGGGTGCTTCAGTAGACCTAACAATTTTCTCTCTTCACTTAGCTGGTATTTCGTCTATCCTGGGGGCTATCAACTTCATCACCACGATTATTAACATGAAACCGCCAGCAATTTCTCAGTACCAGACACCTCTTTTCGTCTGAGCCGTGMTTATTACAGCTGTTCTTCTCCTTCTGTCCCTCCCAGTTCTTTGCTGCCGGCATTACCATGCTATTAACAGACCGAAACCTTAACACAACATTCTTCGATCCAGCTGGAGGTGGTGACCCAATTCTTTACCAGCACTTGTTCTGATTTTT
Malacoctenus triangulatus
2016-07
27
ChaenopsidaeAcanthemblemariaspinosaFL0134FL0134Whole specimen tissuePR-2015-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-09/FL-134A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-09/FL-134B.JPG
OU-RH116RFL01F002D4
Whole Specimen
Ethanol219/14/2015Puerto RicoPuerto RicoSan Juan
Balneario Escambron
Western Atlantic
Morning18°28.145 N66°5.448 W
http://www.google.com/maps/place/18°28.145 N66°5.448 W/data=!3m1!1e3
1-2Sand and rocks
SCUBA: clove oil
D.ArcilaC.PedrazaR.Rivero6D04
ATCATAAAGATATTGGCACCCTTTATTTAGTTTTCGGAGCCTGAGCTGGGATGGTGGGGACTGCTTTAAGTCTCCTCATCCGAGCTGAGCTAAGCCAACCCGGGGCCCTGCTAGGCGACGACCAGATTTATAATGTTATCGTTACAGCACACGCTTTCGTAATAATTTTCTTCATAGTAATACCAATCTTAATTGGAGGCTTTGGCAACTGGCTTGTCCCTTTAATGGTTGGCGCCCCCGATATGGCCTTTCCTCGAATAAATAATATAAGCTTCTGACTCCTGCCTCCTTCTTTCCTTCTCTTACTTGCCTCATCAGGTGTAGAAGCTGGGGCTGGCACCGGATGAACAGTTTACCCGCCCCTGTCGGGAAATTTAGCACATGCCGGGGCTTCCGTCGACCTCACTATCTTCTCCCTTCATCTAGCAGGCATTTCCTCTATTCTAGGGGCAATCAACTTTATCACAACTATCATCAACATGAAGCCCCCTGCTATTTCTCAGTATCAAACGCCCCTCTTTGTATGGTCTGTTTTAATTACCGCTGTTCTCCTTCTATTATCCCTGCCCGTGCTGGCAGCGGGCATTACAATGCTTCTCACAGACCGCAATTTAAATACAACCTTTTTTGACCCCGCTGGCGGGGGAGACCCTATCCTATACCAACATCTGTTTTGATTCTT
Acanthemblemaria spinosa
2016-07
28
ChaenopsidaeAcanthemblemariaasperaFL0209FL0209Whole specimen tissuePR-2015-13
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-209A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-13/FL-209B.JPG
OU-RH116RFL01F003A9
Whole Specimen
Ethanol15.5610/26/2015Puerto RicoPuerto RicoLajas
Media Luna, La Parguera
Western Atlantic
Morning17.93948° N67.05071° W
http://www.google.com/maps/place/17.93948° N67.05071° W/data=!3m1!1e3
4.9Reef
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro9B09
29
ChaenopsidaeAcanthemblemariacf. harpezaFL0314FL0314Whole specimen tissuePR-2016-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-01/FL-314A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-01/FL-314B.JPG
OU-RH116RFL01F004B4
Whole Specimen
Ethanol211/31/2016Puerto RicoPuerto RicoManatiManati
Western Atlantic
Morning18.46882° N66.46294° W
http://www.google.com/maps/place/18.46882° N66.46294° W/data=!3m1!1e3
12
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza8C08
30
ChaenopsidaeAcanthemblemariacf. chapliniFL0315FL0315Whole specimen tissuePR-2016-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-01/FL-315A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-01/FL-315B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-01/FL-315C.JPG
OU-RH116RFL01F004B5
Whole Specimen
Ethanol201/31/2016Puerto RicoPuerto RicoManatiManati
Western Atlantic
Morning18°46.882 N66.46294° W
http://www.google.com/maps/place/18°46.882 N66.46294° W/data=!3m1!1e3
12
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza8C09
31
ChaenopsidaeAcanthemblemariagreenfieldiFL0365FL0365Whole specimen tissuePR-2016-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-04/FL-365A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-04/FL-365B.JPG
OU-RH116RFL01F004G5
Whole specimen
Ethanol212/27/2016Puerto RicoPuerto RicoAguadillaCrashboat
Western Atlantic
Morning 18° 27.469'N 67° 9.840'W
http://www.google.com/maps/place/ 18° 27.469'N 67° 9.840'W/data=!3m1!1e3
7.6Dock
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza8G11
32
ChaenopsidaeAcanthemblemariasp.FL0384FL0384Whole specimen tissuePR-2016-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-05/FL-384A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-05/FL-384B.JPG
OU-RH116RFL01F004I4
Whole specimen
Ethanol20.52/27/2016Puerto RicoPuerto RicoAguadillaEl Natural
Western Atlantic
Morning18° 27.763'N 67° 10.066'W
http://www.google.com/maps/place/18° 27.763'N 67° 10.066'W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza5A08
33
ChaenopsidaeAcanthemblemariasp.FL0386FL0386MZUPRRP-I-00547PR-2016-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-05/FL-386A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-05/FL-386B.JPG
OU-RH116RFL01F004I6
Pectoral and pelvic Fin
Ethanol232/27/2016Puerto RicoPuerto RicoAguadillaEl Natural
Western Atlantic
Morning18° 27.763'N 67° 10.066'W
http://www.google.com/maps/place/18° 27.763'N 67° 10.066'W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza5A10
34
ChaenopsidaeAcanthemblemariacf. harpezaFL0431FL0431Whole specimen tissuePR-2016-07
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-07/FL-431A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-07/FL-431B.JPG
OU-RH116RFL01F005D1
Whole specimen
Ethanol17.23/19/2016Puerto RicoPuerto RicoSalinas
Near Cayo Matias
Western Atlantic
Morning17.93625° N66.29468° W
http://www.google.com/maps/place/17.93625° N66.29468° W/data=!3m1!1e3
5
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza5E07
35
ChaenopsidaeAcanthemblemariaspinosaFL0461FL0461Whole specimen tissuePR-2016-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-461A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-461B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-461C.JPG
OU-RH116RFL01F005G1
Whole specimen
Ethanol194/8/16Puerto RicoPuerto RicoAguadillaCrashboat
Western Atlantic
Morning 18° 27.462'N 67° 9.834'W
http://www.google.com/maps/place/ 18° 27.462'N 67° 9.834'W/data=!3m1!1e3
8
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
36
ChaenopsidaeAcanthemblemariaspinosaFL0463FL0463Whole specimen tissuePR-2016-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-463A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-09/FL-463B.JPG
OU-RH116RFL01F005G3
Whole specimen
Ethanol174/8/16Puerto RicoPuerto RicoAguadillaCrashboat
Western Atlantic
Morning 18° 27.462'N 67° 9.834'W
http://www.google.com/maps/place/ 18° 27.462'N 67° 9.834'W/data=!3m1!1e3
8
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
37
ChaenopsidaeAcanthemblemariaasperaFL0496FL0496Whole specimen tissuePR-2016-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-10/FL-496A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-10/FL-496B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-10/FL-496C.JPG
OU-RH116RFL01F005J6
Whole specimen
Ethanol194/15/16Puerto RicoPuerto RicoLajasEfra's Wall
Western Atlantic
Morning17.89778° N66.96442° W
http://www.google.com/maps/place/17.89778° N66.96442° W/data=!3m1!1e3
17-27
SCUBA: clove oil
R.BetancurD.ArcilaC.Pedraza
38
ChaenopsidaeAcanthemblemariaasperaFL0503FL0503Whole specimen tissuePR-2016-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-10/FL-503A.JPG
OU-RH116RFL01F006A3
Whole specimen
Ethanol124/15/16Puerto RicoPuerto RicoLajasEfra's Wall
Western Atlantic
Morning17.89778° N66.96442° W
http://www.google.com/maps/place/17.89778° N66.96442° W/data=!3m1!1e3
17-27
SCUBA: clove oil
R.BetancurD.ArcilaC.Pedraza
39
ChaenopsidaeAcanthemblemariaasperaFL0505FL0505Whole specimen tissuePR-2016-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-10/FL-505A.JPG
OU-RH116RFL01F006A5
Whole specimen
Ethanol164/15/16Puerto RicoPuerto RicoLajasEfra's Wall
Western Atlantic
Morning17.89778° N66.96442° W
http://www.google.com/maps/place/17.89778° N66.96442° W/data=!3m1!1e3
17-27
SCUBA: clove oil
R.BetancurD.ArcilaC.Pedraza
40
ChaenopsidaeAcanthemblemariaasperaFL0506FL0506Whole specimen tissuePR-2016-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-10/FL-506A.JPG
OU-RH116RFL01F006A6
Whole specimen
Ethanol144/15/16Puerto RicoPuerto RicoLajasEfra's Wall
Western Atlantic
Morning17.89778° N66.96442° W
http://www.google.com/maps/place/17.89778° N66.96442° W/data=!3m1!1e3
17-27
SCUBA: clove oil
R.BetancurD.ArcilaC.Pedraza
41
ChaenopsidaeAcanthemblemariaasperaFL0562FL0562Whole specimen tissuePR-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-12/FL-562A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-12/FL-562B.JPG
OU-RH116RFL01F006G2
Whole specimen
Ethanol184/29/16Puerto RicoPuerto RicoLajas
La Pared, La Parguera
Western Atlantic
Morning17.89847° N66.94626° W
http://www.google.com/maps/place/17.89847° N66.94626° W/data=!3m1!1e3
27.4
SCUBA: clove oil
R.BetancurD.ArcilaC.PedrazaE.Ribeiro
42
ChaenopsidaeAcanthemblemariarivasiFL0608FL0608INVEMAR-PEC-9611CO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-608A.JPG
U. Nacional de Colombia
RFL01F007A8
Pectoral Fin and Muscle
Ethanol1855/31/16ColombiaMagdalenaSanta MartaEl Morro
Western Atlantic
Morning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
43
ChaenopsidaeAcanthemblemariabetinensisFL0617FL0617INVEMAR-PEC-9608CO-2016-02b
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-02b/FL-617A.JPG
U. Nacional de Colombia
RFL01F007B7
Pectoral Fin and Muscle
Ethanol395/31/16ColombiaMagdalenaSanta MartaEl Morro
Western Atlantic
Morning11° 14.955'N74° 13.868'W
http://www.google.com/maps/place/11° 14.955'N74° 13.868'W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
44
ChaenopsidaeAcanthemblemariabetinensisFL0758FL0758INVEMAR-PEC-9609CO-2016-08
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-08/FL-758A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-08/FL-758B.JPG
U. Nacional de Colombia
RFL01F008F8
Pectoral and pelvic Fin
Ethanol386/2/16ColombiaMagdalenaSanta Marta
Bahía de Cinto, Parque Nacional Natural Tayrona
Western Atlantic
Morning11° 20.261 N74° 3.263 W
http://www.google.com/maps/place/11° 20.261 N74° 3.263 W/data=!3m1!1e3
25Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
45
ChaenopsidaeAcanthemblemariabetinensisFL0760FL0760Whole specimen tissueCO-2016-08
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-08/FL-760A.JPG
U. Nacional de Colombia
RFL01F008F10
Whole specimen
Ethanol226/2/16ColombiaMagdalenaSanta Marta
Bahía de Cinto, Parque Nacional Natural Tayrona
Western Atlantic
Morning11° 20.261 N74° 3.263 W
http://www.google.com/maps/place/11° 20.261 N74° 3.263 W/data=!3m1!1e3
25Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
46
ChaenopsidaeAcanthemblemariabetinensisFL0762FL0762Whole specimen tissueCO-2016-08
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-08/FL-762A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-08/FL-762B.JPG
U. Nacional de Colombia
RFL01F008G2
Whole specimen
Ethanol22.56/2/16ColombiaMagdalenaSanta Marta
Bahía de Cinto, Parque Nacional Natural Tayrona
Western Atlantic
Morning11° 20.261 N74° 3.263 W
http://www.google.com/maps/place/11° 20.261 N74° 3.263 W/data=!3m1!1e3
25Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
47
ChaenopsidaeAcanthemblemariarivasiFL0773FL0773INVEMAR-PEC-9612CO-2016-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-09/FL-773A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-09/FL-773B.JPG
U. Nacional de Colombia
RFL01F008H3
Pectoral and pelvic Fin
Ethanol216/2/16ColombiaMagdalenaSanta Marta
Bahía de Cinto, Parque Nacional Natural Tayrona
Western Atlantic
Morning11° 19.994 N74° 3.601 W
http://www.google.com/maps/place/11° 19.994 N74° 3.601 W/data=!3m1!1e3
25Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
48
ChaenopsidaeAcanthemblemariarivasiFL0776FL0776Whole specimen tissueCO-2016-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-10/FL-776A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-10/FL-776B.JPG
U. Nacional de Colombia
RFL01F008H6
Whole specimen
Ethanol186/3/16ColombiaMagdalenaSanta Marta
Bahía de Gayraca, Parque Nacional Natural Tayrona
Western Atlantic
Morning11° 19.720 N74° 6.936 W
http://www.google.com/maps/place/11° 19.720 N74° 6.936 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
49
ChaenopsidaeAcanthemblemariacf. betinensisFL0777FL0777Whole specimen tissueCO-2016-10
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-10/FL-777A.JPG
U. Nacional de Colombia
RFL01F008H7
Whole specimen
Ethanol176/3/16ColombiaMagdalenaSanta Marta
Bahía de Gayraca, Parque Nacional Natural Tayrona
Western Atlantic
Morning11° 19.720 N74° 6.936 W
http://www.google.com/maps/place/11° 19.720 N74° 6.936 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.Pedraza
50
ChaenopsidaeAcanthemblemariagreenfieldiFL0815FL0815INVEMAR-PEC-9610CO-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-12/FL-815A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-12/FL-815B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-12/FL-815C.JPG
U. Nacional de Colombia
RFL01F009B5
Pectoral and pelvic Fin
Ethanol256/6/16Colombia
San Andres & Providencia
San Andres
Shore dive at Nirvana
Western Atlantic
Morning12° 30.097 N81° 43.882 W
http://www.google.com/maps/place/12° 30.097 N81° 43.882 W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
51
ChaenopsidaeAcanthemblemariagreenfieldiFL0817FL0817Photo voucher onlyCO-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-12/FL-817A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-12/FL-817B.JPG
U. Nacional de Colombia
RFL01F009B7
Pectoral , Pelvic Fin and Muscle
Ethanol176/6/16Colombia
San Andres & Providencia
San Andres
Shore dive at Nirvana
Western Atlantic
Morning12° 30.097 N81° 43.882 W
http://www.google.com/maps/place/12° 30.097 N81° 43.882 W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
52
ChaenopsidaeAcanthemblemariagreenfieldiFL0825FL0825Whole specimen tissueCO-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-12/FL-825A.JPG
U. Nacional de Colombia
RFL01F009C5
Whole specimen
Ethanol186/6/16Colombia
San Andres & Providencia
San Andres
Shore dive at Nirvana
Western Atlantic
Morning12° 30.097 N81° 43.882 W
http://www.google.com/maps/place/12° 30.097 N81° 43.882 W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
53
ChaenopsidaeAcanthemblemariagreenfieldiFL0828FL0828Whole specimen tissueCO-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-12/FL-828A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-12/FL-828B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-12/FL-828C.JPG
U. Nacional de Colombia
RFL01F009C8
Whole specimen
Ethanol216/6/16Colombia
San Andres & Providencia
San Andres
Shore dive at Nirvana
Western Atlantic
Morning12° 30.097 N81° 43.882 W
http://www.google.com/maps/place/12° 30.097 N81° 43.882 W/data=!3m1!1e3
12Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
54
ChaenopsidaeAcanthemblemariamariaFL0917FL0917Whole specimen tissueCO-2016-15
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-917A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-917B.JPG
U. Nacional de Colombia
RFL01F010B7
Whole specimen
Ethanol276/8/16Colombia
San Andres & Providencia
San Andres
Shore dive near Nirvana (el velerito)
Western Atlantic
Morning12.49972 N81.73233 W
http://www.google.com/maps/place/12.49972 N81.73233 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
55
ChaenopsidaeAcanthemblemariaspinosaFL0935FL0935Whole specimen tissueCO-2016-15
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-935A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-935B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-935C.JPG
U. Nacional de Colombia
RFL01F010D5
Whole specimen
Ethanol226/8/16Colombia
San Andres & Providencia
San Andres
Shore dive near Nirvana (el velerito)
Western Atlantic
Morning12.49972 N81.73233 W
http://www.google.com/maps/place/12.49972 N81.73233 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
56
ChaenopsidaeAcanthemblemariamariaFL1007FL1007Whole specimen tissueCO-2016-15
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-1007A.JPG
U. Nacional de Colombia
RFL01F011A7
Whole specimen tissue
Ethanol286/9/16Colombia
San Andres & Providencia
San Andres
Shore dive near Nirvana (el velerito)
Western Atlantic
Morning12.49404 N81.73524 W
http://www.google.com/maps/place/12.49404 N81.73524 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
57
ChaenopsidaeAcanthemblemariagreenfieldiFL1012FL1012Whole specimen tissueCO-2016-15
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-1012A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-1012B.JPG
U. Nacional de Colombia
RFL01F011B2
Whole specimen
Ethanol216/9/16Colombia
San Andres & Providencia
San Andres
Shore dive near Nirvana (el velerito)
Western Atlantic
Morning12.49404 N81.73524 W
http://www.google.com/maps/place/12.49404 N81.73524 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
58
ChaenopsidaeAcanthemblemariasp.FL1016FL1016Whole specimen tissueCO-2016-15
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-15/FL-1016A.JPG
U. Nacional de Colombia
RFL01F011B6
Whole specimen
Ethanol176/9/16Colombia
San Andres & Providencia
San Andres
Shore dive near Nirvana (el velerito)
Western Atlantic
Morning12.49404 N81.73524 W
http://www.google.com/maps/place/12.49404 N81.73524 W/data=!3m1!1e3
15Reef
SCUBA: clove oil
R.BetancurD.ArcilaA.AceroE.RibeiroC.PedrazaR.Rivero
59
ChaenopsidaeAcanthemblemariaspinosaFL1071FL1071Whole specimen tissuePR-2016-15
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-15/FL-1071A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-15/FL-1071B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-15/FL-1071C.JPG
OU-RH116RFL01F011H1
Whole specimen
Ethanol186/18/16Puerto RicoPuerto RicoLoizaPiñones
Western Atlantic
Morning18° 27.640 N65° 59.520 W
http://www.google.com/maps/place/18° 27.640 N65° 59.520 W/data=!3m1!1e3
5
SCUBA: clove oil
R.BetancurA.AceroE.RibeiroC.Pedraza
60
ChaenopsidaeAcanthemblemariamariaFL1084FL1084Whole specimen tissuePR-2016-18
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1084A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1084B.JPG
OU-RH116RFL01F011I4
Whole specimen
Ethanol236/23/16Puerto RicoPuerto RicoAguadillaEl Natural
Western Atlantic
Morning18° 27.785'N67° 10.075'W
http://www.google.com/maps/place/18° 27.785'N67° 10.075'W/data=!3m1!1e3
20
SCUBA: clove oil
D.ArcilaA.AceroE.RibeiroC.PedrazaG.Orti
61
ChaenopsidaeAcanthemblemariamariaFL1085FL1085Whole specimen tissuePR-2016-18
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1085A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1085B.JPG
OU-RH116RFL01F011I5
Whole specimen
Ethanol206/23/16Puerto RicoPuerto RicoAguadillaEl Natural
Western Atlantic
Morning18° 27.785'N67° 10.075'W
http://www.google.com/maps/place/18° 27.785'N67° 10.075'W/data=!3m1!1e3
20
SCUBA: clove oil
D.ArcilaA.AceroE.RibeiroC.PedrazaG.Orti
62
ChaenopsidaeAcanthemblemariamariaFL1087FL1087Whole specimen tissuePR-2016-18
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1087A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1087B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1087C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1087D.JPG
OU-RH116RFL01F011I7
Whole specimen
Ethanol206/23/16Puerto RicoPuerto RicoAguadillaEl Natural
Western Atlantic
Morning18° 27.785'N67° 10.075'W
http://www.google.com/maps/place/18° 27.785'N67° 10.075'W/data=!3m1!1e3
20
SCUBA: clove oil
D.ArcilaA.AceroE.RibeiroC.PedrazaG.Orti
63
ChaenopsidaeAcanthemblemariamariaFL1088FL1088Whole specimen tissuePR-2016-18
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1088A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-18/FL-1088B.JPG
OU-RH116RFL01F011I8
Whole specimen
Ethanol246/23/16Puerto RicoPuerto RicoAguadillaEl Natural
Western Atlantic
Morning18° 27.785'N67° 10.075'W
http://www.google.com/maps/place/18° 27.785'N67° 10.075'W/data=!3m1!1e3
20
SCUBA: clove oil
D.ArcilaA.AceroE.RibeiroC.PedrazaG.Orti
64
ChaenopsidaeAcanthemblemariaasperaFL1171FL1171Whole specimen tissuePR-2016-23
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1171A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1171B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1171C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1171D.JPG
OU-RH116RFL01F012H1
Whole specimen tissue
Ethanol229/2/2016Puerto RicoPuerto RicoGuanica
La Pared near Playa Santa
Western Atlantic
Morning17.89863° N66.94365° W
http://www.google.com/maps/place/17.89863° N66.94365° W/data=!3m1!1e3
20Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.Rivero
65
ChaenopsidaeAcanthemblemariaasperaFL1173FL1173Whole specimen tissuePR-2016-23
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1173A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1173B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1173C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1173D.JPG
OU-RH116RFL01F012H3
Whole specimen tissue
Ethanol119/2/2016Puerto RicoPuerto RicoGuanica
La Pared near Playa Santa
Western Atlantic
Morning17.89863° N66.94365° W
http://www.google.com/maps/place/17.89863° N66.94365° W/data=!3m1!1e3
20Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.Rivero
66
ChaenopsidaeAcanthemblemariaasperaFL1174FL1174Whole specimen tissuePR-2016-23
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1174A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1174B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1174C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-23/FL-1174D.JPG
OU-RH116RFL01F012H4
Whole specimen tissue
Ethanol209/2/2016Puerto RicoPuerto RicoGuanica
La Pared near Playa Santa
Western Atlantic
Morning17.89863° N66.94365° W
http://www.google.com/maps/place/17.89863° N66.94365° W/data=!3m1!1e3
20Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.Rivero
67
ChaenopsidaeAcanthemblemariaasperaFL1186FL1186Whole specimen tissuePR-2016-24
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1186A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1186B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1186D.JPG
OU-RH116RFL01F012I6
Whole specimen tissue
Ethanol1811/4/2016Puerto RicoPuerto RicoLajas
La Pared (La Boya Vieja) near La Parguera
Western Atlantic
Morning17.88831° N66.99803° W
http://www.google.com/maps/place/17.88831° N66.99803° W/data=!3m1!1e3
20Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.Rivero
68
ChaenopsidaeAcanthemblemariaasperaFL1188FL1188Whole specimen tissuePR-2016-24
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1188A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1188B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1188C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1188D.JPG
OU-RH116RFL01F012I8
Whole specimen tissue
Ethanol2411/4/2016Puerto RicoPuerto RicoLajas
La Pared (La Boya Vieja) near La Parguera
Western Atlantic
Morning17.88831° N66.99803° W
http://www.google.com/maps/place/17.88831° N66.99803° W/data=!3m1!1e3
20Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.Rivero
69
ChaenopsidaeAcanthemblemariaasperaFL1190FL1190Whole specimen tissuePR-2016-24
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1190A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1190B.JPG
OU-RH116RFL01F012I10
Whole specimen tissue
Ethanol2011/4/2016Puerto RicoPuerto RicoLajas
La Pared (La Boya Vieja) near La Parguera
Western Atlantic
Morning17.88831° N66.99803° W
http://www.google.com/maps/place/17.88831° N66.99803° W/data=!3m1!1e3
20Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.Rivero
70
ChaenopsidaeAcanthemblemariaasperaFL1192FL1192Whole specimen tissuePR-2016-24
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1192A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1192B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1192C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2016-24/FL-1192D.JPG
OU-RH116RFL01F012J3
Whole specimen tissue
Ethanol1811/4/2016Puerto RicoPuerto RicoLajas
La Pared (La Boya Vieja) near La Parguera
Western Atlantic
Morning17.88831° N66.99803° W
http://www.google.com/maps/place/17.88831° N66.99803° W/data=!3m1!1e3
20Reef
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.Rivero
71
ChaenopsidaeAcanthemblemariamacrospilusFL1280FL1280CPUM-13130MX-2016-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1280A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1280B.JPG
OU-RH116RFL01F013I1Pectoral finEthanol3412/10/2016MexicoGuerreroZihuatanejo
La Caleta de Chon
Eastern PacificAfternoon17° 36.940'N101° 33.262'W
http://www.google.com/maps/place/17° 36.940'N101° 33.262'W/data=!3m1!1e3
12Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL01F06
72
ChaenopsidaeAcanthemblemariamacrospilusFL1282FL1282CPUM-13130MX-2016-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1282A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1282B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-03/FL-1282D.JPG
OU-RH116RFL01F013I3Pectoral finEthanol3412/10/2016MexicoGuerreroZihuatanejo
La Caleta de Chon
Eastern PacificAfternoon17° 36.940'N101° 33.262'W
http://www.google.com/maps/place/17° 36.940'N101° 33.262'W/data=!3m1!1e3
12Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL01F08
73
ChaenopsidaeAcanthemblemariahancockiFL1391FL1391CPUM-5222MX-2016-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1391A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1391B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1391C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-05/FL-1391D.JPG
OU-RH116RFL01F014J2
Pectoral, pelvic fins
Ethanol3812/12/2016MexicoGuerreroZihuatanejo
Morros de Potosi
Eastern PacificMorning17.53309° N101.48900° W
http://www.google.com/maps/place/17.53309° N101.48900° W/data=!3m1!1e3
15Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.
Dominguez et al. (research team)
MX-2016-PL02G03
74
ChaenopsidaeAcanthemblemariasp.FL1537FL1537Photo voucher onlyMX-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1537A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1537B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1537C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1537D.JPG
OU-RH116RFL02F016D8Pectoral finEthanol2612/15-17/2016MexicoMichoacanAquila
La Manzanillera; ship wreck at Faro de Bucerias
Eastern Pacific
Morning, afternoon
18.35276° N103.52207° W
http://www.google.com/maps/place/18.35276° N103.52207° W/data=!3m1!1e3
20
Rocky reef (ship wreck)
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.Dominguez et al. (research team)MX-2016-PL04C09
75
ChaenopsidaeAcanthemblemariasp.FL1578FL1578Whole specimen tissueMX-2016-13
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-13/FL-1578A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-13/FL-1578B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-13/FL-1578C.JPG
OU-RH116RFL02F016H9
Whole specimen tissue
Ethanol1712/16/2016MexicoMichoacanAquila
"Bajo" near La Manzanillera
Eastern PacificMorning18.37141° N103.52720° W
http://www.google.com/maps/place/18.37141° N103.52720° W/data=!3m1!1e3
20Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaO.Dominguez et al. (research team)MX-2016-PL04G02
76
ChaenopsidaeAcanthemblemariamacrospilusFL1609FL1609CPUM-5221MX-2016-12
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1609A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1609B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1609C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/MX-2016-12/FL-1609D.JPG
OU-RH116RFL02F017A10Pectoral finEthanol3812/15-17/2016MexicoMichoacanAquila
La Manzanillera; ship wreck at Faro de Bucerias
Eastern Pacific
Morning, afternoon
18.35276° N103.52207° W
http://www.google.com/maps/place/18.35276° N103.52207° W/data=!3m1!1e3
20
Rocky reef (ship wreck)
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaR.RiveroO.Dominguez et al. (research team)MX-2016-PL05A11
77
ChaenopsidaeAcanthemblemariaexilispinusFL1691FL1691Universidad de los AndesCO-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1691A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1691B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1691C.JPG
Universidad de los Andes
RFL02F017J2Pectoral finEthanol441/24,29/2017ColombiaChocoNuqui
Piedra Wacha near Playa Parguera, Cabo Corrientes
Eastern PacificMorning5.60546° N77.49783° W
http://www.google.com/maps/place/5.60546° N77.49783° W/data=!3m1!1e3
15Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01C12
78
ChaenopsidaeAcanthemblemariaexilispinusFL1710FL1710Universidad de los AndesCO-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1710A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1710B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1710C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-02/FL-1710D.JPG
Universidad de los Andes
RFL02F018B1Pectoral finEthanol441/24,29/2017ColombiaChocoNuqui
Piedra Wacha near Playa Parguera, Cabo Corrientes
Eastern PacificMorning5.60546° N77.49783° W
http://www.google.com/maps/place/5.60546° N77.49783° W/data=!3m1!1e3
15Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01E07
79
ChaenopsidaeAcanthemblemariahancockiFL1739FL1739Whole specimen tissueCO-2017-03
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-03/FL-1739A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-03/FL-1739B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-03/FL-1739C.JPG
Universidad de los Andes
RFL02F018D10
Whole specimen tissue
Ethanol251/24/2017ColombiaChocoNuqui
La Ronosa, Cabo Corrientes
Eastern PacificMorning5.58628° N77.50771° W
http://www.google.com/maps/place/5.58628° N77.50771° W/data=!3m1!1e3
10Rocky reef
SCUBA: quinaldine
R.BetancurE.RibeiroD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL01G12
80
ChaenopsidaeAcanthemblemariahancockiFL1828FL1828Whole specimen tissueCO-2017-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1828A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1828B.JPG
Universidad de los Andes
RFL02F019C9
Whole specimen tissue
Ethanol281/28/2017ColombiaChocoNuqui
Rompe Botes (= Ronosita), Cabo Corrientes
Eastern PacificAfternoon5.58438° N77.50698° W
http://www.google.com/maps/place/5.58438° N77.50698° W/data=!3m1!1e3
15Rocky reef
SCUBA: quinaldine
R.BetancurD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL02G07
81
ChaenopsidaeAcanthemblemariahancockiFL1830FL1830Whole specimen tissueCO-2017-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1830A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1830B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1830C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1830D.JPG
Universidad de los Andes
RFL02F019D1
Whole specimen tissue
Ethanol321/28/2017ColombiaChocoNuqui
Rompe Botes (= Ronosita), Cabo Corrientes
Eastern PacificAfternoon5.58438° N77.50698° W
http://www.google.com/maps/place/5.58438° N77.50698° W/data=!3m1!1e3
15Rocky reef
SCUBA: quinaldine
R.BetancurD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL02G09
82
ChaenopsidaeAcanthemblemariaexilispinusFL1832FL1832Universidad de los AndesCO-2017-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1832A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1832B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1832C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1832D.JPG
Universidad de los Andes
RFL02F019D3Pectoral finEthanol431/28/2017ColombiaChocoNuqui
Rompe Botes (= Ronosita), Cabo Corrientes
Eastern PacificAfternoon5.58438° N77.50698° W
http://www.google.com/maps/place/5.58438° N77.50698° W/data=!3m1!1e3
15Rocky reef
SCUBA: quinaldine
R.BetancurD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL02G11
83
ChaenopsidaeAcanthemblemariacf. perlaFL1833FL1833Whole specimen tissueCO-2017-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1833A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1833B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1833C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1833D.JPG
Universidad de los Andes
RFL02F019D4
Whole specimen tissue
Ethanol351/28/2017ColombiaChocoNuqui
Rompe Botes (= Ronosita), Cabo Corrientes
Eastern PacificAfternoon5.58438° N77.50698° W
http://www.google.com/maps/place/5.58438° N77.50698° W/data=!3m1!1e3
15Rocky reef
SCUBA: quinaldine
R.BetancurD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL02G12
84
ChaenopsidaeAcanthemblemariaexilispinusFL1838FL1838Universidad de los AndesCO-2017-09
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1838A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1838B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2017-09/FL-1838C.JPG
Universidad de los Andes
RFL02F019D9Pectoral finEthanol401/28/2017ColombiaChocoNuqui
Rompe Botes (= Ronosita), Cabo Corrientes
Eastern PacificAfternoon5.58438° N77.50698° W
http://www.google.com/maps/place/5.58438° N77.50698° W/data=!3m1!1e3
15Rocky reef
SCUBA: quinaldine
R.BetancurD.ArcilaC.PedrazaG.OrtiO.
Dominguez et al. (research team)
CO-2017-PL02H05
85
ChaenopsidaeAcanthemblemariacastroiFL1928FL1928CPUM-XXX (UMSNH voucher 50568)GA-2017-PM03
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1928A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1928B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1928C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1928D.JPG
UMSNHRFL02F020C9Pectoral finEthanol432/10/17Ecuador
Provincia de Galapagos
Pinta IslandPunta NerusEastern PacificAfternoon0.62766° N90.754125° W
http://www.google.com/maps/place/0.62766° N90.754125° W/data=!3m1!1e3
13
Rocky reef and sandy bottom
Clove oilD.ArcilaO.
Dominguez et al. (research team)
GA-2017-PL02C10
86
ChaenopsidaeAcanthemblemariacastroiFL1930FL1930CPUM-XXX (UMSNH voucher 50570)GA-2017-PM03
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1930A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1930B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1930C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM03/FL-1930D.JPG
UMSNHRFL02F020D1Pectoral finEthanol302/10/17Ecuador
Provincia de Galapagos
Pinta IslandPunta NerusEastern PacificAfternoon0.62766° N90.754125° W
http://www.google.com/maps/place/0.62766° N90.754125° W/data=!3m1!1e3
13
Rocky reef and sandy bottom
Clove oilD.ArcilaO.
Dominguez et al. (research team)
GA-2017-PL02C12
87
ChaenopsidaeAcanthemblemariacastroiFL1937FL1937CPUM-XXX (UMSNH voucher 52592)GA-2017-PM04
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM04/FL-1937A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM04/FL-1937B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM04/FL-1937C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-PM04/FL-1937D.JPG
UMSNHRFL02F020D8Pectoral finEthanol392/11/17Ecuador
Provincia de Galapagos
Marchena Island
Cuevas de Lobos
Eastern PacificMorning0.277671° N90.483492° W
http://www.google.com/maps/place/0.277671° N90.483492° W/data=!3m1!1e3
15
Rocky reef and sandy bottom
Clove oilD.ArcilaO.
Dominguez et al. (research team)
GA-2017-PL02D07
88
ChaenopsidaeAcanthemblemariacastroiFL1997FL1997CPUM-XXX (UMSNH voucher 50492)GA-2017-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-01/FL-1997A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-01/FL-1997B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-01/FL-1997C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-01/FL-1997D.JPG
UMSNHRFL02F020J8
Pelvic fin, muscle
Ethanol352/7/2017Ecuador
Provincia de Galapagos
Isabela Island (nearby)
Union RockEastern PacificAfternoon1° 2.421'S91° 5.622'W
http://www.google.com/maps/place/1° 2.421'S91° 5.622'W/data=!3m1!1e3
8Rocky reef
SCUBA: Clove oil
O.
Dominguez et al. (research team)
GA-2017-PL01A03
89
ChaenopsidaeAcanthemblemariacastroiFL2001FL2001CPUM-XXX (UMSNH voucher 50493)GA-2017-01
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-01/FL-2001A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-01/FL-2001B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-01/FL-2001C.JPG
UMSNHRFL02F021A2
Pelvic fin, muscle
Ethanol442/7/2017Ecuador
Provincia de Galapagos
Isabela Island (nearby)
Union RockEastern PacificAfternoon1° 2.421'S91° 5.622'W
http://www.google.com/maps/place/1° 2.421'S91° 5.622'W/data=!3m1!1e3
8Rocky reef
SCUBA: Clove oil
O.
Dominguez et al. (research team)
GA-2017-PL01A07
90
ChaenopsidaeAcanthemblemariacastroiFL2004FL2004CPUM-XXX (UMSNH voucher 49616)GA-2017-02
http://makaira.hpcf.upr.edu/~fishlab/Photos/GA-2017-02/FL-2004A.JPG
UMSNHRFL02F021A5MuscleEthanol382/8/2017Ecuador
Provincia de Galapagos
Baltra Island (nearby)
Gordon RocksEastern PacificMorning0° 33.992'S90° 8.600'W
http://www.google.com/maps/place/0° 33.992'S90° 8.600'W/data=!3m1!1e3
15Rocky reef
SCUBA: Clove oil
R.RiveroO.
Dominguez et al. (research team)
GA-2017-PL01A10
91
ChaenopsidaeAcanthemblemariaspinosaFL2319FL2319Photo voucher onlyPR-2018-04
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-04/FL-2319A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-04/FL-2319B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-04/FL-2319C.JPG
OU-RH116RFL02F024B9MuscleEthanol16.53/5/2018Puerto RicoPuerto RicoLajas
Weinberg (La Pared), La Parguera
Western Atlantic
Morning17.89021° N66.98869° W
http://www.google.com/maps/place/17.89021° N66.98869° W/data=!3m1!1e3
35
Coral reef (outer reef)
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.RiveroO.
Dominguez
PR-2018-PL01C03
92
ChaenopsidaeAcanthemblemariachapliniFL2349FL2349Photo voucher onlyPR-2018-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-06/FL-2349A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-06/FL-2349B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-06/FL-2349C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-06/FL-2349D.JPG
OU-RH116RFL02F024E9MuscleEthanol153/6/2018Puerto RicoPuerto RicoGuanica
La Boya Vieja (La Pared)
Western Atlantic
Morning17.88820° N66.99799° W
http://www.google.com/maps/place/17.88820° N66.99799° W/data=!3m1!1e3
30
Coral reef (outer reef)
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.RiveroO.
Dominguez
PR-2018-PL01E09
93
ChaenopsidaeAcanthemblemariaspinosaFL2372FL2372Whole specimen tissuePR-2018-08
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2372A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2372B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2372C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2372D.JPG
OU-RH116RFL02F024H2
Whole specimen tissue
Ethanol223/7/2018Puerto RicoPuerto RicoGuanica
La Pared, Guanica
Western Atlantic
Afternoon & night
17.89519° N66.97493° W
http://www.google.com/maps/place/17.89519° N66.97493° W/data=!3m1!1e3
30
Coral reef (outer reef)
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.RiveroO.
Dominguez
PR-2018-PL01G08
94
ChaenopsidaeAcanthemblemariaasperaFL2374FL2374Photo voucher onlyPR-2018-08
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2374A.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2374B.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2374C.JPG
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2018-08/FL-2374D.JPG
OU-RH116RFL02F024H4Half specimenEthanol16.53/7/2018Puerto RicoPuerto RicoGuanica
La Pared, Guanica
Western Atlantic
Afternoon & night
17.89519° N66.97493° W
http://www.google.com/maps/place/17.89519° N66.97493° W/data=!3m1!1e3
30
Coral reef (outer reef)
SCUBA: clove oil
R.BetancurD.ArcilaE.RibeiroC.PedrazaR.RiveroO.
Dominguez
PR-2018-PL01G10
95
LabrisomidaeAcanthemblemariaspinosaFL2513FT133SNOMNHPRMN-2019-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2513A.jpg
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2513B.jpg
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2513C.jpg
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2513D.jpg
F026H09Pectoral finEthanol22.655/16/2019Puerto RicoPuerto RicoMona Island
Pajaros WPT No. 389
Western Atlantic
Afternoon18.0551464° N
67.86252712° W
http://www.google.com/maps/place/18.0551464° N67.86252712° W/data=!3m1!1e3
15.5Coral reef
SCUBA: quinaldine
D.ArcilaC.PedrazaE.Troyer
PRMN-2019-PL01
H09
96
LabrisomidaeAcanthemblemariaasperaFL2515FT135SNOMNHPRMN-2019-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2515A.jpg
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2515B.jpg
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2515C.jpg
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2515D.jpg
F026TBD
Pelvic, pectoral fins
Ethanol17.385/16/2019Puerto RicoPuerto RicoMona Island
Pajaros WPT No. 389
Western Atlantic
Afternoon18.0551464° N
67.86252712° W
http://www.google.com/maps/place/18.0551464° N67.86252712° W/data=!3m1!1e3
15.5Coral reef
SCUBA: quinaldine
D.ArcilaC.PedrazaE.Troyer
PRMN-2019-PL01
TBD
97
LabrisomidaeAcanthemblemariaspinosaFL2517FT139SNOMNHPRMN-2019-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2517A.jpg
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2517B.jpg
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2517C.jpg
http://makaira.hpcf.upr.edu/~fishlab/Photos/PRMN-2019-05/FL-2517D.jpg
F026TBD
Pelvic, pectoral fins
Ethanol25.465/16/2019Puerto RicoPuerto RicoMona Island
Pajaros WPT No. 389
Western Atlantic
Afternoon18.0551464° N
67.86252712° W
http://www.google.com/maps/place/18.0551464° N67.86252712° W/data=!3m1!1e3
15.5Coral reef
SCUBA: quinaldine
D.ArcilaC.PedrazaE.Troyer
PRMN-2019-PL01
TBD
98
OstraciidaeAcanthostracionquadricornisFL0075FL0075MZUPRRP-I-00292PR-2015-05
http://makaira.hpcf.upr.edu/~fishlab/Photos/PR-2015-05/FL-75A.JPG
OU-RH116RFL01F001H5Pectoral FinEthanol161.68/31/2015Puerto RicoPuerto RicoGuanica
Las Pelotas, Playa Saila
Western Atlantic
Morning17°53.345 N66°57.252 W
http://www.google.com/maps/place/17°53.345 N66°57.252 W/data=!3m1!1e3
12-18
Reef (with local fishermen)
SCUBA: spear
E.Ribeiro
Fisherman
7G03low quality DNALQ2016-07
99
OstraciidaeAcanthostracionquadricornisFL0729FL0729INVEMAR-PEC-9703CO-2016-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-06/FL-729A.JPG
U. Nacional de Colombia
RFL01F008C9Pectoral FinEthanol2306/2/16ColombiaMagdalenaSanta Marta
Bahía de Gayraca, Parque Nacional Natural Tayrona
Western Atlantic
Morning11° 19.720 N74° 6.936 W
http://www.google.com/maps/place/11° 19.720 N74° 6.936 W/data=!3m1!1e3
15Reef
SCUBA: spear
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza
100
OstraciidaeAcanthostracionquadricornisFL0741FL0741INVEMAR-PEC-9703CO-2016-06
http://makaira.hpcf.upr.edu/~fishlab/Photos/CO-2016-06/FL-741A.JPG
U. Nacional de Colombia
RFL01F008E1Ethanol2386/2/16ColombiaMagdalenaSanta Marta
Bahía de Gayraca, Parque Nacional Natural Tayrona
Western Atlantic
Morning11° 19.720 N74° 6.936 W
http://www.google.com/maps/place/11° 19.720 N74° 6.936 W/data=!3m1!1e3
15Reef
SCUBA: spear
R.BetancurD.ArcilaA.AceroE.RibeiroC.Pedraza