Annotated tac/tds Table (by MSU students)
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
tac/tds SiteAc/Ds insertionChromosomeSequence Adjacent to TE's 5'-end (RC)Pseudomolecule Location Next to 5'-end of TEAc/Ds orientationPCR Primer to Amplify TE's 5' JunctionGene ModelGene DescriptionWhere the sequence is located
917.11Ds1TTTACAAGAGACGTGGCTAAGTTTTTGGAGTGGTCGCTTGGTCGTTTGCAGGGGACTGGCGGGGAGTTCGAAGAGGA53164931ForwardCAAGCGACCACTCCAAAAACGRMZM2G107481Putative uncharacterized proteinIntergenic region (.010 kbps away from the gene)
906.59Ac3TCCCTTCCCTAGCAAGCCAGTGATAATATTTGTTTGTACCTGTAACTGGGTGA201191485ReverseCACTGGCTTGCTAGGGAAGGGRMZM2G589538Transcribed locusIntergenic region (1.019 kbps away from the gene)
907.01Ds3CCGGAAATGACGTACCAGCCGGCCCGGCCGGACCTGGGAGGATCTTGGACGCAG176326781ForwardGTCCAAGATCCTCCCAGGTCGRMZM2G074229No gene function listedIntergenic region (4.171 kbps away from the gene)
907.16Ds5TCTTTGAGGCGGTGGCGTGGCGTGCGGCGACCTTTCTTGCAGTACTACGGCAGGCAGGGATTGTGTTAGCGCA201232514ReverseATCCCTGCCTGCCGTAGTAGRMZM2G417229hypothetical protein LOC100279191 (LOC100279191), mRNA Intergenic region (4.331kbps away from gene)
931.17Ac7GGCATGGGGACCAGCCTTTACCAACCAACCAACCAACCAAACGGGAGGAGCGCTTACGGTGGCGGT152746077ReverseGGTTGGTTGGTTGGTAAAGGGRMZM2G121546Putative uncharacterized proteinIntergenic region ( 3.995 kbps away from the gene)