gencodes
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBM
1
RNA codonUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAGUGUUGCUGAUGGCUUCUCCUACUGCCUCCCCCACCGCAUCACCAACAGCGUCGCCGACGGAUUAUCAUAAUGACUACCACAACGAAUAACAAAAAGAGUAGCAGAAGGGUUGUCGUAGUGGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGG
2
DNA Base1 TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
3
DNA Base2 TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
4
DNA Base3 TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
5
1 (Standard)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
6
Starts / stops Start STOPSTOP STOP Start Start
7
2 (Vertebrate mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucine
Methionine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
8
STOPSTOP StartStartStartStart STOPSTOP Start
9
3 (Yeast mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
Tryptophan
Threonine
Threonine
Threonine
Threonine
ProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucine
Methionine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
10
STOPSTOP StartStart
11
4 (Mold, protozoan, coelenterate mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
12
StartStart STOPSTOP Start StartStartStartStart Start
13
5 (Invertebrate mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucine
Methionine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
SerineSerineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
14
Start STOPSTOP StartStartStartStart Start
15
6 (Ciliate, Dasycladacean and Hexamita Nuclear)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosineGlutamineGlutamine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
16
STOP Start
17
9 (Echinoderm and Flatworm mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
Asparagine
Lysine
Serine
Serine
SerineSerineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
18
STOPSTOP Start Start
19
10 (Euplotid Nuclear)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
20
STOPSTOP Start
21
11 (The Bacterial, Archaeal and Plant Plastid Code)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
22
Start STOPSTOP STOP Start StartStartStartStart Start
23
12 (Alternative Yeast Nuclear)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineSerineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
24
STOPSTOP STOP Start Start
25
13 (Ascidian mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucine
Methionine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
GlycineGlycineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
26
Start STOPSTOP StartStart Start
27
14 (Alternative Flatworm mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosineTyrosine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
Asparagine
Lysine
Serine
Serine
SerineSerineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
28
STOP Start
29
15 (Chlorophycean mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosineLeucine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
30
STOP STOP Start
31
21 (Trematode mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucine
Methionine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
Asparagine
Lysine
Serine
Serine
SerineSerineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
32
STOPSTOP Start Start
33
22 (Scenedesmus obliquus mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
TyrosineTyrosineLeucine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
34
STOP STOP STOP Start
35
23 (Thraustochytrium mitochondrial)
Phenylalanine
Phenylalanine
Leucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
36
STOP STOPSTOP STOP Start Start Start
37
24 (Pterobranchia mitochondrial)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
SerineLysineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
38
Start STOPSTOP Start Start Start
39
25 (Candidate Division SR1 and Gracilibacteria)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Glycine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
40
Start STOPSTOP Start Start
41
26 (Pachysolen tannophilus Nuclear)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineAlanineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
42
STOPSTOP STOP Start Start
43
27 (Karyorelict Nuclear)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosineGlutamineGlutamine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
44
STOP Start
45
28 (Condylostoma Nuclear)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosineGlutamineGlutamine
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
46
STOPSTOP STOP Start
47
29 (Mesodinium Nuclear)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosineTyrosineTyrosine
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
48
STOP Start
49
30 (Peritrich Nuclear)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Glutamic acid
Glutamic acid
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
50
STOP Start
51
31 (Blastocrithidia Nuclear)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosine
Glutamic acid
Glutamic acid
Cysteine
Cysteine
Tryptophan
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
52
STOPSTOP Start
53
32 (Balanophoraceae Plastid)
Phenylalanine
Phenylalanine
LeucineLeucine
Serine
Serine
Serine
Serine
TyrosineTyrosineTryptophan
Cysteine
Cysteine
Tryptophan
LeucineLeucineLeucineLeucineProlineProlineProlineProlineHistidineHistidine
Glutamine
Glutamine
ArginineArginineArginineArginineIsoleucineIsoleucineIsoleucine
Methionine
Threonine
Threonine
Threonine
Threonine
Asparagine
Asparagine
LysineLysine
Serine
Serine
ArginineArginineValineValineValineValineAlanineAlanineAlanineAlanine
Aspartic acid
Aspartic acid
Glutamic acid
Glutamic acid
GlycineGlycineGlycineGlycine
54
Start STOPSTOP STOP Start StartStartStartStart Start
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
Loading...
Main menu