Annotated tac/tds Table (by MSU students)
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
 
ABCDEFGHIJ
1
tac/tds SiteAc/Ds insertionChromosomeSequence Adjacent to TE's 5'-end (RC)Pseudomolecule Location Next to 5'-end of TEAc/Ds orientationPCR Primer to Amplify TE's 5' JunctionGene ModelGene DescriptionWhere the sequence is located
2
901.32Ds1CCCGCGCGCACGAGACCGTGTCCGTGTTCGCCGGCTCCTACGGCTACATCGCGCCAGGTCAGTGTCAGTTGCCACGGCCCACGTGAACAGCGAGTTCTTCAGGCTCAACGCGATCTTGCACTGACGTCAATCTGG9807083ReverseGAGCCTGAAGAACTCGCTGTGRMZM2G009818Transcribed locus, weakly similar to NP_001053257.1 Os04g0506100 [Oryza sativa Japonica Group]Within the gene
3
902.22Ac1GTCGCATTGGCCATCCTGATCATGCGCCGCCGCCGCCGTCGTCGTCTGAACGAGTCCGAGGCACAGCGTCTGCTTGGAGAAGAGCATGTCACTGCTCCTAGCATCATAGGGCGGCGAGGGAGGGCTGATATGCAGCGAGAGGTCGGGGGCTGCAGCAGCAGTAGTAGCCATTGTGCAACGACAAGTTTCTGCTGCTGCACTTGTGAATTGGCAGCAGGTCCAGCCTTGTCGCCTGTTCTTACTCGAAGGGG254253043ReverseGGACTCGTTCAGACGACGACGRMZM2G039074Putative uncharacterized proteinWithin the gene
4
902.33Ac1CATGCCGTAGTCCACCTTGTACCAGAAGTTGGCCCGGTTCTCGGCGGGGTAGTAGTAGTAGGTCTCGGCGGGGACGCCGCACTCGCCGCCCGAGTCCATCACGTCCCAGAACGCCGCCGTGTCGGGCCAGTCCCGCTCGTGGTTGCCGCTGCCCACCATGTAGGGCTTGCGGGCGGTGATG195332149ForwardGTTCTGGGACGTGATGGACTGRMZM2G136453Putative uncharacterized proteinWithin the gene
5
906.19Ds1CTGGCCATGAAAGCCCGCCAGGGGAAGCCGTGATTTTGAGACAATCAGAATGCACGTTCCAATTACAATAAGTAGAGCTGCATGCGTGACGAATCCATGTCATCTTCATCGTGAACCCTTAACCATTTATCAGGCATTTATAATTGGATCCACATACGTATGTTGTTGTTGATGATGATGATGATGATCACAAAGGATTTAACTTCTAAGGATGACAACACATGAATTGTACTAGAAAGAAACGCAACAATTCCAGACTCCAAGAACAACAGCACGACTCGTTTCCAGGCTCTAAGTTCTATCGA297377325ReverseTCACGCATGCAGCTCTACTT GRMZM2G369912Putative uncharacterized proteinWithin the gene
6
907.12Ac1CTTCGACATGCCCGGATGCTCCTGCGCGCGTGTGCTCAGCAGAGAGAGATTCGACAGCGCACAATCGTACAAAGTGTTTTGCGCATTCTTTTTAGCTACTGAAATCGCAGATTTTTGCGCATTTCTGAAACTGAAATTGCAGACAGATATGATGCATACCTTGAGGTAAACGTCGATGGCGCGGTAGAGCGC162463336ForwardGTGCGCTGTCGAATCTCTCTGRMZM2G476637Putative uncharacterized proteinWithin the gene
7
907.20Ac1GACACGGAAGGGTCGGGTCTCGGGTGGAGAAAGGGGACTTTGTACGTAGGGGGACGTGGCGTGGCTGCGACGTATGTAGTAGGCTTGGAGGCAGAGGCGACAATGAGAGAAAGGAGTGTGAGCCATTGTAATTCATCTAATTTTCTTCATCGGTCGGCGGTGCT199111495ReverseCTCTCATTGTCGCCTCTGCGRMZM2G113191Carbonic anhydraseIntergenic region (.762 kbps away from gene)
8
907.37Ac1CTCGGAGCGGGGGGACGAAATGAAGCGCAAAGCGGAGCGGAACAAAGCGGGCAAGGGGATTGCACACTTGCAGCGTTGGTTCATGTTCATGATGAGTTCTCGTGGCTCGTGTTTATACTAGACTAGAGAGACGGGAAAAAATGAAATGAGAGTGCTTTT47597170ReverseAAACACGAGCCACGAGAACTGRMZM2G427418Transcribed locus, moderately similar to NP_001168327.1 hypothetical protein LOC100382095 [Zea mays]Intergenic region (.089 kbps away from gene )
9
907.38Ac1CCAGTGGAGGAGGCTCGCTGCGGGTTGGTGACGAGTCTTGGGCGGCGGGGGCGCAGAAGGCGTCGCGCGTGAAAAGGGTCGGAGGAGGGGAGGTAGGTGAGGGGAAAAAATGAAACAAATGCTAAATTGGTAAGTGAGTAAGTGACACATGGTGCCCACCTAATCAAATCATATCAGTTTAAACTTTACA47474757ReverseCTCCTCCGACCCTTTTCACGRMZM2G300685No gene function listedWithin the gene
10
917.11Ds1TTTACAAGAGACGTGGCTAAGTTTTTGGAGTGGTCGCTTGGTCGTTTGCAGGGGACTGGCGGGGAGTTCGAAGAGGA53164931ForwardCAAGCGACCACTCCAAAAACGRMZM2G107481Putative uncharacterized proteinIntergenic region (.010 kbps away from the gene)
11
919.14Ds1CCTTCCACTACCCTGCCTCCTCTCCCTTCTTGCCCCCCGCGCCTCGCCCCTCTT296774733ReverseAGAAGGGAGAGGAGGCAGGGTAGTGRMZM2G170137Putative uncharacterized proteinWithin the gene
12
919.17Ac1GTGGCAGCGTCCCTGAGTGCCTGCCCGTCGTCGACGGCGAGCTCGTCCCGTGGGAGCTCATCGGACATTGAGATCCAGGTGCTGTTCCAGGGGGGCGACGACGACGACTACTACGGTGACGATGGCTCCACGACGACGTCGCCGGCGGCAGCGTGGTCGCGCAG88969217ReverseTCGACGACGGGCAGGCACTCAGRMZM2G089285Within the gene
13
921.26Ds1CCGGCGGGGCAGAGCCTGAGCCCGCAGAGCTGCTTGTGCGCGTACCCGTACCAGGGCGTCATGTACTTCCGCGCACCCTTCTTCCACGACGTGGCCAACGACACGGCGTTCCAGGAGCTGGAGAGCATGCTGTGGACCAAGCTGGCCCTCACC54277901ReverseGAAGTACATGACGCCCTGGTGRMZM2G023715Putative uncharacterized proteinWithin the gene
14
922.05Ds1TACCTGTCCGGCTCCAGCTGATAAGCACTGATGGTGCGAGTTAGAGAAAGTATACATGTTTATTTGGCTTTAATCTATACCAGTCTCTACTGCTTCTAAAATATTTTTGTCTATATGAATTGCAGCAGCAGCAGTCTAAACAGCTGACTTTAATCT275228176ForwardTCGCACCATCAGTGCTTATCGRMZM2G169671TSA: Zea mays contig62594, mRNA sequenceIntergenic region (1.046 kbps away from the gene)
15
922.09Ds1CTCTTCCCCTCCCGAAAATCTTCTCGTCCCTCGTCCAACTCCTTCCCTCCCGCATATTTATTTTTCGTGTGAGAGATTCTTCTCCAATCTAGACCCCCTGCGAGGTACTTTACAAGCTGTACGACCCCTCCGCC GGACGAGGGACGAGAAGATT
16
922.09Ac1TGGCCATGTATAGCTCAGCGGAGCCTGTCACAAGATTCAGTAGGTTGGGCGACAGTGACACTCTGCTAGGAACTATTGAGGTGTTTGAGGTGTTTGGTTTGATGAATCACTCTATCCAAAATGAAGTGGTGTATATCTCAACGT30041870ReverseTCGCCCAACCTACTGAATCTGRMZM5G896413No gene function listedIntergenic region (.455 kbps away from the gene)
17
923.08Ac1CGGCTATCTCGGCACCACAAGACACCAAGAATTAATTTAAACGACTCACATTCAACATTACATTAATAAATTRRTTRCATATRRKRKBGCCAATTTAGCATAGCTCCGTTTCCAAGATTTTTGGCGATGTTATATACAaTTRATCTATTAACGTAGTGCTTGCAGGTGAATCATTCAAATTAATTTTTGGTGTCGAGCTTGGCACCACGACCTGTGGTGCCGAACGCAGCACTTGGTATCCCACCTCGACGCTAAGkGaTGGCACCGAGATGCATTACCTCGGTGCCATGGTTCGTGGCGTTGAAAAGGAATTCAACCTATTTGATGTTGAGGGATGCCTAATCGAATTCCCGSGGCCGCCATGGCGGCSGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAARCCCTgGSGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTTG6834053ReverseGRMZM2G092916No gene function listedWithin the gene
18
925.56Ac1GTTGCTGCTCCACATCATGTTCTCGTCAACGGCCTTCACCCTGGCCTCCGCAGTGGTTGTCAAGACGGCCTACACACTTACCATCTTCCTCCCTTGCTTTCTCGTCATGATCGACTTCTCCATCACCGTCGCCTGGTACTCCCTCGCTCAACGGTGTCTCAGCACACACGTTGTCGCTAGCGC201189994ForwardCGATCATGACGAGAAAGCAAGRMZM2G004190No gene function listedWithin the gene
19
931.08Ds1CCTCCCGTCGCCGCCTGAAACCGCGACAGCAAGGGTCGTAGGAGCAAGGACGACGACGAGAAGGCTCGGTTCGGCTCTTCCCAGTCTCTCCGAGGGAGGAAGGAGAGGATCGGAGGGTGCGATGGCGATCGACCACGAGTCCCCGTTCAAGGAGCTCCGCCTCAAGA98761179ForwardCTTCCTCCCTCGGAGAGACTGRMZM2G094168 Putative uncharacterized proteinIntergenic region (.124 kbps away from the gene)
20
931.13Ac1TTGTCTGGACATAAGTTTTGGATCTCACCGCTAGAAAACTGTCTGGCAGTGCATGGACTAATGCTACCCTTTAGTCCAGGCATTAGCGATTTAATT185466444ForwardTGCACTGCCAGACAGTTTTCGRMZM2G134202Putative uncharacterized proteinWithin the gene
21
906.52Ac2CCCGTCGGTGTGCAGCCGCATCCTCCTGCTCTCCCCATCTGACGCCGCCGCACCAACCCTGTCGTACATCTCATTTGCTGCGCAGAAGGATGAGCAAAGGAAGATGAAGCAGGCGAAAGCTAGAGGAGGACGAAGCGGCGCTTGAGAATCC29521919ReverseCTTTCGCCTGCTTCATCTTC GRMZM2G048366Putative uncharacterized proteinWithin the gene
22
906.73Ds2CAACTAACTAATGGCCGCCCCGGTCGCTTCATGCTGGAGGAATGCAGCAGCAGTGTTCTTTTTGACGTTACCTTAGTAGGGACACGGTGTAATTGGTTATTGGACCCGCTGTTTTTGTTTAGGTTC167363518ForwardGCGGGTCCAATAACCAATTAGRMZM5G872070Full-length cDNA clone ZM_BFb0236O04Within the gene
23
907.43Ac2TGTAGAGCTGGGCAGGGTAGTTGAGCCAGCAGCGCTAGGATAATCGCGTGTTCCATTGAGATCGAGCTGCGCGGTGGTATTGGTTGAAAGCTACGCTGACAGCGGGTCCTAGCGGCCAGAGGACAGAGGAGATAGCGCTAGAGTCCATCCGTGAGAGGCAGGCGAGTCGGGCCCATCTGCAAGTGACCGAGAGAATGGAAAACGGCGTGCAGGACTACGTGGGGTCGCGTGGCTGACATGTGGGCCCTGTGTTTCGGCGCATGGGCAAGCGCGAGGGGAGGTTGGGCTGCCTTGTA17875575ReverseCTCGATCTCAATGGAACACGGRMZM2G027891No gene function listedIntergenic region (4.045 kbps away from gene )
24
907.62Ac2CGTAGACCGACATATAGCAGCTACTAGCTAGCTGAAGCTCACATGGACAAGGGCGAATAATGCAGGGGTCGGCGGCGAGGGTGCTGCAGGACACGTGCAGCTACATCAGGAGCCTGCACCAGGAGGTGGACAACCTCAGCGAGACGCTGGCCGAGCTGCTCGCCTCCGCCGATGTCACCAGCG6190937ForwardCCCTTGTCCATGTGAGCTTC GRMZM2G072820Transcribed locus, strongly similar to XP_002448623.1 hypothetical protein SORBIDRAFT_06g030340 [Sorghum bicolor]Within the gene
25
918.02Ac2TTCCTGAGGCGGTTCGTTGCTGTGTCAATGGTGCCTCTTACATAGACGGCGTCACCAACGCCGCGCATCAAGGTCTCTTTATTCTTATATTGGTTTGTACGGGTTATACCAATAGCTTAGATTGTAGCTGATATGTTCAACTCATAGAGAGAGAGAGATTAATAGTTACATAGATGGRTCACATGTTCACATGGSTCATGATGATCAACCGCTAGCACATGCATGTACGGCTACCACCAGAGCTACTAGCTGTTGAKCATCGTGAGCTKGTGGTTAATGCATAAGGGGCTTGTGTCAAACTACTAGCACCAGAGCTGTATTTCTAGTCAGCTGCAACTGTTCTAGTCAGCTACAAGTGTAGTTATAACCTGCTCGABCGRCCAAAATCATCTBCTTCTACG28125899ReverseGRMZM2G483501No gene function listedIntergenic region (2.722 kbps away from the gene)
26
919.39Ac2TATGCGAATTTACGGGCAACGACGTACAAGAACTGCAACAATTTGATGTCGCCAAGGGAGGCCGGAATCGAACCGCTCAACGAATTCCTGTGGAGCTTCAGTT222681316ReverseTTGCCCGTAAATTCGCATAGRMZM2G015933BRASSINOSTEROID INSENSITIVE 1-associated receptor kinase 1Within the gene
27
923.17Ac2ATTCGACCBTCTTCGGAGAGCTTCYTTCTKTGTGCAGGWACTKTKTGATTGGGAGCCTGCAGGTGGCGTGGGCGCAGAWGKGGGGACATGTGGAGGGTCTGGTGAATTGTTGTCATAGCAATGAAGAAGAAGAAGAATAGGACTKGYAGTGGTTTGTGGGgATTCTGCAACCAAATsCTGGGgCTTCTGGCATGGGGGGTGATGATGAAAACAGTGAGGCCAACATGAGTGAGCTCATCGGCGGGATCSGCCAGGAGTTGGCCATCTCGTGcC228859281ForwardGRMZM2G150383Putative uncharacterized proteinWithin the gene
28
923.27Ac2CATGTAGTGGAAAAGCATAGTATCCACGTCCATCCTTACTCGATAAGCCGTGTTGATATCAACGGGGCTTTTGGGTCTTCTATGATGTGAAGTCTTATACAAGAAA27122695ReverseATCAACACGGCTTATCGAGTGRMZM2G024196TSA: Zea mays contig19269, mRNA sequence Within the gene
29
901.09Ds3ATTGCTATGAACTGGGAACGAAGTGGAAACGCGATATCTCCGGTTACAGATCCGCAGTGTTCGTTCGTCTCTTCACCGGCCGGCGGTAGATCCAAAGCAAGATTTGGCCTGCTGTTGGGCTGAAAATCGACTGTGGGCCGGATCAAATGAAGTACTGGGCCGAACACGAACTGCTACGGCATGAAACTCTTTAATGTTCTCTCTCTCTCTCTCTCATTTTTCTCCCTATGACTATGATGGTCCAAACGCGAATGTTGCGGTACAAATA155964091ForwardTGTTCGGCCCAGTACTTCATGRMZM2G161295Putative uncharacterized proteinIntergenic region (.928 kbps away from gene)
30
902.26Ac3TTGATCGATTGGTTGTTCGGTTCCTTGGTCGGGAATCAGAGGAGGCAGCAAGAGAAGAGATGTGCCCGCTGCGGGTGATCCTCATCTTCCTCTCCGCCACCGTTGCCGGCTTCTTCCTCATCAGGGGCCTCAACGCTGAGCCCGACCAGTTCGACGCCGACGCCGACGACTCGGGATCCCCCAGGGCACCCCTGCCCTTC230670836ReverseGGGCACATCTCTTCTCTTGCGRMZM2G011878Putative uncharacterized proteinWithin the gene
31
903.05Ac3CACTGAACCANGGAGAGACAAGCTGACACGCTGAATTGGCCGAGTGCCGCTCCAGGTGCGTGCGTGTCATGTCCACTGATCCGGGTCGTAGTATAAGCCAAACCGTGCCCGCCCCCTTATCCCCCTTGTTGCTCGTTCGTCGGGCAGGACGGGCCCGCGGGCGCCCCTTTTACNCCGACCCGTGCCGCCCGTACGTGAGGTGGACGGGCCGCGGGCGGGACCGAGGAACACNATCCAACGCCCGAATCTTANCTTAAATACGGNGCCGAANTTATTGTCCCT10387692ForwardGRMZM2G483032No gene function listedIntergenic region (1.081 kbps away from the gene)
32
905.87Ds3CTCCCAACATGAATAGACTTGGCCAAACGAGCAACAAAAGAATATATGCGTGGACAAATGTGATAAGGTGTCGTCTAAAGAGAACCAATGG148834668ForwardGCTCGTTTGGCCAAGTCTATGRMZM2G047310Putative uncharacterized proteinWithin the gene
33
905.92Ac3ATGGCATGATTGCAATCCCTTCCCCGACTGCACTGCACTGTTCTGTGCGCGTGGTGGGTGTGGGTCTTCCAAATACACACATTGTATTCTTCTTCCTCCTGCTCACTCTGGTTCCTGGAGCTGCACGGCACGGAGAATGGACAATGGTGGCTGCAAGTGGAACCATAAGCTAGGGCACCGACACACGCGTCGACGCGTTTCTCCGGCAGCACTGCGCGC28336805ReverseGGAACCAGAGTGAGCAGGAGGRMZM2G076104Putative uncharacterized protein Intergenic region (.576 kbps away from gene)
34
906.59Ac3TCCCTTCCCTAGCAAGCCAGTGATAATATTTGTTTGTACCTGTAACTGGGTGA201191485ReverseCACTGGCTTGCTAGGGAAGGGRMZM2G589538Transcribed locusIntergenic region (1.019 kbps away from the gene)
35
907.01Ds3CCGGAAATGACGTACCAGCCGGCCCGGCCGGACCTGGGAGGATCTTGGACGCAG176326781ForwardGTCCAAGATCCTCCCAGGTCGRMZM2G074229No gene function listedIntergenic region (4.171 kbps away from the gene)
36
907.32Ac3AACGAAGGCTTGCTGCCTTGCTCCTCATGCAAACGGCTCTGGCTCCTGCGTCATCTTTTAAATCATGACGTAATGCAATTTTGGACATGTTTAGGATAGCTTTTTTAAGAGTTTTTATGAAAAACTAGATTTCTGAATAATATAGCTGTTACCAGGATCTGGACATTGTAGGACTTGCTTG156362262ReverseCAAGCAAGTCCTACAATGTCCAGRMZM2G173534Inducer of CBF expression 2Intergenic region (.100 kbps away from gene )
37
919.32Ds3ACAGCACGCACACCGGACATCCATCGATCGTCTCTCTCATAACTACGTAGTCCAGCTAGAGGCAGCTAGAGCGTCGATGGAGATCGGTCGAGCGGGGCAGGCCGGTCAAGGCCAAGGACGACGCATAGAAAGCCCAAACTTTT5880174ReverseAGTTTGGGCTTTCTATGCGTCGTCGRMZM2G143723Transcribed locus, moderately similar to XP_002457187.1 hypothetical protein SORBIDRAFT_03g002960 [Sorghum bicolorIntergenic region (4.076 kbps away from gene)
38
921.38Ds3CTCAGAAGCCTGTGGCGAAGAGAGAGAGAGAGCTTCAGAGGTGCAACCCTGCACAAGCACATTTCGAGGAGCTGAGACCGGAGATTTCGTACCCAGCTGCATATGGGTTTGTGATCATACGGGTCAGGAACCCTCCCGGATATGGTCTCGATCATGAGCGCGCCGAAGCAGTAGGCGTTGCTTGGGAGATCCGGAGGAGCTTCAGCACGGCTGCTGCCGTCCTCCTTTCCAGCCTTCGCTTT4337629ReverseGGTCTCAGCTCCTCGAAATGGRMZM2G346466Transcribed locus, weakly similar to XP_002266057.1 PREDICTED: hypothetical protein [Vitis vinifera]Within the gene
39
923.13Ac3CTCCTTCGCACCCTGCAGCTAACTTGTGCTGCAATTGCAAACTGGTACAGGCAAATCTGAACTGGTCTATACACAAACGCTAGCTACCTATCCCCAGCCACCTCGCTATTCCCCTTACAAAGACAGGAGAG202040226ReverseTTGTAAGGGGAATAGCGAGGTGRMZM2G158013Putative uncharacterized proteinWithin the gene
40
925.16Ds3TTGGCATTCATGATCGGTACGCAATGACGGTTAACATAATAGAAATAGGACTACTAGTAGCTAGATCGAATTGATGAAGAATTCCTAATGCTCTGTGGG11651267ReverseGCGTACCGATCATGAATGCGRMZM2G336437Lactoylglutathione lyaseWithin the gene
41
930.06Ac3GAAGAGAGCTCTCTTCCAGAGAAAACATGAACCCAAAGGCCAAACCAGACGAACAAACACCAGCAGCACAAGTGAAACCAATAATAGGTGGCCATGCAACTGCATGTTCTTGTTCTTAACGCAGC212116930ReverseCAGTTGCATGGCCACCTATTGRMZM2G577756Transcribed locus Source: UniGene Zm.Within the intron in the gene
42
933.60Ds3CCACCTGGCACCTGCTCAAGGAAATGGAGGTTAGTCCGTGTGGGTACGTATTGGTTGTCAACCCCAAACCCAAAGGACAACACGCCCATACGGCTCTCACGTGGCCATCTAGAACTTCTAATCATATGGTCATGAAAATATAAATCTGGATAGCCTTGACGTCTTGACAAATTCATGGGAACCTTACCCACTACCAAGACGGATTCTTCTTCAATCGAGCTGTTCATTCAAAGGGACTTGCTACGA189461670ReverseCCACACGGACTAACCTCCAT GRMZM2G702070Clone 484277 mRNA sequenceIntergenic region (2.962 kbps away from the gene)
43
902.13Ac4GGAGGGACCATCCTCATCTTGCTGGCTGCTGCTCTCTTCACCGGCCACCGGCGGTTTCGCATCCCGTTCCGATCGCTATTCGATTCTGTGGAGAATCTGCCCAATCGGGTACACTGTCCGTCTGTCCCACTGGACCACGAACAAAACACATGTGCTCGTGCGTGGGCCCGCTACGGGATTCCCAATCATCCATGCTCTGTTCTCTCCGTCGCATCCCGAGT112454645ForwardGACGGACAGTGTACCCGATTGRMZM2G156322No gene function listedIntergenic region (34.16 kbps away from gene)
44
902.24Ac4CAGTATAGTATATCAGTCACCTGGACAAGCCACAATTTATGGCTCCGGCCACGCCCGACCGCCGGCACCCGCCGCGGCCGTCAGAACTCACAAGAAACATGCCAGTGCTGAAGCCGCCCAGAGGCTGGCCAGTGCCGT185315106ForwardGGCTTGTCCAGGTGACTGATGRMZM2G131516Protein SCARECROW (ZmSCR)Intergenic region (3.5 kbps away from gene)
45
904.03Ds4GTAGGAATGGCATAAATAAAATGTATTTCAGCTTAGAGTGTCTTGCTGATGACACATATGTGACTTACTGTCTTACTGACAATGAGACCCTCTTGGTGAATAGTGT144525848ReverseCCAAGAGGGTCTCATTGTCAGGRMZM2G038820Putative uncharacterized proteinIntergenic region(1.451 kbps away from the gene)
46
907.01Ds4CACCTACCACCATCATGTGCATCATGTTGATGAACGACGGCCACAGCGGCAGGGCTAGCATCCAGCCACCGCCGCAGGTCCTCGCCTCTGTTCCCTTGCTCGTCTACGAGTACGAGGATGCTGCCGCTGTTGATCCAGCAGACGACTCTGCTCCTACCGCCTTCAAGATGCTCATGTATAGCCTGCCTGAGCGGAGCATCGTCT37731735ReverseCATCTTGAAGGCGGTAGGAGGRMZM2G434240No gene function listedWithin the gene
47
907.74Ds4GCTATATCCCCCTCTAAACGCGTGTTCAGATGAGTACGCACGAAGCGGCCGCCGGCAAGAGGAATGTCAACGTACATCTACGGAACGCACAGACAGTGTGTGTGCTTGAATCACTGCGAACACGAG200026581ReverseACACACTGTCTGTGCGTTCCGRMZM2G581755No gene function listedIntergenic region (3.904 kbps away from gene)
48
911.05Ac4ATTCGCAGTTCTTCTACGCTGCTTGTGTTTACAAGTCCAGTTTAATTTGACCCATGGGATCAAGATTGGAAGCTTTCTGCGAAATTTGGGCGTCAACAAACAGTGTCAGAGGCAT122293522ReverseCAAGCAGCGTAGAAGAACTGCGRMZM2G081359Putative uncharacterized proteinIntergenic region (37.352 kbps away from gene)
49
919.05Ac4AACGTCCCGGAGAAAAAGGCTGAGCGCTTTTTGGTTCTTGAAGAGATTTCCCCACTGCAAGAAACATCCCGAGAACGTTCTGACGTTCTGGTAACGTCACCGCCTCGCCGTTTCTTTCTTCTGGTCTTCCCGGCCGCGATTGTCCTCCAAAGGGAAACCGTGTGCCCTCTGCAGACTTTCTGCCCGTAATA228624458ForwardGCCGGGAAGACCAGAAGAAAGAAGRMZM2G020196Transcribed locus, strongly similar to XP_002451836.1 hypothetical protein SORBIDRAFT_04g008430 [Sorghum bicolor]Intergenic region (.063 kbps away from the gene)
50
919.19Ds4CCGCTGAGCTCCAGCCCTAGTGCGAGCTCCCGCATCTCCTCGGCGGGTAGCGTGCCGCCGGAGCCGAAGGACACGGAGATGACCGACTTGGCCGGCTGCCGGTCCGGCCACTCCACGCACGGGCACGGCGCGTCGT3266789ForwardGCACGCTACCCGCCGAGGAGAGRMZM2G085854Hydroquinone glucosyltransferaseWithin the gene
51
919.26Ac4ATAGAGGGGCCCACTGCGCACTATAGCTGAGGGAATTAGCTGAAGAACTCTCTCTTTCTCTCATGTAAGGACCGTCCCTTAAAGTATAAGAGGGAGTCCCTCTTCCCTCGTACGCACGTAAGCACACAAG175424123ForwardGTGCGTACGAGGGAAGAGGAC204383.2_FG002No gene function listedIntergenic region (1.199 kbps away from gene)
52
922.24Ac4GTTCCGAACGTGTTTTTACCGTCGGTGATATGGTCTATCTCAAGCTTCAGCCTTATATCCAGAGTTCAGTGGCTACCCGTGCCAACC145246116ForwardCACCGACGGTAAAAACACGGRMZM2G165519No gene function listedIntergenic region (.589 kbps away from the gene)
53
925.28Ac4CTGGCAACTGGTCGATGCGAGGCCAGAGGAAGTCGACCTTGGTCGAAAGGCACGCCCCCGAT158605779ForwardGCCTCGCATCGACCAGTT GRMZM2G106931No gene function listedWithin the gene
54
931.10Ds4CACACGAGAGGAGCCAACAACAACAACAAGAAGAAGCTACAGGCAACCACACCCAGCCAGGCCTTGGTCAGCGCGCGCGCTACAGCTACAGGCATGCAGTCGGCGCCCGCCCGCCCGCCGGCCGGCCGCCGATCAGTTGGGGCCCCAGCACACGAGGTGGTAGGCCTTGCGCATCC236904175ForwardGACTGCATGCCTGTAGCTGTGRMZM2G419994Wound induced proteinPart of the only exon, contains the TGA stop codons, and goes into the 3'UTR
55
934.07Ac4ATCACTTGAAGAGAAAAGAAGTACACTCGCTGCACTAAATAATAATGAATTTGATGCTTTGAGTGTTTGCTGGATAAATTGATTAAT210664744ForwardATCCAGCAAACACTCAAAGCAGRMZM2G397403No gene function listedIntergenic region (3.857 kbps away from the gene)
56
902.05Ac5CATCGCACGGTGTTTAAGAGGAAAAAAAGACATGCAAAAAAAGACTTAAATAAAAAGGATGCACCAGCCGGGAATCGAACCCGGGTCTGTACCGTGGCAGGGTACTATTCTACCACTAGACCACTGGTGCTCTGAATGTTACTACGCCTTCCATGGTTTATCCTTAACTGCACAAACACAGGAACTTGGTTCGAATCTGTACTSGTGTTCTTGCCGCGTACTGGGTGAGAMACGBTCCTGCGGTGTGGATGATGATGTAATGTAAGTGCAGGAGGAGACGTGACCATCTCAGCTACCSTTTCAAGAACAGAAATGGAATCATAGACAGTGTAGCATATAGCACAGGRGAAACGWTTTCAAGGACGAGGAGTCTKGGTGCAGTTACCTCTCGTCTCGAGCGGTCGGGCCCTTGGCCCCTTGCTGCAACAACGTCAAAAGGCCCAAAAGGGCGAACACCGGTTCCCCCCACCCCCCACCGTCACTCAAAGGTGTCCCGCGTGATCCTCCTACTCTCGCCCGTCCATCCCGTGCCCACCGAGCAAAATTACAAGTCCAAGTAAGAGGCACCCGTGCCATGTTTTACCCAGCATTTGGCG15445966ForwardGRMZM2G340578No gene function listedIntergenic region (.908 kbps away from the gene)
57
904.04Ac5AGCGCGCGGTCCCTTCCCGCTGGAGCGCGGCCTCCGCTCGGCGCGCAGCCTCGACCATCTCCATCCCAGTT116910168ReverseCTGGGATGGAGATGGTCGAG GRMZM2G470666No gene function listedWithin the gene
58
907.02Ac5GATCGAGAACAATGCATGGCGCGCTGTGTGTAAAAAAAAAAGGCAGAAGAGAGAGCGAGATCGATCGAGATGAACATAACACCGACACCTCGCGTTGAATCTTACCCATGCCGGCCGCCTGCGGTTATCGTAGAATGCCCAGAGATGAGCACCGTACCATGCCGTCCAGACATGGGCGAAGAAGGAGGGTGATCCATGCGA18672546ForwardCGGCATGGGTAAGATTCAACGRMZM2G487300No gene function listedIntergenic region (2.331 kbps away from the gene)
59
907.16Ds5TCTTTGAGGCGGTGGCGTGGCGTGCGGCGACCTTTCTTGCAGTACTACGGCAGGCAGGGATTGTGTTAGCGCA201232514ReverseATCCCTGCCTGCCGTAGTAGRMZM2G417229hypothetical protein LOC100279191 (LOC100279191), mRNA Intergenic region (4.331kbps away from gene)
60
907.25Ac5ACTGCACACATGTACATATTCTTTTAATGAGACACACATGTACGGTTTACCTTACCGAAGTCTTGGCTCTGGTGAATCTGTTGCAGGTTTCTCTTTCCAGCTTTGGGAGGCCTTCTGTATGGCTATGACATTGGGGCAACATCCGGTGCAACCATATCGSTCAAGGTATCACATGAGCGCTAATCTTATTCCTGTTTGCTTCTAAAARTGCCGCATTAGACTTGCACATCAATTCGGTTAATATTGCTAATKTGACTGCATCAAACCTATTTTGCAGTCGTCGRCATTCAGTGGTACTACTTNGKACAATTTGTCATCTGTGCAAACGGGTCTTGTGGTATGYTTTACTWTGCATHAAAAGACTATTTGCGCAAAGGTTGGGTTCATTCACCTGG45334411ForwardGRMZM2G067789TSA: Zea mays cultivar W22 CL571Contig1.betc, mRNA sequenceWithin the gene
61
907.51Ac5GGCTCACGTCCTCCTCCGACGTCACGTCGCAGTGGACGAACATGGCGCCCTGCGCGTCACCTCCCAGGGCGTCGCGCASCTGCCTGCCCGGCCTCATCCTGGATGTCCGCGATGCAGACCTTGGCGCCGTGCTCCATGAAGAGGCGAACGATGGCCTCGCCGATGCCGGTGGCGCCACCAGTGACGAGGGCCACCTTCCCTTCCAGTCTGTGTTTGGGGCAAGAAACGCAAGATCAAATCTGAAGGACAAAAACACAGGCACAGCTACTGGATGGAGATGGAGCAGCACCGTACTATGGTGTTGCAACTGGRTCGACTGTATGCCGATGTATACTGCACGGTTGGGACAGTAGGAATGGTTGAGGATACAMTTGGSACACCATTTCCTATTTGGCBCCCATAAAGGAGGGAGGGGGAAATGACC3146628ForwardGRMZM2G332976Sex determination protein tasselseed-2Within the gene
62
911.30Ac5TCTGACCCTGACTGGCCCATCCATCCGTCGGCTACTACTACCTAGCTCCGGCCTCCGGGTGGAGTTGAGTTGAGCTAGTCATGGCAGCCATCATCATCATAGCCACACATTCTCGCTCGTCATCACGRGCTKCTGCTGAGATCACDGAGATAGTTGCG51355174ForwardGRMZM2G457211No gene function listedWithin the gene
63
914.07Ac5CTAATTATACTCCTCCCAGTCGCATCGTATCTATSAGCTAGCTGCAGGGCGTCTGATGATGCGGCGCAGGCGCAGCAGCAGCTAGCTGGTCACACGCTAACTGTACGTGAGTCGcCTCGcCTGCACTTGCCCTTGTGTGCCCTGCTAGTTGTCGTAACGACCCGCTCACGsTTTCTACAAARGACACGGCACATCCCCGCGTCGTGACGAGCTTTGCGGGGGGAGGGCCAACGGACTGCACACCAGTGCTGGCCTCGSAAGCAATTGGTGTGCAMAAACAAGGCAGGCCGCAGGCAaGCTCCGTGCCSCAGCGGAVCGG164859654ReverseGRMZM5G872392Hypothetical protein LOC100280206Intergenic region (.238 kbps away from the gene)
64
919.17Ds5GTCGACATCCGGAAGCGCGAGGTCGCCGCGTTCCTGGCGGAGCCGGCGCACCGGACCTCGGGCGGCTGGGACGGCGCGCCCAACGGCACCTACGCCTGGGGCTTCTGCTACAAGCCGGCCGGCGCCCAGAACGTCACGGACCCCGTCGCCTTCTTCGAGACGGCCATCGCGAGCTGGATGACGGCGTCGGCGCGCCCGCCCAA63229876ForwardCAGAAGCCCCAGGCGTAGGRMZM2G064360Basic endochitinase 1Within the gene
65
919.17Ds5ATCAGAAACCACCAATCTTTCAAGTGCTGAAACTCTGGCGACTACAATTGTCGATCCGATTAAATTACGGCGACAGGTCGATTCCATCCT63634507ForwardCAATTGTAGTCGCCAGAGTTTCAGGRMZM2G028501Intergenic region ( 847 bp away from gene)
66
919.41Ac5CCTCTAGCTCATCTCTATTTCTTTGCAAGAAGGTGCGTGAGGGAGCATGGGTATGTATAGACGGGAAGCGCACAGGCGTGGCGTGGTCCATGGGCTGAGCGCATGGTCAT21933865ForwardGCCTGTGCGCTTCCCGTCTAGRMZM2G096372Clone 264517 mRNA sequenceWithin the gene, but 84 bps of the sequence fall into the intergenic region after the gene
67
921.30Ds5TCTATCCTCACGTGAAACGCAGGGGCATGCATTTGCATTTTGCTTTGAATAATCCTAGCTCATTTGCAACGCCAGCAGCTTGTTCCATCTTTATTAGCAGACCGTATTCTAGGGACTTATATTCATGCGTTGAAGCGCTTAAATATTGTCACGGCCGCATGCATGCATGCTTGTCTTG43662478ReverseGCGTTGCAAATGAGCTAGGAGRMZM2G312578No gene function listedIntergenic region (4.487 kbps away from the gene)
68
931.11Ac5AGTCCTGCCCATGATGCGAACGCCCCCAAGCCGACCAAGGCCTTACCCTCTATGAGGATTTCTAACTCGCATGACCCCATGGGTCGAAAGCCTCACCCTTGAA136203049ForwardCAAGGGTGAGGCTTTCGACGRMZM2G449019No gene function listedIntergenic region (1.932 kbps away from the gene)
69
931.23Ds5CATGGACTCCTGCGTCGCCTTCGCGGACGCTAGCTCCATCTCCAGGTTCGAGATCGTCCTGTCCAGCGTCCTGATTGATCACAGGGCAAACAGTTCGATCGGAACA20490408ReverseTCTCGAACCTGGAGATGGAG GRMZM2G080231Putative uncharacterized protein part of the 2nd intron and the 3rd exon within the gene
70
934.08Ds5GTCGGACCGACTGCGTCAAGCCGGCCGTCAACACGGCAACGTTCGCTTTGTCAAAAGGGGCTTTGACAAGAACCTGTGGAGGGCGCGCGATTGTCAAAACCGTGCACTGGAAACCCTGCGCACAGCACACGTACTAACCGGAAGAATCCAACACGTATACTAAAGCTTTGGCGCCGCGGAGACGGGACGACGACCGGGCTCTCCGCATTTGGGCCGGAAATTGCCAGTGGGCTGAATGTCACTGAAATGTCTACGCATGCGT53908064ForwardCAGTGCACGGTTTTGACAATGRMZM2G026980_T01Putative uncharacterized protein Xyloglucan endo-transglycosylase homolog Xyloglucan endotransglucosylase/hydrolase protein 23 3' UTR within the gene
71
922.05Ac6ATAGCTGATTTAGGTCCTACTCTTGTTTGCCACTTCTTTCGTCTAAAAGGTCACTGTGGCATTGGTTTCGATTTCGCTAGCTGGTAATATTGCATGGACATAGTATGAGCTATCGTCAAATTCAGAAGATTTAATGCAGATTTTGTTACAAAGAATCCTA147525627ReverseCCAGCTAGCGAAATCGAAACGRMZM2G147867Putative uncharacterized proteinIntergenic region (10.600 kbps away from the gene)
72
925.04Ds6TCTGTGACGACGCTGTCAAGAAATGTCAAGACGGTGGTGATGCCATTGATGGCTTGGCTGCACCCCCGGTCGAGGTCGCTGGCGCTCAAGAAGAAGGCCGGCCGTGCTTTCAAAAAGGCGNSSCACCACCGTCTTGACATTTCT
73
931.06Ac6AGAAGGAGTGTGTGGTGGAGTGCAAACCAAATCAAACGAAGAAAAGTGGGAGCGAGGAGGAAGAAAAGAAGAAGAAGAAGACGACGACGACACCCACCACCAGCAGCAAGCAGCAATCAGCAACCAGCATAACGAAATG656694ReverseTATGCTGGTTGCTGATTGCTGRMZM2G358540VAMP protein SEC22Within the gene
74
931.12Ac6GCACAGCCTGTATCAGTTCTCATGAACCCCAAAATCTGTGCAACATATCCCACAGGTACAGTTGGGCGATATGACCTAGACATGCATTTCATAGCTTCGAAGCGCATCCGCTCCACATATAGATCTGTTAATGAGAATGGTTA152142578ForwardGCACAGATTTTGGGGTTCATGRMZM2G134753_T01Putative uncharacterized protein19bps are within intron 11, the rest of the sequence is within exon 12
75
902.19Ds7TGCACCTCGTCCTCGAGCATGCTTGCTCCTTCGATTTACACTTGCAAAGTTACACAGCCAGAAACAGCTGCAGCTGCAGCTGCAGCGTGGCCATCGCGGCGAGCGACACGGGGCCGATTCATTGCCCTCTGCTATGGCACGCCTGCCTGAGCGCCACGGGCGGGTCCGAGAGCGCGCCGGCGACGATCTGGTCGAACAC GCAGCTGTTTCTGGCTGTGT
76
902.34Ac7CCAGCTGTTGGGTACTTGATTTCAATTCCCTGAATGCATTTGAGAATCAAGGCAACACAAGTTAGTAATGTGAACCTTCGACCTGATCTAAAGTGTCAATATAGAGAACGAAGGTCATAGAAATGCAAACGGAAATGATGTGTAATGGAGTAACACGACACAAT176025858ForwardGATCAGGTCGAAGGTTCACAGRMZM2G525718No gene function listed22bps are within the gene, the remaining 144 are within an intergenic region
77
903.06Ac7GGTATGGCAGCATAAGGCATTGCAGTATGGCAGCATAAGGCACTGCAGTATGGCAGCATACTGTGATATCTTAGCCTGGTGGATGTGGATCCAACAAGTACCCAAACGGATGGCCCCAGAGCAATCTAATCAAAACCACACACTATTTTCTCCTTGTTTGCACTGCATGTTCAGAGCTCCCTGAAGACAGGGGTGCTGAGGCACGCCAGGGGCACCTCGAACCGCGCCCCGTCGGCCGTGTACACGGCGCAGTGGCCCTTGCTCGCCACGGAGCTGCAGCTCTCGCCGGCTTGCTTTGCTGCCGCGCCTGCGCCGCCCCAGGTGAGGCGCTGCCTCCCTTGTGCAGCCATCCTCTGCCACTTCTTAGCCAGATGAGCGACCCTCTTGGCGCTGATCATGGTTGGCTGTTGGCTTGTTTCCTTCTTCTTTCTGGATGAATTCTGGAGAGCTGTGCCTTTAGCTGCTGTGTTTTAGTTTGTTTGTGAAGCTGCAAGTGATGATGTTCAGAGCCCACCTGACCCTGAATATATATAGCCCAGTCCGCTGCTGGAATGAAATGGTTGGGCAAGGGACATGGCCACGAGCGCGGCGGGTGCGGTGTTGCAAGACGGGTCTTCCGGGAACAATTTGGRTGAGATTCTGATTGGRGTCGAGTKTTGTAGT147418063GRMZM2G042429SAUR52-auxin-responsive SAUR family member Within the gene
78
905.60Ds7CCCTTCATGCTCTGAGGGTCATACACTTCCGTCTCTACGGCCTGTATGCCGAAACGGATCTTCCTTGGGTTTGGGCGGAAAAAAGATTCGATTTCTGCATCTTGTATCCCACAGCTGCTAGACCGATGGATTCGCAGAGCTTTGTGAATAAAGCGAAATAAAAGAGGGCCATTACGCAATTG4260898ReverseAGATCCGTTTCGGCATACAGGRMZM2G365875No gene function listedWithin the gene
79
907.49Ac7CTACTACTACTACGGCAGCGAGGCTACAGGATCTGGTTACGGCTACAACGAGACGTACCGGTACCTGCCGGGATACGAGACGATGGTGGTGTACCAGGSGCCGCCACATGCCTTCAGCGCCAGCTTCTTGTACCCGTACGGGTACCCGGGCCCCGCGTACGTGCCATYGGTCCGTCGCCGTCGAGCCGTCCTYGCACGCCGTGGCTCCTACGGAGCCGGAGCCCGGDTCTTGGCATTAGTCATGATTTARRTKCAGTTTTTTTAGAGTAGTAGTAGTAGTATACAACAGATAAGRSTTTGCTAGGGTCGATTTGATGGATCGAATTTAAGTGTCGTTATTGTTTCGTGTGCAAACTGCA4547477ReverseGRMZM2G180011Clone 287630 mRNA sequenceWithin the gene
80
913.09Ac7CCTGTTGGAAGGTTGCTGTCTGCTGTGCTGTAGCCGTGCTCAGACTGATAGGRGGAATTTGAGATGGTGGAGTTTCAAGTTTGAGCTTTACCTCTTCTGGATCGACAAATTCAGCGATCAGATAATTGTTGTTGTTTGAGGGCCACTGGAGGTCGTAGACAGCATTCCTCGTGGCCACAGCTTTCTCCACTGAAGAGTACTACGGACCAGAGAGGTAAGGGAAGCAGGAAAaTCAAAGCCATGCCACTWAAAGGGDATAGGCATTAADDGGCAACATATCACGG167042537ReverseGRMZM2G427408Clone 402894 mRNA sequenceWithin the gene
81
923.32Ac7GTTGAATGCTGCTCGAAACGTAAGAACCCTGACAGACTGAGACGAGCTCTTTGGTTTGGTGGACCCTGATCGACCTCTCGCTGCCTTGGTTTGGTTCGGGACACACTTGGAACCAGAGAGCCCATTTCCCAGTCACCAAAACTTCACAGCCCATCTGAGCTACCGG170994630ReverseGGGTTCTTACGTTTCGAGCAGRMZM2G036113Putative uncharacterized protein Intergenic region (1.123 kbps away from the gene)
82
929.28Ds7CACGTAGTCCCACCACATCCACGGCCTGCGAGTCCCATTGGCGACCCTGAACACGCAGATCTGGACCAGGTTCTGGAGCACGACATCCCTGCCGTCGTAACCGGTGCTGAAATCCTGCTCCGGGTCCGGCGCGCA173187340ForwardCGTGGATGTGGTGGGACTACGRMZM5G881387Putative uncharacterized proteinWithin exon 2 in the gene
83
930.04Ac7ACTATGATCATCTTGTGTTGGTCCATGAAACAAGAGGGATCGCAGTTTATTCCTTCCGCCACTTCGGTCCCTTGTTTGCCGTGAGGTTGCGAGCCCCTATTTGGAGGTGGGAAAGACTTTGTTGATGTTGAATTCCTTGGACAAGGTATGGACGAATCGGCCCCCTGCTTCTCATGAGT164607070ReverseGTGGCGGAAGGAATAAACTGAC187072.4_FG002No gene function listedIntergenic region (.041 kbps away from the gene)
84
931.11Ac7GTTGAGCCCCAGGCTGGTGACGATGTGCTTGATGTACACCATCTCAGTCGTTATGGTCACCAGGTACGCGAGCGCCCACGAGTACGCCGTGAGGCTGAACGCCGAATCCGTCGTCACGTAACCGACCGCTCCGCCCAGGATGACCACGA85882314ForwardATCAAGCACATCGTCACCAGGRMZM2G088849Putative uncharacterized proteinWithin the gene
85
931.11Ds7AAGGGATCACCGTACCATGCGAGTGGAATAATCACGAATTGCTTGGCTTGGCGTGCCTAGGCGTAGCTGTCGTGTCAAGTTGGGGTGGGCTTGCCACTATCAGCTAGCAAAAGGAATGCTATATATAACATTGGAGTGAAGGCGACGTCAT160992038ReverseACTTGACACGACAGCTACGCGRMZM2G550596No gene function listedIntergenic region (37.638 kbps away from the gene)
86
931.17Ac7GGCATGGGGACCAGCCTTTACCAACCAACCAACCAACCAAACGGGAGGAGCGCTTACGGTGGCGGT152746077ReverseGGTTGGTTGGTTGGTAAAGGGRMZM2G121546Putative uncharacterized proteinIntergenic region ( 3.995 kbps away from the gene)
87
902.13Ac8CTCCCATGGTCGTGACCTCTCCTTGGATATCTGTAGGAAATAGTCGCTGCCCTTCTCTGGTGCTTGCTTCCCAGCTACCGTGAGCTCTGTTTCGCCGTCGCGTCCTAGCCGCGTCGAGCTCCCTGCTCCAGCTCGCCGGCTGTGCAGCTCTCCTCT63801974ReverseCAGAGAAGGGCAGCGACTATGRMZM2G539365No gene function listedIntergenic region (.517 kbps away from gene)
88
902.27Ac8CAAATACTGCATTGATGTCACTGATGTCTGACGGAGTGACGGTCGCCCTTCTCAGTTCAGAGAACATTGGAGAAAGAGGAAGTGTCACAGTGCGACCTCAGCAGCACGAGTCCTCTGTTTTGGACGGACCGGCACGCCGTGTATACGACGCAATAATTGAGATGATTATGCCCTCGCTATTCTTAGCGGTAGATTTAGCACGTTTGATT166241430ForwardTCGCACTGTGACACTTCCTCGRMZM2G173715No gene function listedWithin the gene
89
903.23Ds8GTCACATGCCCATGCTGCCGGCACTTCGATTCGACAGGATCTACACATAGCGGGGTTTGGGGCTAGTCCACGGGGCGTGGCCTTACCGGAGATTAGGCTCTAAGAGTTCCTGCTCACAACGCACAATGATCTGATGATGAAGTACTCTGGTGAGGTCCTCGGGTTCTTTCGATGGGGGGTCTAAGGAGTGGCGCGGGACGATTTTA11107625ForwardGATCATTGTGCGTTGTGAGCGRMZM2G090114No gene function listedIntergenic region (1.61 kbps away from gene)
90
907.40Ds8CACCGCAGGTTGTCCTTGTCGTATTCAGTTCAGTTTCATACATAAGTGTCATTGCTAGATGTCTCTGCATATGTCGGTGTTTTATTT1641075ForwardCACCGACATATGCAGAGACATCGRMZM2G030280Putative uncharacterized proteinWithin the gene
91
907.54Ac8GACGGTGAGGTTCGTTCCGTCGTCCGTGGCCAGGGATCGACGACGCGCGGCGGTATATATGCATGGRGACCATCAAGTGCTGCATCGCGTGCATCCTGCCGTGCGGGGCGCTGGACGTGGTGCGGATCGTGCACTCCAACGGCCGCGTGGAGGAGATCAGCGGGGGGCCCGTGCTGGCCGCCGAGATCATGAAGGCGTACCCCAAGCACGTCCTCCGGAAGCCGCCGTCCACGTGCCCCGCCGACGGCGGCGGCTTCGTCGTGCAGAAGCCCGTCGTCCTGCCGCCCAGTGCCGAGCTGCACAAGGGCAAGAGCTACTTCCTCATGCCCCAGAATAAGGCACCAGCCGCGAGGTACAGGCCCCGCC173609195ForwardGRMZM2G406155No gene function listedWithin the gene
92
907.58Ds8CACCGCAGGTTGTCCTTGTCGTATTCAGTTCAGTTTCATACATAAGTGTCATTGCTAGATGTCTCTGCATATGTCGGTGTTTTATTT1641075ForwardCACCGACATATGCAGAGACATCGRMZM2G030280Putative uncharacterized proteinWithin the gene
93
910.01Ac8AGTCCCCGTCGCTTCTGATCTGGCCGTGGGCCCACACTGATGTTAACGCAGACTGCAGAGTAGTACACAAAACTGTAACCGTCTACTGATTTTATAGTTCAGGTCAAAGATTCTTTCGTAGGCATCACTCAATA151219593ReverseCTCTGCAGTCTGCGTTAACATCGRMZM2G077054Transcribed locus, strongly similar to XP_002458326.1 hypothetical protein SORBIDRAFT_03g031310 [Sorghum bicolor]Intergenic region (3.921 kbps away from gene)
94
911.14Ac8GGTGCGGAGGGACTTGGGCTCGCTGGACAGGTACGTGTGGGCGTTCGTGAACAACAGGCCGCTGTCGCCGAGCTACAAGTACAGCCGGAAGATCCCGGCGAAGACGTCCAAGTCGGAGTGCATCAGCAAGGACATGGTCCGGCGCAGGTTCCGCTTCGTCGGCCCCACCGTCATCCACTCCTTCATGCAGGCGGTCGGCCTCACCAACGGCCACCTCGTCTYGTGCCCGSGCCACCGGGTCTGCTCCGCCGCCGCCGTTAATAACTGATTCTGCTGACCACCCAGACGTAAGGAAGRRGGGAGACCTTTTATCTAAGG171608052ReverseGRMZM2G132303No gene function listedWithin the gene
95
911.16Ac8CGGGGACTTGTGTTGTCCACAGTCTCCGACGGACACCTCCACCTCCACCTCCGCGGCTCCACCAAACACCCCCCTTAGCAAACATCAGCCGCCCGTTGTACGTGGGGCCCGAGATCCGACGGCTGCAGTCTGCGTTAACATCAGTGTGGGCCCACGGCCAGATCAGAAGCGACGGGGACTCAGGGATGAAAGTAGGATGGGAAAAAT151219586ForwardGRMZM2G077054Transcribed locus, strongly similar to XP_002458326.1 hypothetical protein SORBIDRAFT_03g031310 [Sorghum bicolor]Intergenic region (3.914 kbps away from the gene)
96
911.22Ac8GCGCTGTGGTATGGAGAGGGCCTACTGAACTGGGAGCAGCAACTAACGGACAAGCGGGCAGTGGCTCCCAAGTCCCAAGCCTTTTAGSCTCTCTGGCTCTGGTTCTCACATGAGGAGGCCAGGAGAGGAGAATCTCTGTCCTTTCTCCTCCCCTCTCCTTTTGTCTTGGTCGAGCTCAAAATGCAGTTACTCCGCTGATGGTATGGTAACACAAGAATATATCTTACTATCACATCTGAGATCTGACCCTTTCAGTAAAGATCTGCGCGAAAAATGTTCTTGAAATTAGTAATCAAAGTGCGCGTCGTCAGATGTCAGATCCCACACGRACTYTCATGAGACTTKAGATGAAACCCGGAGTAGTTTAGKTGCCCGTACGTSGAACTGGGAGCTCTAGCGCTTCCAAACT130212184Forward GRMZM2G178686Putative uncharacterized proteinWithin the gene
97
919.25Ac8AGCAGGAGACACCTGCGCAACACATACCTGAATACCTTCTCGTATAAGGAAGCTCTCAGACTTAGACATGTGTCTAGAAGATGTACACACTGACAGACACCAAGGAAATGATCCGCCAGGACATGCTACAGCTTGCTAGC119722282ReverseGTATGTGTTGCGCAGGTGTCTCGRMZM2G161009BZIP transcription factor Putative uncharacterized proteinWithin the gene
98
921.18Ds8GCCGTGACGGCGTCCCCCAAGGCGCGGACGGTGCTGGACCTGTGCAACAACCTGTACCTGGACGTGGAGGACAACCTGGGAGCCTGCCGCCGCGCCATCGGCTTCAAGGACGCCGTCACC5721316ReverseACGTCCAGGTACAGGTTGTTGGRMZM2G323558Pectin esterase inhibitor domain containing proteinWithin the gene
99
933.81Ds8GAGTACGCGATCGAGTCAGCAGTCAGCTCTGGCTTTTGTTTCTCTCACACAGTCACGTACGCTCGTGTCTCTGGCAA170180140ReverseCAGAGCTGACTGCTGACTCGGRMZM2G495996No gene function listedIntergenic region (9.441 kbps away from the gene)
100
934.08Ds8TACCCAACCGAGAACCGACGCTGCCTCCATCGCTCCATGCCTCCATCCACACTCCTGCGTTCCACAAGCAAATTGCTGTCGGCAAACTGATGCCGCTAGTAAACAAGTGATGCAGCTGAAGG18447222ForwardCCTTCAGCTGCATCACTTGTGRMZM2G504652No gene function listedIntergenic region ( .015 kbps away from the gene)
Loading...
Main menu