R95 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79X80X81X82X83X84X85X86X87X88
2
1lel0-wats-rev-GS0_01
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5637448
GGGAAAGAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCUCUCUCUUCGGAGAGAGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
3.056
medium
88.90.192.0911.1412.02670.8671.15060.6044-0.13096.01957.13014.0732.55623.13495.72193.09564.44852.26032.6291.7551.78431.67280.09890.04320.81361.07360.37560.03250.70771.37370.26571.4511.22130.60930.88922.19272.50861.97623.27480.21190.31820.34190.68140.39480.28651.87592.97751.64060.80710.37970.54540.41590.49170.43881.10922.54542.80713.11471.83153.04130.78580.3280.20760.45350.90690.27981.20072.11831.04581.41360.32140.4620.1727-0.12540.22880.11820.71951.63150.71020.29270.36910.15760.10440.82180.55140.42020.13480.24440.19660.4080.24220.0967
3
2lel0-wats-rev-GS0_02
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5637450
GGGAAAUAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUCUCUCUUCGGAGAGACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.414good93.90.1331.4670.8-0.22660.39161.7151.01211.12491.96493.90363.24371.7612.80563.25933.21182.87082.10991.44321.25191.48790.54120.03280.21550.80860.71010.2670.14080.33520.57360.37680.8810.71820.34050.28031.22711.59181.11121.47480.2320.25150.12220.5580.18330.63691.16752.2371.23941.14320.56070.38670.49040.36370.16480.72121.31572.18772.11261.61451.61290.50350.33530.11520.13710.41150.2260.82541.61330.75651.20030.39140.08910.10550.11970.05910.14250.44081.44340.85830.34140.17340.17260.05720.42460.4170.46370.29530.07610.11920.24070.1973-0.0086
4
3lel0-wats-rev-GS0_03
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5637452
GGGAAAGAAACAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGCUCGCUUCGGUGAGCCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
8.821good91.90.1181.30.7090.13540.19780.3610.41330.34260.33871.34862.09011.31831.60743.48823.03092.39441.92451.47831.67931.46160.97450.11570.24810.38170.49190.23370.08080.25110.6970.50210.81641.50280.75090.35390.93071.79941.01391.44810.27810.30820.05390.34550.05340.30451.55852.46381.49161.33120.68420.38330.65390.31720.19770.65351.4962.38721.9791.44721.72940.53590.40010.15240.18110.21610.17990.68771.51250.68241.01810.39870.09810.12570.12220.03150.12990.44091.18220.89530.3740.12650.05590.05430.46660.44610.51330.11580.05770.01850.18580.18850.0219
5
4Squirrel
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5638259
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUCGAGCUUCGGCUCGACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
10.475strong89.90.1371.510.8240.03821.18561.12430.70811.27262.97392.94882.96361.28442.03694.32393.4262.79051.94561.21391.14040.95881.4550.16490.44750.50670.60080.31890.25560.54531.10640.6411.16050.63270.46170.24790.77841.42570.97451.0360.35370.26520.0480.25210.07380.36371.59692.96482.12811.5280.99330.58430.77110.21930.17260.49421.71232.46071.92551.48641.55510.86940.52530.15920.13040.28570.16320.69521.55760.65640.82120.20060.0760.13050.10420.02810.15210.68761.42551.03990.43330.35170.16090.13850.43160.55510.5710.20870.17120.02730.1690.11540.0284
6
5Chipmunk
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5638264
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGACGAGCUUCGGCUCGUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
9.835good90.90.1461.6080.8770.5721.07041.11550.54931.05712.88123.21222.94740.98942.75555.08823.61033.23892.62511.77811.34261.10660.87080.10790.21740.83211.26760.41020.16990.5850.58920.42741.1180.85540.63670.37131.45682.28021.48781.87980.39930.24970.06060.7420.20050.3871.45012.47141.43931.03730.36060.27380.40530.44120.31460.67691.7272.40232.33021.98182.14750.53620.2620.07760.27610.43170.24451.461.61160.79861.21950.43780.08910.2080.1340.05680.10750.32721.26420.73150.37360.18550.11970.07410.57670.56690.36690.14160.22660.04760.23070.18-0.0037
7
6Sugar Glider
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5638266
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGACGUGCUUCGGCACGUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.982
medium
91.90.1451.5970.8710.17871.1930.63260.9761.28252.94223.08113.11581.19782.32215.78183.89423.43082.42741.57940.96150.92770.49710.0323-0.00410.86460.74490.25870.15440.28730.8680.26751.17931.41130.56520.74511.10392.2181.34621.81610.35450.21390.1260.5780.17740.41681.44292.131.2491.2250.67090.41750.49910.41830.3860.74222.03912.37822.35821.48741.82310.49110.37780.1570.21670.5070.16370.93091.7120.76891.11990.25450.10490.20680.10950.03090.18860.45561.33950.81250.42880.20750.17750.08510.60220.60710.43740.30510.17770.08990.29590.25930.0595
8
7
January - Jieux - Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5639547
GGAAAAUAAAAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCAUACCUUCGGGUAUGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
9.914good89.90.1271.3950.7610.53911.53591.65041.35131.64072.61011.92073.19642.09771.81253.51833.59772.73141.74351.42161.15420.79020.6130.04770.15380.78951.05960.29120.08330.2960.39270.25850.90740.80450.47510.39431.14711.8531.15161.83670.3740.30580.06240.64460.13550.35061.16021.87291.00070.86950.43940.33010.33250.27460.16920.78161.61232.15631.88331.41171.76920.43260.30490.07340.22990.48520.27621.14751.68420.83671.09680.35880.10590.09630.0980.05220.10420.38571.30950.70930.26960.18340.12450.05130.52230.5550.30210.15850.14290.0580.20730.15910.0499
9
8
February - Jieux - Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5639550
GGAAAAUAAAAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGAUACCUUCGGGUAUCCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
8.74good91.90.1041.1440.6240.69581.4961.62741.22161.06661.91291.57392.3542.06621.4322.57872.35412.13481.42041.17610.92790.67380.41120.0510.17690.59230.65270.21560.04120.38880.40230.28090.75820.60870.37220.32020.88651.52710.86421.12320.34110.1580.10060.92420.07270.3580.76091.68830.91540.65560.39410.23280.23560.26150.14960.55961.5051.76671.55151.52021.44370.48880.20540.04530.24290.3340.24331.08321.54530.73391.02240.30360.06370.13170.1120.02940.07310.34420.98680.59980.36420.15580.18750.04410.60270.46690.33280.17340.0990.0630.27620.15850.0432
10
9
March - Jieux - Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5639555
GGAAAAUAAAAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGUAUCCUUCGGGAUACCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
15.607strong92.90.1481.6270.8880.52911.45921.92551.90621.40582.35853.07433.51373.21561.92373.62244.13963.0142.19791.80761.30711.0870.78950.13440.30730.86311.23250.48530.16810.34550.53490.37180.96860.71970.66810.72791.66032.52351.49681.88540.46220.33810.17730.82670.15810.45011.31292.31921.24260.93060.43610.27760.38880.44760.28210.88582.0062.5712.23351.92451.93680.55590.36970.08710.28580.42290.26081.25271.86430.89641.21750.41140.10050.16570.13130.04190.10840.53581.31020.72510.43630.4350.17820.02350.57490.59360.37890.11070.10430.03230.36280.21260.0555
11
10Spider Gap 0 M1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5639977
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCCAUAGGUUCGCCUGUGGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.714good93.90.1251.3740.7490.71331.22991.19941.25421.25731.9242.47192.24011.2412.86452.89012.732.34091.66481.46761.01430.85450.63290.03530.24990.87770.93180.30530.13020.23220.41380.21480.87520.67720.40260.52391.32682.14851.11651.60030.45060.24730.080.76120.08620.39831.08471.63580.8790.79470.33480.240.4250.47290.35940.63551.65172.37771.87741.38111.69360.48730.29880.05440.25230.44630.24381.12541.49810.82121.12620.37610.09470.14030.08530.03290.08920.36071.02070.69620.35010.30310.09380.03970.58190.4440.34040.17920.19630.01680.19920.15070.0502
12
11Spider Gap 0 M2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5639979
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCCAUAGGUUCGCCUAUGGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
10.611strong92.90.1261.3840.7550.58131.59721.5081.51911.9442.18022.39622.11281.56063.07172.4952.81852.41081.81271.19270.85390.87340.66410.0820.16850.71960.88030.36960.13740.3160.28470.22330.80950.79280.56240.5571.22772.07071.12331.54970.44870.24930.10780.77110.10960.35471.07661.76351.08720.77490.3780.17970.31060.36930.30350.68111.77272.13282.14641.44431.71320.50450.27950.06530.23420.4620.32981.1831.70740.69951.06360.3920.10350.18190.12760.08350.10210.40171.12040.76640.35830.17310.12480.06090.56190.54750.3460.15530.17870.06810.2470.21990.0821
13
12Spider Gap 0 M3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5639985
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCCAGUGGUUCGCCACUGGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
8.798good94.90.1431.5690.8560.52421.23141.35920.94821.29083.21822.77323.29982.1013.48823.69553.48782.78072.20261.63631.19350.97950.80.0770.20020.67821.05030.20810.09650.31050.43190.2850.87620.8310.40140.6291.40672.16611.27171.79140.49380.29280.0520.81590.16370.34741.0471.90270.97111.00730.46610.19220.40650.43730.30130.74211.82872.65962.28661.47942.07790.55660.23830.07240.27310.4590.37251.03761.83170.84571.21740.28260.14840.27130.07820.06160.11430.33291.14760.65170.39710.1920.11280.06870.65590.4970.40870.08530.05240.08080.28690.3070.0503
14
13level 0 entry
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5640168
GGAUAAUAAUAUAUAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCGCGCGUUCGCGCGCGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
3.138
medium
89.90.1311.4430.7870.9750.38491.23291.15171.87711.93370.97980.94642.05222.49492.50442.2013.15873.50592.27640.79971.40620.1458-0.02810.04470.68990.85410.42660.13950.33880.48410.21250.90591.46420.46071.00631.26842.10610.90631.32260.32840.35280.05420.29470.07780.5021.28212.23691.36461.15250.4620.37150.40830.26230.19350.93861.68692.10231.38991.56911.64680.5260.21830.07270.27230.22520.33961.40272.0680.87791.11220.32240.06330.0740.1260.03680.06280.31231.21210.57240.67230.8270.20940.07280.36440.63990.22570.14070.09060.0280.19930.16680.0297
15
14JR_WaterS_Sub1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5641853
GGAAGAGAAGAAGAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCAAGAACUUCGGUUCUUGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.52
medium
90.90.0372.3571.1970.4432.1061-0.12051.5422.18930.71417.69321.551412.403313.66271.507611.963114.0024.65283.30621.84711.57251.56680.1431-0.01772.08792.40880.70930.25760.80110.79870.1222.01640.17150.7515-0.41472.35743.20962.05742.89590.50090.4673-0.0811.31250.1399-0.07621.67432.75071.89071.5655-0.18950.25180.36310.29860.30710.51782.52833.42442.51841.60222.18110.00670.29960.02760.03520.3959-0.12220.71092.04230.51081.3729-0.27830.06090.12660.05820.0538-0.04670.47791.2960.84890.37320.0616-0.0041-0.16490.5620.42050.3079-0.38380.02170.03230.17920.1211-0.0713
16
15JR_WaterS_Sub2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5641857
GGAAGAUAAGAAUAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCUAGAGCUUCGGUUCUGGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.616good88.90.1551.7090.9320.43341.00970.86810.94640.53662.58972.98890.68481.39714.48242.06164.25425.85252.37881.55781.78971.37550.95440.24040.25020.66311.12910.54130.18670.38121.02620.68630.86181.0380.72320.67891.81342.8811.66231.94730.51280.2283-0.03340.99780.1060.29161.4452.69671.89421.24420.58950.36320.67620.4740.29270.77551.86562.52011.9851.23361.54820.66360.47540.12550.24340.50680.46591.14961.63190.60741.08780.41990.07580.09560.22490.05490.12930.61681.42390.88590.48920.13560.07980.0440.57150.61220.4716-0.01460.1591-0.01840.33360.3342-0.0178
17
16JR_WaterS_Sub3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5641859
GGAAGACAACAAUAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCUGGAUCUUCGGGUCUAGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.088good91.90.1631.7880.975-0.1860.1540.0808-0.04320.41290.27970.8710.61041.80933.90852.85075.53165.99612.17191.69462.50831.5270.46040.30770.24661.91911.83160.470.38990.48830.65490.31191.13260.44590.75990.80082.29712.95141.81932.03040.60620.33240.25370.88270.16040.69891.5722.45331.35651.23450.28280.45290.31740.66550.37450.77092.06852.70282.20461.791.75310.63190.37680.15750.23790.46740.36161.48662.06411.08641.22390.45160.13870.15740.11430.09510.11590.41791.28421.12640.5150.35640.1662-0.04380.75240.56320.4641-0.21010.08640.06850.48350.1982-0.0019
18
17Water Stride frozen 1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5646062
GGAAAAAAAAAAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCCGGGCUUCGGCCCGGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
2.565
medium
93.90.1561.720.938-0.08341.25220.27281.21061.78651.4233.1032.89654.05795.29845.04113.25671.95172.94111.66962.10291.78661.23100.40711.14191.63360.4020.28410.65441.12890.48331.02380.81150.69920.11071.85162.39581.67882.22190.34150.40960.13620.79210.43040.47271.45051.87841.03761.15180.16910.28990.61710.3897-0.01220.5782.34051.8951.68471.81021.51830.61390.26180.08710.23740.36380.12851.06561.66860.69861.4120.27550.07620.15190.08690.18870.13170.63191.12260.92620.42960.10560.19290.05820.47710.46650.4412-0.05990.17240.13460.28720.01670.0334
19
18WS0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5649870
GGAAAGAAAACAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCGUAAUGUUCGCAUUACGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
14.136strong91.90.1331.4610.7970.43361.27061.05770.5271.07842.08372.08352.15711.01661.84612.91272.35292.30311.46540.9230.97830.7470.78940.05670.24810.86781.09950.33020.11940.32610.40380.48240.88651.02670.6120.56851.50442.10521.15781.91010.5720.34410.22180.5270.11180.39861.1862.2731.50771.07350.63340.41960.42390.36630.28340.7971.88042.43642.07261.58911.76280.6210.35480.09170.38110.60160.25911.13921.79510.73811.18160.27650.0960.16320.13490.0750.15420.42231.22670.83360.38910.16950.11280.06970.60550.49430.4260.16960.14590.05190.26530.25160.0632
20
19LELO - 0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5650703
GGACAACAACAACAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAUUAUCUUCGGAUAAUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
12.265strong89.90.1541.6960.9250.64220.44770.27690.31870.40050.27970.93280.58672.08792.89450.98133.66155.95082.66662.25251.53941.40831.07420.220.39351.06671.60450.44910.18330.55450.70550.54391.01991.06260.95150.69171.92872.87221.54162.19840.57370.4830.12960.92390.1640.50241.6312.67461.47381.27220.62220.32780.38230.40550.39480.95412.37642.94242.76192.26372.11050.80410.37090.16030.28420.47770.25181.44672.13650.87351.3090.58590.13240.20750.2030.08770.12080.46071.44350.91320.43560.28670.1410.12470.65890.69690.40380.22260.18540.07940.39320.17550.0211
21
20Impassible
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5653617
GGAAGAAAGAAGAAGGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUGAUUCUUCGGAGUUACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
2.91
medium
85.90.1242.4651.2941.38221.35261.199-0.02631.43390.91260.26492.45755.67434.08317.081118.88630.30378.197411.11424.09623.1112.73610.33180.7532.4653.66520.5920.71050.70530.6608-0.53351.85290.08780.1824-0.63172.18913.47821.32812.64990.27550.54070.11270.7352-0.40280.00282.34753.94351.74411.57980.63710.31290.54080.40560.14380.26253.0254.78773.12042.80612.26430.39760.4317-0.18510.22710.52860.48511.5342.66330.83391.2455-0.5970.1660.1481-0.0041-0.0546-0.01280.29181.19690.92360.240.2503-0.064-0.13370.68010.24790.5614-0.9526-0.30030.04520.09470.21090.0049
22
21WatStr level0-gap0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5654701
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAUUAAAUUCGUUUAAUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.219
medium
90.90.1611.7660.9630.26320.87621.54390.8360.54361.91133.5642.01050.79972.94444.21593.54772.65391.99831.82191.28521.09861.00510.06680.27321.04531.59850.31190.31260.34710.5170.4791.04610.70990.76940.6731.53952.4281.18892.29880.57410.37390.17070.59490.07570.3611.69822.35561.54931.18140.37880.4380.46380.38840.47420.92792.47272.83772.19222.04931.93430.72150.25360.21880.30170.4880.20061.2091.90021.32421.21180.56350.04640.18160.15410.02880.00710.45121.29670.80790.25060.19060.13980.1970.84140.65250.29820.1610.14940.08880.50790.16090.087
23
22WatStr level0-gap0-II
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5654705
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUUAACUUCGGUUAAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.952good93.90.1291.4190.7740.27351.47451.33670.68611.2832.23312.5532.16480.98241.64373.94923.17542.64981.81671.65541.16110.78080.65220.08430.14280.7450.71690.29060.07250.21430.27620.46171.10270.8330.59540.2781.37172.03291.02471.51170.42740.23720.10580.51750.28350.37891.64522.27691.27351.04770.47710.24030.46620.24570.31950.58421.61492.12442.20641.47041.66780.56630.29760.01840.1470.29570.23431.01071.71310.70431.02410.34220.08140.08720.17760.04440.06990.87681.32730.94680.30610.2390.07060.09470.55730.61470.4114-0.00260.10660.04470.27230.19250.0465
24
23WatStr level0-gap0-III
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5654707
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGUCACCUUCGGGUGACCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.359good90.90.1311.4450.7880.49960.8120.890.67581.27442.5372.91462.53720.93711.90944.7783.56552.56672.01531.54550.70270.99230.6420.14560.24920.96621.00330.49270.01490.35060.29040.17940.74460.96170.52530.62221.42472.58661.32982.10930.35050.2450.06730.57270.12450.41851.14432.10861.23380.88840.4650.19320.31760.27490.2630.58641.87942.40932.08171.81711.80760.51030.28680.10950.2330.45650.24561.26881.86140.67951.24180.41990.08460.10640.1280.03590.12360.27671.23270.65940.09510.27490.08980.05970.52150.5280.25890.10860.08980.04480.28940.14410.0343
25
24Lab Entry Level 0 - Water Strider - Frozen Shape w Gap Size 0 entry 1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5654839
GGAAAGAAAACAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUAAAAUUUCGAUUUUACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.969good92.90.1251.3750.750.41420.75320.84210.22060.7571.34841.62981.26240.94151.66013.01653.09292.41331.91021.28630.99160.71820.8110.25920.1210.79020.88430.46650.15990.37780.46790.34951.13920.73070.40070.84190.86512.02881.06521.50140.47570.20650.06320.49030.14640.31971.43082.45541.15880.86160.50050.34760.48210.38150.29850.59741.98432.38261.9061.62121.57090.58230.28810.05020.21870.27670.18711.00681.93930.72811.03680.40930.14770.16630.21730.01850.18310.45351.25610.70170.35390.23120.13290.0170.42190.65150.35750.00930.13390.01270.30180.1298-0.031
26
25Lab Entry Level 0 - Water Strider - Frozen Shape w Gap Size 0 entry 2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5654841
GGAAAGAAAACAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCAAAAUUUCGAUUUUGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.583good90.90.1321.4530.7920.30721.05851.05730.35310.86032.34021.91972.46610.67231.63493.58712.63622.45911.64251.58661.0890.69050.4680.02240.25870.5971.10010.50370.07250.34540.36550.24650.78790.58590.69270.7171.24661.96670.84571.73670.47710.39520.10990.85070.08550.62951.15862.06311.15010.92460.50320.32030.29660.3630.22650.65131.66432.11292.24151.82891.57030.73730.24860.08560.31020.50350.26651.21711.8230.83121.1910.44170.10130.16250.16180.04410.09520.17551.27870.74790.29420.11640.11140.03760.5520.72150.3888-0.04390.18190.03690.29180.1669-0.0471
27
26Lab Entry Level 0 - Water Strider - Frozen Shape w Gap Size 0 entry 3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5654843
GGAAAGAAAACAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCAAAACUUCGGUUUUGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.706good92.90.1451.5940.8690.43031.5790.78980.51921.72122.66814.09712.7470.68552.41854.09963.97453.10581.96831.55251.36051.26381.0227-0.02350.33461.02581.12710.2970.14420.69730.68670.32510.96450.86560.56070.5591.05332.56411.1651.83110.36990.2118-0.02350.88320.08250.33511.24692.14981.50640.79260.43180.28770.43890.18350.16740.70341.84382.3252.29561.77662.09390.74750.31490.08240.23660.60180.24081.06931.66950.75561.02920.41720.17530.15410.07770.04070.14820.57691.28730.7170.43890.2510.13130.0010.54320.78930.31480.00130.14480.01030.28510.26230.0186
28
27Frozen-Gap0 1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5655253
GGAAUAAAAUAAAAUGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUUUAUCUUCGGAUAAACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.479
medium
90.90.1331.4620.7980.96572.50851.68541.42051.93932.46882.20551.19542.36922.2551.93192.51760.9542.12692.64731.10431.12120.78510.12810.20230.99661.16010.25780.00440.55720.67750.45570.85710.43160.32630.83511.32371.49541.28291.72480.13780.44580.10370.91210.33910.37081.31412.77461.64460.96290.68310.34530.47580.46710.24560.47011.57182.66362.04131.80761.49520.79410.32770.08910.23010.21170.38071.03691.77630.81061.09690.28710.12250.14750.12180.04050.11620.5220.96920.87560.31830.2830.09860.21820.58360.63060.49320.18320.07420.07340.20530.17790.0527
29
28Frozen-Gap0 2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5655255
GGAAGAAAAGAAAAGGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUUGAUCUUCGGAUCAACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.477
medium
90.90.171.871.02-0.13340.69210.65691.7062.65923.47223.96650.50432.6123.97535.00934.17430.61033.98635.24981.47771.69241.19110.27810.33170.79051.79180.4080.25870.61870.85480.1991.21361.70510.93850.21052.12433.1651.30672.24920.49810.25120.15310.85240.26130.49421.61952.76821.21571.21650.51030.16630.40630.25820.37890.91871.83562.9812.50442.12462.11560.41550.44460.08730.21110.48390.17991.09171.97830.47891.37010.49940.11170.2241-0.08940.08770.1250.44371.46540.98170.3380.26610.13790.06750.59190.50720.40870.26030.0603-0.00410.07620.2179-0.01
30
29Frozen-Gap0 3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5655257
GGAACAAAACAAAAUGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUAGAUCUUCGGAUCUACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.575
medium
92.90.121.3240.7220.27831.25561.23541.240.85741.68931.61021.15281.93511.54192.12651.86481.19672.41461.8911.35180.65150.62220.06630.31750.88471.25410.30140.06380.56560.45940.39840.8470.56170.30310.39921.35221.73671.32591.65550.62250.33530.14060.97210.12170.49861.28341.76191.17160.8330.42680.06330.41470.34440.17510.57291.67182.32512.02141.7921.810.66460.38050.04960.21030.48650.19281.09691.48870.79481.2040.4960.1450.18530.18460.06940.11460.37861.04230.56790.41590.25090.22260.1080.51760.64970.34630.00450.11030.01480.24550.21580.0268
31
30Water Strider Fs/gs0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5657054
GGAAAGAAAGAAAGAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGUGUACUUCGGUACACCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
11.087strong91.90.1731.9081.041-0.71661.2081.0041.12011.1682.94183.30010.89882.78714.67014.7650.83774.41256.8242.60061.59341.87851.16070.09620.31921.31491.72740.56010.44220.74190.75510.29141.51721.180.67130.71542.07012.93221.54582.37540.62940.32510.07861.03460.09020.56181.75392.59771.42671.18780.38960.3230.34720.47980.28420.76572.24373.00462.68012.12192.22460.50780.34660.07640.3390.58920.28591.33252.13920.94331.24240.3420.10220.10030.16850.03220.07580.45571.37710.6860.49250.58210.2091-0.02070.51580.5940.43550.19980.19180.04240.34660.25070.0053
32
31Water Strider Fs/gs0 2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5657188
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUCACCUUCGGGUGAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
3.749
medium
94.90.1341.470.802-0.05580.8380.9450.39390.72212.42292.82432.79621.0492.81233.74093.32882.68352.59581.43861.3520.72970.83070.10640.20870.81.5380.35780.08930.35470.48690.48641.04481.1360.45780.52711.16022.51620.94481.82030.23270.27490.07240.94220.14090.72971.49892.41911.11280.7830.53390.21890.37260.25920.29720.45741.34312.01271.98571.42441.92810.34510.2483-0.00610.24030.37490.22551.42161.57730.67641.31690.15970.03410.16630.04790.09820.07840.36181.18340.65840.3350.36950.09220.08320.46310.53230.27880.21960.11970.02810.52690.23590.0868
33
32Water Strider Fs/gs0 3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5657222
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGUGAACUUCGGUUCACCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.141good94.90.1341.4770.8060.52921.13780.44380.96151.8142.5621.49752.62150.70542.23924.14763.76432.70162.76921.86240.8031.18591.10370.12580.31590.65241.07290.2756-0.01610.37870.37580.50760.75140.88180.69870.46520.92731.9841.26581.71950.45580.2795-0.01680.59960.14370.40671.33781.77621.04950.92510.42470.41960.40920.31730.14370.78251.92282.40912.11321.69341.8420.63880.22770.06330.26120.47840.25511.03121.80050.87511.01620.44980.07950.20960.03150.04740.13770.43241.18480.7770.43990.18530.13620.21060.46830.71650.24490.14930.14240.04210.31880.1717-0.0106
34
33Guesses 1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5657549
GGGAUAGAUAGAUAGGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUUCAGUUUCGACUGGACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
3.321
medium
89.90.0132.4211.217-0.215501.28210.64270.33180.65510.2214.18725.21684.60554.784614.15760.154918.968911.06922.71723.93523.45180.15780.48081.72182.55660.79910.26060.7812.4578-0.68932.6922-0.5479-0.3847-0.11141.90893.60962.35322.51710.45720.1302-0.02190.7562-0.252-0.43791.70035.02163.10352.3532-0.06130.18081.22380.35380.3866-0.39652.35773.11742.6742.22382.42110.66450.43630.1068-0.04440.36940.11580.97871.81220.52711.456-0.38750.12510.10640.11350.00170.06450.42071.48231.21420.64040.13760.0395-0.72510.42570.47920.6312-0.336-0.1463-0.05720.0458-0.00560.0588
35
34Down
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5658972
GGAAAAUAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUUAGCUUCGGCUAGGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
11.469strong90.90.1441.5810.8620.55871.70071.72862.27731.40822.31073.2363.30433.08381.03832.23194.74623.43522.10451.38761.54021.06381.33210.11230.1650.7470.77370.27320.10680.31020.59920.480.85680.90610.75580.6011.24162.40571.18741.63060.49730.31060.11090.61790.15590.23031.16942.57491.62861.12990.56890.45410.46950.44820.25390.65011.93312.3992.26611.85161.65850.67830.35750.06820.22480.45030.18871.06231.73310.71071.21310.28320.12150.09030.04320.02740.11410.45671.38060.96560.38730.25550.16330.04550.57130.63140.46080.06940.13350.0530.26560.17640.0461
36
35Grade
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5658980
GGAAAAUAAAACAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCAUAGCUUCGGCUGUGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
8.058good90.90.1141.2570.6850.78440.94451.6611.18720.73681.69591.68351.9111.92871.18671.80192.54682.32451.64061.15051.04420.79160.89930.06530.18320.60810.65580.20720.05180.26190.57050.39461.00770.80620.74660.31641.18011.6860.90041.31580.30740.18150.03030.49150.06070.44741.09722.09481.2990.95290.60890.37840.5780.24430.15260.41571.46161.87751.94281.32831.46970.48220.3030.10770.25420.42530.20760.89771.48720.66261.08990.51410.12530.10570.04410.06930.13970.44121.2090.8110.44270.13530.1350.10760.59640.56630.63050.32810.17360.05850.18150.19310.0326
37
36Swapped
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5658982
GGAAAAUAAAACAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGUUAGCUUCGGCUAGCCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
8.24good92.90.1151.2650.690.42451.31271.21731.32911.36941.99411.55292.15341.681.23811.91432.52452.18721.72551.24960.79070.7531.05660.1310.11360.52830.64320.15980.02110.21320.35870.42610.71780.91950.59510.25331.07941.59790.92331.06970.31220.24360.06560.68660.12210.26191.15982.15661.09050.98360.46440.33140.41570.30430.14040.57651.51752.18251.83951.39781.48830.66250.20810.04590.20190.43580.23921.07971.51770.70341.0390.38980.11620.11040.13780.10160.16390.40081.36230.70150.63220.24880.19290.07490.50660.53390.39710.16410.09920.11150.30750.25360.0761
38
37Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5660041
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAGACUCUUCGGAGUCUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.167good91.90.1811.9951.0880.56071.66191.75281.20770.68151.40633.52853.95684.94791.39873.4848.80924.1433.31692.53621.33381.92651.15470.25390.39261.10581.97970.53190.2210.31460.56830.40951.34871.24171.10030.49132.13133.39351.77632.23680.52940.4980.14640.99880.12480.45811.38212.62611.72561.29630.84950.57320.31390.59350.3270.9172.22943.05642.64192.29792.58240.72750.25960.0830.3320.56180.37031.3152.08740.91431.4390.44530.10590.22650.09510.05870.14810.51021.43890.80510.47850.28880.08370.05890.66390.70570.32980.07910.12890.06010.41570.25420.0079
39
3848166_5634134_1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5661661
GGAAAAUAAAAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCCCUGCUUCGGCAGGGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.067good91.90.1261.3870.7560.24091.79331.94432.45751.83293.27362.3752.8152.40721.82483.01613.79632.25882.20161.14630.87151.01950.71140.04260.21230.70160.68250.23160.13150.23270.35720.42161.01061.03550.56350.35781.20431.6461.08641.75460.41330.12910.09130.53240.17330.22091.54272.00190.96730.80280.32880.23790.38230.15920.18780.52491.46272.27942.00631.58721.57750.51670.27890.13910.21610.40090.20751.20021.71610.63520.97250.21060.06310.11120.0066-0.00350.08830.35431.29150.67190.36220.15660.1490.12910.45560.45630.4780.10390.07980.05320.24940.2260.0067
40
3948166_5634134_2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5661663
GGAAAACAAAACAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCCCAGCUUCGGCUGGGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.571good91.90.1051.1560.630.46071.17631.56471.39441.14120.60540.84471.85141.90691.22891.83783.35092.3741.95621.40970.90780.85160.60110.1170.19010.69480.72220.30960.20280.43770.65340.32610.85860.64360.35050.58240.88271.68841.02581.32750.15920.21180.11050.46730.08870.43221.06971.82590.92680.82570.41280.27320.30770.20070.08870.50331.38691.90542.04881.28731.60870.39950.27620.04360.15150.24150.23971.03421.47310.590.84390.18330.12020.1120.05950.08950.05090.31231.18040.67320.31090.16510.14080.02910.35950.61610.320.11750.07030.02490.27620.1541-0.0115
41
4048166_5634134_3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5661665
GGAAAACAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUCAGCUUCGGCUGAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.749good88.90.1691.8571.0130.76860.81911.62841.4111.33671.19763.97093.17981.98963.14292.87833.39044.6822.99344.28464.4252.32541.4180.11290.21511.40181.77570.5320.17220.48430.80420.72441.18760.7650.77360.35191.29262.5611.13272.19391.69520.38950.17820.7464-0.01360.44141.4462.6791.35851.25710.31030.15870.31580.62880.59010.86952.36872.50882.30411.87011.97980.54630.34280.05840.18170.56360.22881.11731.61320.94161.17190.74890.20730.17120.12750.08480.09860.371.57630.92920.26510.27690.10160.00310.43461.48810.4018-0.03480.06770.03530.2090.14160.0012
42
41Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5664084
GGAUAUAUAUAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUUUGGGUUCGCCCAAACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
10.776strong89.90.1491.640.8950.28390.67370.17050.16130.20.53481.89241.08463.76483.44725.08765.6243.84412.35641.99341.29541.52440.67060.24640.36540.80762.20680.40890.13510.30750.77110.140.55490.48970.28630.36160.64991.47270.98181.09780.29070.13620.09420.38950.11160.48751.33243.45132.28171.68971.10320.65490.89520.32990.13680.34171.7552.62082.23091.59141.68160.85890.56060.19830.16040.35830.15290.78761.74430.66481.07510.28060.17120.12190.1470.08980.14950.65431.32040.99640.38960.17450.06650.02710.41250.53610.650.0670.11210.03050.17990.11910.0177
43
42S-1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5665939
GGGAACAAGAAACAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCAGUGUCUUCGGACACUGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.987good90.90.1411.5560.8490.35030.21110.75751.18130.33860.57880.49620.73843.52283.60541.77723.46965.13932.74661.75591.15480.89440.86690.08050.16030.92441.56150.25330.21590.61730.57670.64171.17831.14760.51110.51981.52712.55721.57542.10370.63310.29880.11320.86990.23190.3881.58442.39171.140.91390.45350.27990.31750.3790.26350.9041.93812.8152.67221.64691.72490.39670.25640.10740.35520.38790.33661.12141.8770.97221.27520.43910.210.21640.17470.04270.05750.51081.3270.82550.35370.21010.2020.07140.63330.61010.53790.25580.22480.09240.4850.290.0522
44
43Groovy strider 1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5667025
GGAAGAAGAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCAGCUGGUUCGCCAGCUGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.754good960.1612.1821.1710.42860.99360.30481.46584.54461.15954.751811.05337.51242.63024.87399.46755.22183.49232.08541.14161.5911.1830.0250.36121.44761.74310.36820.16790.50540.46010.12631.16640.7040.85990.28121.97372.95011.51242.50290.49570.48330.16060.65250.23810.42641.89932.57271.40471.16370.36270.3180.39580.38520.16790.60312.03432.96512.52811.66732.01550.5220.48620.08740.37520.40280.19281.30811.76310.76381.20630.18740.05440.13510.05840.05790.13670.43291.26110.71880.57630.35750.1804-0.00510.47870.65440.431-0.01630.12860.03330.28470.3099-0.0075
45
44Groovy strider 2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5667027
GGAACAACAAACAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCGGCUGGUUCGCCAGCCGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.914good94.90.1481.8510.9990.73550.28490.61760.67420.42371.0640.75755.54164.74611.79334.32957.64074.34233.23582.41281.85351.73911.19090.12890.41241.07871.75810.91990.19950.58680.80640.22621.43540.88060.67670.46191.84863.16751.492.75620.42520.3092-0.01240.61190.2720.53311.10733.23111.31341.08690.43490.29150.54830.52360.32730.55772.25582.34182.67961.77131.85110.61380.37680.12090.26680.43740.16821.25031.85020.65881.05770.31360.09320.17360.05580.04490.18430.42321.41690.69020.35690.16780.10610.1180.61340.47010.37920.15480.13730.0990.36710.28860.0543
46
45Groovy strider 3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5667029
GGAACAAGAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCGACUGGUUCGCCAGUCGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
9.037good93.90.1592.0171.0880.18850.67240.69860.56760.89680.78952.0616.46137.64771.2714.77679.38176.24214.0092.11041.74741.30791.41530.13260.45671.19161.75450.28590.16250.69520.50340.28211.53420.60590.67630.44061.7612.9951.59642.64990.45830.3830.07530.88380.28150.3061.70492.72081.39621.09680.38860.31490.5560.43170.21690.88262.05572.67162.53561.75841.9840.57350.33550.18690.2730.4740.30621.13231.8410.90991.37210.37130.13210.15940.12120.00630.13040.40611.33960.82450.36230.21920.0148-0.00180.6060.60820.4160.01940.07380.06810.37390.18290.0123
47
46ChP WS-FG0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5667302
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUAUACUUCGGUAUAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.549good960.1411.5560.8490.47071.24861.46131.07110.92920.94943.31492.92382.64171.06292.48075.26563.15292.65861.79371.06221.01480.78460.12010.17610.93341.31890.38370.0910.41010.40180.36860.71390.67260.84090.77911.72812.10061.53932.17010.38690.24210.11470.52670.13810.32221.20972.22141.28960.83180.610.29910.43740.3460.210.66311.66532.25392.23751.78911.89960.68380.26230.09780.30450.30840.30241.34671.57940.67821.0040.56920.30170.32660.16180.00170.08390.3981.37340.72780.3810.21850.08680.02940.38470.76270.45430.22290.17030.0620.41890.0907-0.0033
48
47ChP WS-FG0 2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5667307
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUAUCCUUCGGGAUAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.518good88.90.1711.8861.0290.38321.01861.10161.34720.88292.00273.15764.22693.30421.29522.8998.41474.57233.67742.6341.881.22471.13990.44840.27641.71271.42470.50690.2230.5510.90430.40561.41221.01420.68230.58221.97912.64361.34152.4790.44570.32670.13951.03180.22970.44841.67072.45721.51191.04890.49250.35770.39120.56130.32010.74922.23442.86162.68792.08472.29270.49580.2850.11920.1580.57050.42261.39991.85960.86281.2870.36840.08580.19750.03650.00940.1130.29781.36270.84920.37790.15460.0852-0.02870.59490.54920.4719-0.00640.07430.07470.25410.2015-0.0216
49
48ChP WS-FG0 3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5667318
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUGACCUUCGGGUUAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.222good89.90.1631.7950.9790.57830.64511.81622.00150.89290.99013.21354.5534.07220.87093.60787.16154.21213.39372.60341.60331.64751.33150.2390.40440.93261.23370.39260.13590.48570.680.37910.88211.0851.07880.45691.35162.29571.68052.0060.33580.2988-0.02690.53130.33270.48681.38552.93091.64641.14260.53770.17670.52260.33780.21550.23152.04112.79422.28242.27841.93890.82910.49720.11970.19120.52080.24461.19361.80040.95121.24340.35980.0650.23590.09690.06420.12770.49371.31010.790.36170.17090.1360.0840.71740.56030.4440.2070.2040.04090.40810.24643.00E-04
50
49Impossible to be satisfied
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5667589
GGAGAGAAGAAGAGAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCGCGCGCUUCGGCGCGCGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
1.303
medium
81.80.1932.6391.416-0.29581.16321.1375006.02823.728508.89941.488110.34151.968912.813712.72183.94464.61422.44221.88250.46641.8004-0.10734.85141.18501.62690.93340.54632.63874.91851.75080.80972.44114.76093.01522.12160.2681-0.0730.2011-0.2373-0.03590.8861.79111.441.15230.41160.374-0.05620.7830.10860.33231.69481.33312.68162.6972.03160.6411.12850.24960-0.05940.24660.36730.151.30330.84551.99960.54950.109700.10940.2180.10880.32421.40210.87120.40670.30330.30150.28740.97641.05220.47390.28280-0.20940.16570.18650.1858
51
50BLA
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5669024
GGAACAAGAAAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCAUAACGUUCGCGUUAUGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
8.097good86.90.1341.4710.8020.4171.20610.68130.89860.63940.37581.08343.68952.30921.52052.8093.18232.60841.50441.0850.83450.86640.38790.14770.28481.04030.85670.24220.05880.45560.42830.33470.85470.3370.39840.70181.25762.01831.04191.39510.67970.33190.20630.58470.13570.47541.08181.92241.24810.83850.42140.26740.39490.49670.29970.76591.68892.42492.24941.52981.50610.86970.36920.07780.37750.4440.15720.8611.77350.91790.96450.54120.15740.21140.10830.09320.08980.39931.27850.9590.29710.37150.19210.04060.46910.43370.2904-0.14250.28090.16220.18770.20950.0069
52
51Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5671692
GGAAUAAUAAAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGCGCGCUUCGGCGCGCCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.537good91.90.0931.0250.5590.45691.47141.41181.11041.10541.38581.63051.74431.961.08481.93612.16851.45120.93681.01310.45940.75570.23640.05810.10040.67830.5390.23940.06560.17980.14030.4860.92540.60940.28780.31940.39591.16210.7311.08260.27830.13870.00860.24430.04080.21280.66680.99480.50010.49880.13250.11350.17320.28460.08190.47491.37571.19421.36251.22590.97050.51360.12860.0480.42970.51880.06290.48811.21420.09840.93582.53340.17010.35060.37710.04710.02560.19011.10940.25651.14771.61980.34390.13320.31980.88790.35030.3860.14760.06370.38870.2260.0094
53
52Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5671694
GGAAUAAUAAAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGCGCGGUUCGCCGCGCCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
10.358strong91.90.0961.0580.5770.43640.55870.47960.92840.75341.35071.46961.78832.6341.2592.0742.36632.00731.19891.10410.9950.63630.39660.06640.15560.51720.61850.50790.01430.30950.25240.16480.72710.57730.35131.28951.09291.36270.841.01520.28780.17360.08190.58010.15780.34911.14041.58560.93810.69330.32060.23820.31630.31440.10220.36150.86241.34921.38280.95350.89780.26580.13780.03290.10390.23090.26070.96071.17140.45820.68050.21450.05690.06380.06430.02560.07670.25440.66440.42930.20230.1320.0580.09050.44840.43430.28080.14160.17760.0420.29960.15390.0307
54
53Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5671696
GGAAUAAUAAAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCGCGCGGUUCGCCGCGCGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
3.618
medium
94.90.121.3220.7210.67310.92851.14561.11670.81991.32041.78912.43142.23991.36462.66793.72882.66621.72431.17250.70010.58640.617400.33311.02360.7726-0.00810.10140.33940.19910.36110.55810.5490.40290.94071.36362.29470.90161.53770.80350.22150.06110.44790.02210.45991.59041.72130.9250.88480.22290.23440.42770.39680.24650.41931.29652.08231.46481.21811.47330.62210.47040.14880.21980.3380.14130.84851.56790.42530.83890.20310.04050.17430.11140.11120.02220.41881.20560.84120.37820.32810.23290.08730.67190.77710.35890.10910.03950.13840.27810.38550.0125
55
54Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5673398
GGAUAUUUUAUAUUAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGGUCGCUUCGGCGACCCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.246good94.90.1041.1430.6230.13470.36941.05750.81281.17160.98941.25660.97890.92162.45790.45081.62951.57393.42481.26670.88281.03820.8350.040.18050.38780.75390.40450.07230.27590.28890.17370.68931.22790.66850.16480.98031.69050.93291.37530.32930.04550.04870.56280.11550.27491.05062.4171.21190.77420.34520.3510.44030.44150.12190.5441.56671.77071.60551.29321.53120.40850.3010.14380.22690.24920.07170.66971.4170.72770.89030.31950.06430.08440.07480.05390.14970.471.02830.78780.28140.2140.12870.19140.44570.75010.37780.10220.130.09630.31410.26470.0676
56
55Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5673400
GGAUAUUUUAUAUUAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUGUCGCUUCGGCGACACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.022good92.90.1121.2330.6730.75690.4331.47840.77791.38260.82091.67131.2631.38192.48260.65141.42931.45153.52031.68050.84020.95680.68960.08140.11160.40010.36730.11890.05940.0790.3039-0.01010.7693.42090.45040.30040.82451.48991.05251.08380.18120.10170.08390.16170.06490.40741.34252.88511.91581.24560.73370.41920.72170.17260.18130.32621.6941.95471.8251.23771.06440.66440.46670.10490.10560.27160.13220.64811.41370.43340.83180.22280.05780.01080.12440.02920.19050.52211.27721.2750.48530.36850.25210.05890.48690.59460.53770.20430.04860.00750.33890.39580.0929
57
56Locked sequence 52-56
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5680150
GGACACAACAAACAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUAUAUAUUCGUAUAUACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.156good90.90.121.320.720.39290.41660.31580.22120.06970.27280.77040.78431.0541.50811.11351.38431.98471.12230.89780.85210.6580.34130.05180.09541.00780.830.27490.08490.37160.52550.57550.670.90920.48770.50791.03031.85871.27321.97150.46770.26990.13470.63810.19450.43821.49132.04611.24630.74460.45640.33240.43370.32090.4270.93981.44112.00231.83521.78111.45020.66320.25730.12880.27870.37990.38420.98341.58790.88491.05430.54950.15920.37470.12270.09180.09460.43761.12930.76420.35710.27610.14020.08860.42540.72110.43360.4050.24250.07820.3870.26120.1058
58
57Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5686010
GGGAAAGAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGGCCCGUUCGCGGGCCCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
1.615
medium
89.90.131.5740.8520.65120.46841.8078-0.14861.1731.57393.98473.57131.84393.48457.74632.69484.60720.92041.64311.451.35761.1462-0.265900.90780.36980.23560.18290.36330.22950.14470.91930.66560.94690.70040.59251.92730.94142.0655-0.25220.43480.14450.85280.29710.031.36492.46631.62470.7359-0.00110.36510.83210.47340.17690.50972.73192.10611.36523.26751.29470.24650.36470.18170.09070.5385-0.03091.18951.3681.47920.96310.20020.03980.1193000.23740.39271.07670.83240.18230.29920.0747-0.16150.3990.5840.23150.37310.0719-0.11720.31070.09630.0709
59
58Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5686012
GGGAAAGAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCGCGCAUUCGUGCGCGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
3.895
medium
91.90.151.6450.898-0.9670.64940.88771.44671.30961.0436.03123.4331.33942.04745.69683.19624.24862.85332.06741.26261.08980.72970.06250.03121.20521.07880.46740.09110.40130.76770.0881.02730.33381.19940.24421.72222.17531.38722.02440.24650.31470.20530.47240.18050.2891.37632.94130.94941.01430.54040.23360.36340.30220.20860.24241.90032.14771.82251.62811.66520.67760.17020.04080.13880.40070.21621.02051.55380.70191.21750.32040.11150.18210.02590.14180.14890.30861.02650.99940.34670.08530.19850.00540.56340.40110.48730.15790.1570.01660.13470.28420.0464
60
59Default title
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5686043
GGGAAAGAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAGAGAGUUCGCUCUCUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.625
medium
94.90.1541.6990.927-0.15740.39250.51260.52380.52421.95425.70943.59962.00172.44565.22743.65853.69242.21722.27171.30811.16651.06370.1330.18891.0731.15960.28810.060.41480.3620.41071.16591.01760.72850.68931.64381.69191.28651.78010.29510.23380.04350.47150.11670.52031.43092.33241.41010.85370.50790.15350.39220.25230.13720.69311.6482.22342.01781.9551.80950.72330.35140.10650.09310.320.1560.9361.75650.89381.20380.30710.17080.13930.01250.11570.14890.4031.49151.08940.52060.20560.19680.25160.40940.50510.41750.35230.19920.05140.32740.17220.0027
61
60Failure 2?
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5689498
GGAAAGAGAGAGAGAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCUAGUGCUUCGGUAUUGGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
2.163
medium
84.80.0282.0471.037-0.5050.22220.6580.6114-0.250100.427800011.32942.484418.087810.24354.84154.82173.7262.47980.55940.47741.41991.2984-0.01810.26380.84241.26130.1422.00260.72550.9437-0.93532.63994.79082.47393.22610.71720.16960.10881.33580.0827-0.49061.34414.06942.24021.7584-0.35890.22810.70080.19510.40220.11622.41583.00791.33941.67792.0596-0.29230.471-0.17240.25660.52380.26260.62952.01710.40430.93110.02810.12170.1416-0.0380.04090.08070.59161.60680.59160.4034-0.01680.01-0.16230.54110.54280.7144-0.404-0.1591-0.12370.17040.2483-0.1298
62
61Linsey s puzzle
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5689580
GGAAAGAAGAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCCGCCGCUUCGGCGGCGGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
2.376
medium
90.90.1351.9961.065-0.39142.58290.0958-0.34443.62022.01780.91260.68877.43370.86944.74838.80436.00344.30442.72941.63222.30141.47760.227-0.11580.8861.30170.6330.20370.4110.48580.74721.71652.22381.01281.07751.7014.31471.01652.65810.09970.03480.10410.8744-0.110.47951.53843.11041.83071.21760.98720.80190.37280.26840.4160.42251.83053.50782.65781.91672.02120.4950.52910.05360.37070.3850.48920.77041.94410.74521.21710.28240.1281-0.0599-0.02360.12730.22180.40231.12310.86320.27940.17480.16920.01070.41120.47520.58860.1350.074-0.15170.1833-0.0093-0.0868
63
62Linsey s puzzle
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5689582
GGAAAGAAGAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCCGGCGCUUCGGCGCCGGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.689
medium
91.90.1291.9971.063-0.30051.02170.88410.20410.49981.99690.66234.49799.94962.1074.273910.70134.75033.92262.7292.12622.37521.05370.25350.38751.0941.60720.25410.04850.26580.78850.49971.17620.86550.84660.38922.15982.72171.84392.66040.77690.4980.11610.79410.15930.29361.8533.17551.8481.28010.29260.37120.44510.45540.24790.58922.58962.5662.34331.4961.76230.67950.48060.1140.06730.51910.28141.25911.78570.53771.22420.40270.23770.09770.07560.0540.06470.27471.67630.87760.39970.1289-0.00270.08480.62540.76530.3370.0264-0.0068-0.01460.33580.1663-0.0875
64
63master design
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5694189
GGAAAGAAGAAGAAUGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAUAUGCUUCGGCAUAUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.033
medium
88.90.2162.3751.2951.26871.0181.12830.89580.40382.85212.02641.72746.17123.50424.86113.44832.17867.21476.84662.16152.1831.58590.40190.94272.0322.7111.03110.2380.88241.20290.40641.84030.73531.34330.74341.92713.82861.67922.39440.36720.4161-0.17640.90410.0350.63232.29053.73632.25921.54420.66050.39170.59690.37430.24440.59382.42933.15092.74741.96282.62160.48110.3680.15930.19030.57010.29391.30222.06490.85661.11930.07810.19460.02490.130.07040.22190.64441.3820.71860.45540.2455-0.0018-0.07450.63830.54620.5169-0.35150.1259-0.05170.09750.15940.0756
65
64gctry1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5695363
GGAAUAAUAAAUAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGACACACUUCGGUGUGUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.752good91.90.1411.5520.8470.50141.27161.07061.28591.23321.02571.59462.56123.17521.91773.59894.42313.07212.0231.56181.82241.60970.94240.17040.4170.99591.19770.47170.03050.30640.33680.35291.16341.07460.44120.46291.21422.38841.39581.86370.13850.26130.08380.83370.14220.63241.16132.03561.36361.06030.5830.39820.26470.35490.37541.00812.15332.35052.0581.56641.72480.36440.25870.11090.26690.46370.32851.25811.70.8241.14260.41510.15850.13670.14480.11460.1640.38451.11210.71860.32540.25870.20238.00E-040.69770.44280.48920.11180.16750.17130.39060.1735-0.0843
66
65gcwaterstrider2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5695428
GGAAUAAAUAAAUAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGACUCACUUCGGUGGGUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.966good93.90.1491.6360.8920.24670.96291.24051.55951.4161.59680.9142.32393.14013.82882.0874.12835.54682.28941.9281.83971.06920.75130.11620.26890.78141.22530.27650.25570.36560.81180.29711.10740.97870.6260.62921.32562.41071.23361.73020.42170.28010.05830.86490.24970.65051.53252.27311.14541.20710.55470.28920.47810.40650.21450.84571.71492.21252.4431.81481.80770.46820.32630.05740.17240.34410.18041.37491.8710.81351.31640.44060.08640.14460.0460.0430.09050.47771.18480.86190.34290.14180.1164-0.00430.74130.80140.45940.20660.18010.14150.48230.2310.0963
67
66Orderly
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5698764
GGAACAAACAAACAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAUAUGGUUCGCCAUAUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.487
medium
93.90.1221.3430.7320.47240.6360.72990.64980.16071.08290.69570.65141.34862.18270.9732.5123.79032.31841.51140.97521.07540.66850.05910.16670.96760.91590.37220.16760.15370.36320.55690.48660.94020.66230.30061.20461.66671.23971.77970.54830.14650.07850.49430.09420.34531.23832.11920.99390.99320.46440.24280.4110.37840.22490.38541.69912.37842.49331.71041.60190.610.16450.06570.24050.4750.25371.17261.72961.07751.46570.51170.16130.14650.07140.10530.17490.29241.18140.68310.33330.35840.09470.09190.62050.60320.36620.11290.1590.08770.34620.1297-0.0285
68
67Starry Level 0 - Water Strider - Gap Size 0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5702669
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAUGCUCUUCGGAGCAUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.922good90.90.1741.9151.0450.63841.94742.21351.48652.94562.7644.17553.62871.85863.6234.24444.35044.69293.38542.49871.72821.4461.12860.07490.14640.95281.63371.06320.13740.36710.52450.6971.41590.63420.81961.07531.70492.96531.57441.9590.6220.33230.06410.87590.20330.36031.37972.71731.62971.15550.54990.48530.63140.59940.33650.50752.28222.75772.75692.13052.28450.91620.42760.04930.28850.51830.34581.28691.87270.97031.220.33530.05290.15230.0160.04790.13970.28531.12840.76950.47140.24970.13610.06590.5250.5040.46120.17470.15440.02030.42520.1637-0.0231
69
68Starry Level 0 - Water Strider - Gap Size 0 v.2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5702673
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCAUGCUCUUCGGAGCAUGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.428good88.90.1321.4490.7910.26591.43131.52180.76511.2532.06793.02462.04251.45452.88963.19883.00571.99231.65531.12481.03551.07680.57890.11130.32361.35881.14850.28550.26560.47160.55760.38511.16380.85140.67270.50471.45642.22071.32981.66480.46580.25980.08590.86490.14550.34011.15752.06991.03040.94640.49260.21930.39150.34290.31140.84781.81142.51782.12121.64751.6230.55250.50370.12980.31980.40460.12491.00261.64370.71891.50680.44220.08230.15560.08690.05620.09370.2781.38920.7140.42660.2540.0790.0910.65980.63870.42210.18170.1160.10330.27770.28760.0086
70
69Simple barcode
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5703225
GGACAACAACACACAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUUAAGCUUCGGUUUAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.564good79.80.0820.9010.4920.42370.27610.30760.17990.24630.14740.46650.22670.33370.35710.58010.35261.35111.35740.65381.19150.90460.58760.03630.0380.17570.35750.11260.04770.3390.94430.32450.67940.56160.14150.28610.32460.68740.51620.64510.26130.11990.03010.23870.05950.31290.89052.26671.47691.14960.69120.48010.54620.12730.0760.39241.0581.80271.5840.99081.08430.61250.57060.10970.09190.18920.09240.46151.12730.52510.49620.18040.19680.04290.08860.09490.10950.72711.32730.82790.40460.17780.10130.08760.30590.35440.55760.39810.08240.0660.16030.07560.0284
71
70A lot of G
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5705704
GGUAUAUGGAGAGAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUGAUACUUCGGUGUUACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
1.214
medium
83.80.0482.2951.1723.36572.55312.87432.236701.32641.293102.462912.1864.922710.787511.23216.18375.23033.80432.83772.7981.0433-0.64612.12852.85630.0768-0.99151.39310.8605-0.94213.20941.73121.19770.53642.64333.71822.29512.8930.3269-0.224701.0201-0.10890.57971.77733.38671.51381.48660.208-0.1596-0.81280.3520.3902-0.15053.30073.27392.7872.17381.77680.3270.53160.11790.18110.408-0.05350.922.4491.0681.6477-0.1122-0.45050.29360.07710.29030.02680.21841.8450.74530.65290.4385-0.0588-0.54890.69410.7220.6428-1.6503-0.0304-0.40.0302-0.8471-0.7679
72
71lel0wsrfsgs0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5706005
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCAUAGGUUCGCCUAUGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.329good960.1711.8861.0290.77181.05311.24971.16710.87241.31024.52214.05124.00031.43033.8997.14184.08853.25512.75371.83331.65891.24680.07020.31821.46281.37830.31120.21810.43860.63520.40910.92671.01970.83340.49231.87042.25551.51692.23610.52590.37410.20970.92880.07270.33951.60482.41541.04331.26620.49980.29190.48430.43890.41770.68782.01192.61082.28111.98332.02940.55840.35950.13050.27960.56350.33081.36041.88910.78021.28050.23810.07960.19450.11280.06510.13530.43681.31660.90240.40230.28320.1040.07060.60060.580.40090.18540.0520.070.4070.2192-0.0264
73
72lel0wsrfsgs0-2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5706007
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCGAUAGGUUCGCCUAUCGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.749
medium
92.90.1391.5320.8360.77231.08710.98961.08950.68240.98212.93613.85862.28041.05441.80545.87334.36221.93261.3861.04370.96550.8370.050.31720.94540.93610.18750.06390.23020.48030.54630.90710.57930.43070.30671.40572.4761.49472.03540.38210.35610.03990.93210.21120.49031.40911.86041.19121.03660.37610.20320.28580.4360.29040.55571.69392.732.31371.42741.90540.56210.42570.09680.13580.32230.19930.97181.64010.9131.44260.53710.1360.17670.07010.02270.09380.41161.04240.74380.34330.26620.13470.15280.38040.57440.34870.32890.12020.00510.25880.2640.096
74
73lel0wsrfsgs0-3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5706012
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGAAAGGUUCGCCUUUCCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.676good92.90.1832.0091.0960.54771.74712.06180.65410.91942.34134.35214.56484.16651.83763.62058.07284.09382.77931.92921.76682.28980.99390.17270.50921.41541.34730.65630.16810.74281.14910.97021.07211.56660.96630.57521.17142.59611.4681.94580.58140.42230.05840.74580.06970.57461.59353.01161.76511.36710.62020.58010.49170.49120.23380.80712.28722.61022.34781.90262.1110.50150.34750.15560.20210.44270.18171.0771.69481.05111.11210.19140.11570.2261-0.01640.01480.17220.42291.66370.96380.44940.29130.11720.14990.57060.54960.59560.2073-0.01160.07080.22610.27760.0536
75
74S2-Frozen Water Strider Gap size 0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5706808
GGAUAAACAAAAGAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCUCGACGUUCGCGUCGAGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.658good91.90.1121.2360.6740.71861.14231.1231.13691.09011.10780.7481.14641.82682.21871.09012.01033.00841.91170.97710.70390.67820.60450.09960.52190.67741.0480.33310.12430.14460.41080.24640.93360.660.47840.53620.93461.67891.03361.28520.41750.34630.09220.50990.130.33060.97071.65760.77950.91130.45590.20320.26890.25250.16040.80681.44731.95832.06271.33961.40970.62860.27680.18380.22540.34040.21450.71631.52520.74020.79820.44330.09790.24680.02630.06630.16450.41781.13330.86350.34840.71790.21890.18910.63790.42710.28550.35390.12220.02820.20580.13050.1115
76
75Mat - Water strider - Frozen shape - D1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5708257
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCGCUAGCUUCGGCUAGCGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.99good92.90.1421.5670.8550.15821.43941.39721.39791.37423.41013.36532.7681.86993.23524.30193.5943.562.06161.35681.14460.980.97330.01030.29730.69480.85320.29590.07380.11630.55180.36390.89310.65450.64570.63531.38582.22881.31631.97150.50010.38990.2110.69980.12990.42471.37862.31021.33261.06150.46930.27610.39590.35620.2090.60891.76742.15832.10711.51491.67820.63230.26050.17210.20160.42460.28771.23111.62920.91071.08050.42170.09620.13150.11530.04150.13560.41141.35570.81850.4680.30270.03860.030.52360.67380.48890.24050.120.0260.26150.27920.0463
77
76Mat - Water strider - Frozen shape - D2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5708260
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCGUUAGCUUCGGCUAACGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.833good92.90.1291.4190.7740.15731.54921.39131.37371.76962.01992.46762.42651.78323.28592.6663.32962.27451.48441.09171.04580.64950.83350.09140.19890.6190.97210.22610.0650.39330.51150.36040.96730.74870.29340.42661.19932.0540.95621.86750.45190.26180.05740.46520.14960.29651.17092.14081.23540.87880.29310.40470.38750.37950.14960.59541.70162.19322.32281.59281.60850.48830.37510.11560.28730.90180.27541.17561.82950.82941.11370.25380.12520.18570.06070.08230.15030.55051.34230.79430.3070.23620.17580.11720.69570.62510.39090.09920.14010.04660.26250.23840.089
78
77Mat - Water strider - Frozen shape - D3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5708263
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCGUAAGCUUCGGCUUACGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.773good93.90.1451.60.8730.50491.2260.90760.72971.91022.50213.55733.31490.86362.33675.23793.99993.09442.55611.5310.95930.79120.98770.11380.11260.83350.91990.40580.20090.39110.66040.2350.8521.08990.55230.63081.17392.8351.08881.86720.38580.25810.06860.58090.21210.43721.44422.51081.34541.05510.51160.31060.43780.32650.28750.55011.8482.63852.43931.70671.60210.42890.3720.08510.29350.36350.25541.10661.77430.83651.10920.31270.08360.10830.14690.05260.13830.61851.19480.73190.38650.28670.15180.0420.4420.51020.43470.09210.13540.05570.34150.25170.0487
79
78JMF s take on Lab
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5708587
GGAACAAUAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAGCACAUUCGUGUGCUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
8.881good92.90.1471.6140.880.7571.38911.38210.5650.57741.06082.32473.63123.73411.39652.31885.45253.04722.63561.7171.27191.19380.7030.11630.28641.0131.16170.32590.16450.47220.63830.45490.91031.01050.53840.59141.3642.59071.52312.18260.51870.33540.07690.56520.19890.43281.42492.22631.0961.06870.35770.42070.31560.44270.24890.72192.02992.34872.18291.93881.99790.60810.34260.0930.26910.44230.26921.47691.7770.76041.25750.33020.11270.1470.13590.05380.12350.40481.11470.84830.4230.16320.1207-0.020.45770.53370.3850.10180.08930.00260.28890.10650.0494
80
79JMF s take on Lab 2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5708609
GGAACAAUAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAGUACAUUCGUGUACUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
8.613good91.90.1561.7210.9390.74081.33081.08070.91520.50321.40482.46273.84673.73711.31932.28735.87693.54462.47182.02461.37381.19070.94810.10420.29881.45551.36140.55670.1910.43930.64970.40321.02920.68810.59250.66691.47552.54461.58571.82540.57290.34270.0861.07910.21290.41181.53442.55681.33840.99180.76390.36020.56630.41520.16650.6722.52582.8632.44011.89642.08310.6130.33460.09070.18630.39180.25341.19361.92810.94611.11250.37870.07470.18380.17990.02190.09370.3471.18360.71430.40480.16760.06510.11110.57550.73420.37620.09460.18280.06410.28780.1358-0.0221
81
80JMF s take on Lab 3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5708611
GGAACAAUAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGAGUGCAUUCGUGCACUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.798good94.90.1541.6890.9210.5261.25781.18540.80591.24811.03442.77314.41233.51031.49123.28546.60883.65652.56931.99050.79831.13040.56730.090.46230.92881.28390.47960.22110.56940.6940.27420.99090.78020.65150.44671.28172.08841.31721.92590.40680.23110.08380.6810.21580.31661.43022.49251.161.28310.46360.35470.52270.41490.27650.67192.03292.12992.62091.80262.08150.48650.31950.02650.32940.38190.31461.01881.94771.09651.07560.57350.17210.17460.11660.08020.17980.49461.43690.82340.32740.20750.09540.10220.55210.51540.33360.0640.14480.02470.31890.1620.0414
82
81water strider frozen 0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5709091
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGUUCUCUUCGGAGAACCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.312good89.90.1611.7750.9681.00192.78142.3170.68841.6874.62094.13563.94330.9092.90775.9743.29183.7462.42822.04821.36591.03550.92160.07440.20341.32431.33950.30280.07520.32210.72040.27591.17391.55430.74860.58041.55162.53781.51382.14570.21320.34360.05541.07150.16080.34021.5942.5981.45951.26220.40120.32720.30860.35070.3310.69171.84712.76232.51122.17972.18010.7040.40730.08570.14930.32970.31011.51731.87320.76491.16070.38450.16090.24620.03630.07980.07610.26481.2680.78470.46070.20340.08520.09680.38220.62240.411-0.10130.11230.0510.22250.18120.0856
83
82water strider frozen 0 2nd
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5709093
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGUGCUCUUCGGAGCACCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
4.289
medium
91.90.1291.4180.773-0.00710.2960.57620.1772-0.74351.1712.5773.40490.61921.62744.5222.50762.69562.58071.44891.10221.12170.92440.07130.16110.98780.95170.45530.11280.09990.45290.55490.98370.7480.6280.42121.34021.8861.43331.54340.21210.19760.00530.55010.00950.4861.28252.40791.64730.89120.50120.33410.45550.35990.17630.6642.0242.17582.06481.50311.6590.63370.3950.13650.24480.32990.31271.311.97790.61941.09970.04830.1370.14330.14240.10860.17580.52811.26110.94830.48170.23880.1550.06830.60070.61090.32820.22530.1737-0.020.24920.22290.0068
84
83water strider frozen 0 3rd
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5709095
GGAAAGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGUUGCUCUUCGGAGCAACAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.036good90.90.1141.2550.6850.0551.15481.08140.72931.27741.92811.88542.46351.00741.97213.49352.69362.16581.78111.34150.91750.91180.51340.14620.30610.60391.16490.36140.1950.38050.29090.20490.74430.95480.46990.35051.21841.31211.39410.3260.07050.09750.38920.04440.33291.1682.19121.32230.90990.43870.44020.43330.19480.26920.64731.54811.66351.81411.48421.53670.53250.21540.1010.12220.44530.24240.80031.44960.79451.16140.3030.06720.07830.07330.06830.05360.33851.08650.68450.23420.09720.11080.10650.41260.55080.35010.17760.1220.04750.17440.14360.0512
85
84Water Strider Frozen Shape Gap 0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5711882
GGAAACAAAACAUAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCGAUUAUUCGUAAUCGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.953good91.90.1651.8130.9890.37690.72851.07121.27130.90751.7121.75162.8320.69362.66262.28925.20785.47372.8551.94561.73711.65151.0510.19280.27541.91331.84790.46150.17280.54710.49750.430.85640.87520.70130.47231.51852.32061.39751.87320.51620.33280.10460.69870.15550.43141.59122.29851.46991.34110.69080.23540.54380.58960.32051.10192.34852.67522.46412.08142.19840.56590.25990.15680.12360.50510.28541.50332.07920.9141.29690.21280.08330.15880.1210.04470.15470.43971.19790.82360.32360.21130.16490.06030.56250.7530.31610.20920.11430.06510.27630.18850.0893
86
85Water Strider Frozen Shape Gap 0 - GA-AG mismatch
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5711886
GGAAACAAAACAUAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUAGGCUUCGGCAGAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
8.138good88.90.1561.851.0030.37540.81692.44463.2991.41122.44334.23024.63032.92893.6091.85854.94636.57963.46172.93092.12651.33351.16750.06650.19380.36050.71060.16970.16630.86032.34160.54090.83321.49731.67130.30961.24341.92181.34241.21810.37360.26690.06960.39390.01240.33351.76393.55142.27891.72010.76770.54670.77170.18870.10830.36611.96462.83061.93561.48641.47570.76190.53120.09420.10740.2260.1060.56621.42440.67170.78950.2244-0.00290.08830.0940.00290.13430.59821.59951.01960.55130.26460.14340.07040.52460.57940.62180.02470.08770.04670.1880.18850.0149
87
86Water Strider Frozen Shape Gap 0 - crossed GUs
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5711891
GGAAACAAAACAUAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUGUGCUUCGGCGUAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
13.417strong88.90.1161.2760.6961.59531.43521.39421.2720.73191.20022.02091.81541.08171.46510.99142.96593.42562.6081.55381.68871.32811.0940.15770.16230.4450.47350.20430.05030.92910.44310.02890.25120.26311.62950.09890.46551.03360.79240.78990.1210.22670.15560.19410.07730.30011.28432.8732.12721.52950.91580.48740.83080.20030.10410.35691.6222.24191.73891.26061.39340.71320.56620.15420.15970.23680.10710.65221.39420.59330.90350.37430.060.06240.09060.06370.17210.59191.29020.96520.4190.16140.0710.09160.39620.54020.65640.17240.21280.04990.33120.2080.0439
88
87Way_out1 gap0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5712107
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCCUAUGGUUCGCCAUAGGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.915good960.1441.5840.8640.18151.05911.86561.59591.57323.36173.14682.77161.56242.93853.92063.34053.03362.24051.92751.10680.76070.8210.12410.3720.95951.39670.17350.15570.10620.26370.37040.78830.780.56430.49381.20612.33441.21771.87450.32650.31630.11950.76050.08730.49150.97031.74231.04070.93010.25980.30590.41740.40120.28580.90511.71762.49172.09011.45031.56860.55370.45240.24610.30850.47260.35431.13131.97050.77371.38190.82990.14790.31570.13890.10190.07240.5861.30730.7620.43850.39650.16260.12350.59470.64030.40350.1180.14050.09830.40970.24180.0454
89
88Way_out2 gap0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5712109
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGCUCUGGUUCGCCAGAGCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.234good94.90.1441.5880.8660.45732.24161.69981.97082.90133.64193.8353.21621.97943.38533.62272.98172.99192.1941.70671.37971.23520.61660.12220.38211.20931.76130.31440.11590.3140.45040.31920.74150.71260.37060.43891.29392.02031.15821.44060.15550.28840.03420.72240.08220.40321.61352.27921.35741.14450.61530.31950.42780.35280.18080.56061.55551.9291.96361.63831.4980.46060.26810.09460.08490.38550.16060.981.49210.73370.98370.42750.060.13890.13850.0420.14280.38191.15350.73990.34540.31790.09130.05210.520.46280.50230.15670.16650.03420.25420.17410.03
90
89Way_out3 gap0
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5712111
GGAAAUAAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGGUGUGGUUCGCCACACCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.176good91.90.1141.2570.6850.6851.66091.50831.32961.81732.23662.19271.77471.83442.48792.24112.10311.90891.53571.12470.82770.81930.51710.01040.33920.59360.92050.39130.08370.18530.44080.21020.65690.7720.54710.52491.07821.72571.18151.26640.35540.1350.18910.67650.14540.14611.06451.49330.78050.70160.34360.17650.29180.26340.15120.62391.42612.21222.00411.72921.4570.31030.23860.09740.10330.49380.34711.00631.54540.93291.03780.43950.13420.16380.09710.0110.09920.36370.98950.52860.23180.1720.07270.17240.63730.42990.43420.25040.14640.06010.23930.18740.0595
91
90doom strider lab 1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5712375
GGUAAAGAAAACAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACGACGUACUUCGGUACGUCAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
6.286good93.90.161.7620.9610.66691.1131.47111.94730.96381.96024.12064.41094.51081.44433.30596.72593.60582.95751.67371.4121.3060.9210.1480.18791.03111.40840.39770.31490.42960.64960.26051.05230.83880.55760.42951.70352.62971.69582.12150.74170.20420.08560.55360.11080.4351.55842.09521.47750.81870.57250.23790.26420.41910.16010.472.20982.63512.34871.86482.01390.60850.33970.06730.16130.33350.20491.24261.8821.00131.17840.29130.15210.14350.07940.05530.14970.40571.42720.89450.40510.2050.1396-0.07580.58320.63880.46330.12870.21250.13170.28350.14860.0031
92
91WSF gap 0 - Omei 1
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5712522
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCACUUGCUUCGGUAAGUGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
7.207good89.90.1371.5030.820.51691.3010.99931.2490.61791.51423.44913.03672.73811.17552.30165.17173.13631.73931.28050.96330.89630.8480.15920.17970.79351.02190.26530.10040.25560.3970.49541.32580.82520.59630.54131.35412.33451.27891.76470.49860.31580.02010.82570.13920.25861.0522.14331.43941.03930.63460.41810.28410.36040.29730.70871.81652.50492.27061.77361.79450.65680.27270.07170.31090.56180.17171.01711.96210.91291.20050.35630.15580.19830.10840.04690.1320.47141.17670.74170.36350.23410.13640.03460.61950.49730.45080.07130.14080.06070.32070.2424-0.0335
93
92WSF gap 0 - Omei 2
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5712529
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCACUAGCUUCGGUUAGUGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.043good91.90.1551.7070.9310.79441.63660.71721.79821.30471.57022.81223.37673.24871.32543.15256.12763.79462.61461.37141.7311.19091.07390.14470.17151.15791.5680.39460.18610.44360.28190.50931.20711.17010.59360.62771.75593.08471.50922.2140.42670.31020.01480.73240.03960.76232.06792.51781.10151.19910.55670.61480.45940.38860.14890.34731.99462.82012.26841.61741.4590.78840.31390.08680.22550.45240.29961.26291.80260.85251.17590.26120.14250.16050.0680.0460.12940.60631.50130.88820.37340.20490.1653-0.05190.66730.65340.38220.04890.17340.03480.40220.20520.012
94
93WSF gap 0 - Omei 3
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 0
5712532
GGAAAAGAAAAGAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACCACAUGCUUCGGUAUGUGAAAAGAAACAACAACAACAAC
...............((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))(((((((....))))))).....................
5.345good91.90.1441.5880.8660.17910.67241.26291.33460.42891.79143.28653.01482.58470.99552.38286.28353.2972.11691.35811.19311.12070.79260.08610.17371.15131.09270.37680.20930.07980.71810.261.25531.24650.46420.39541.25222.2181.55381.66010.32270.20590.08450.9970.1090.31421.41672.21251.30181.33260.52950.39150.39940.5250.24470.67491.74622.82892.26471.54422.02030.49780.33080.11960.43940.3350.24341.00671.78290.9051.36720.4310.14320.18160.1060.07770.02120.60161.25311.12470.51720.39270.06940.0980.7330.6280.4296-0.37660.0422-0.06570.37040.2128-0.1028
95
94LEL0-wsrev-GS4_01
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 4
5637460
GGGAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACAAAACCAUACCUUCGGGUAUGGAAAAGAAACAACAACAACAAC
...........((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))....(((((((....))))))).....................
6.487good91.90.09110.5450.01570.50531.47221.26520.71780.60452.07191.70761.29961.07640.84990.63940.49420.61560.06780.25130.72740.6370.16290.02980.29090.78850.31480.50470.46450.48680.36010.98711.45590.76031.33240.25650.21380.25120.45190.07150.27540.83221.13980.82570.61380.29990.19420.24460.2140.19570.51681.50991.8311.79971.23041.4260.35990.23350.06470.14750.2540.12840.51061.43910.74570.93190.51680.11780.2070.04060.06720.07550.19571.01050.55160.38420.12770.04930.12820.30650.33470.49390.2650.09320.09360.36960.12940.12440.18290.85531.21880.6566
96
95LEL0-wsrev-GS4_03
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 4
5637468
GGGAAAACAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACAAAGCCUCGCCUUCGGGUGAGGAAAAGAAACAACAACAACAAC
...........((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))....(((((((....))))))).....................
7.559good88.90.1311.4450.7880.96610.49861.62552.22931.79351.05541.49164.09632.03841.83261.4890.95351.02951.00750.06260.29291.13151.16370.40010.11580.31260.4130.37190.83790.62240.56820.46051.08172.17391.32631.61990.66890.39830.32850.88350.3070.36811.14232.61680.99111.69331.13190.56850.59860.45440.20880.8892.40082.65942.28431.85032.04080.51250.25180.06070.3780.78220.31331.11291.78811.04231.38270.40890.13550.1560.15420.00810.10640.44591.18571.02920.2890.24220.13930.01610.79380.67650.46610.20920.13270.12140.34850.2590.10510.58021.38981.23980.6028
97
96LEL0-wsrev-GS4_02
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 4
5637475
GGGAAAUAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACAAAGCCUAACCUUCGGGUUAGGAAAAGAAACAACAACAACAAC
...........((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))....(((((((....))))))).....................
5.497good89.90.121.3230.7221.54150.48733.59273.32711.39231.96943.29372.42072.44771.47241.18120.6660.92930.76530.07620.22730.62140.98050.10230.11540.20050.25340.18130.8321.29090.73890.53051.18461.951.16511.69190.68750.28050.17810.62260.11350.53311.21782.20720.78160.92970.3660.13550.34580.60120.38950.60471.75652.40612.44521.57361.85620.57220.28920.06110.23720.29240.28140.96531.90040.87661.31020.98150.11520.16580.16510.03810.09490.39491.31860.63740.51250.41180.1240.04220.49750.77530.41640.14720.07890.08750.23670.13680.10990.32581.24941.18110.4666
98
97Chipmunk
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 4
5638271
GGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACAAAAGUGCGACUUCGGUCGCACAAAAGAAACAACAACAACAAC
...........((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))....(((((((....))))))).....................
5.785good91.90.1231.3580.740.7161.85732.21772.29741.08381.85343.69433.27252.55921.93351.40780.73330.77040.41790.14770.29260.55430.82570.43430.29290.37250.45680.43270.6870.76170.41290.37351.27662.2860.78981.55070.23680.31960.09180.84980.24110.42381.52071.92031.36330.97880.36370.2920.3540.43860.22450.53761.78372.50352.1821.49241.55540.29090.20220.18630.30090.28070.12420.84061.97010.99161.36110.37630.05820.15710.11020.02350.06960.43491.23730.540.3230.14760.13920.04160.48720.59420.3350.21140.21690.09480.1570.18990.06660.42091.48930.94570.513
99
98Squirrel
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 4
5638273
GGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACAAAAGAGCGACUUCGGUCGCUCAAAAGAAACAACAACAACAAC
...........((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))....(((((((....))))))).....................
6.494good90.90.11.0950.5970.52012.0182.07651.83680.43561.22334.06082.00291.78541.33821.22950.44580.42290.64060.0880.16850.81110.57480.27310.10160.31580.38540.22950.4840.63570.32750.25640.79671.57580.59451.37570.25640.35230.05060.7930.12070.2530.88911.47990.80390.6480.35550.3340.26370.1860.16260.74021.58251.86731.86361.71081.61250.42870.29930.05120.23670.33220.20021.00921.41790.63841.01660.31110.04810.2680.13390.05420.05020.23181.04350.54920.20740.08840.0730.0620.38490.50570.25730.30350.13130.04320.19160.16440.05090.36691.03340.83970.4348
100
99Sugar Glider
Lab Entry Level 0 - Water Strider revisited - Frozen shape with gap size 4
5638278
GGAAAAGAAAAGUGCGGAGCGGCAGACGAAAGUCGUGGAAACACGCCAAAAAGUCGACGAAAGUCGCCGAAAGGCAGACGCGACGGACAAAAGAGCGUCUUCGGACGCUCAAAAGAAACAACAACAACAAC
...........((.((..(((((.(((....)))(((....)))))).....((((((....)))(((....))).)))))..)).))....(((((((....))))))).....................
5.507good91.90.0981.0780.5880.65192.3732.15342.04180.8071.20122.91752.35191.66161.14041.15430.67890.31610.59580.02320.23210.38050.76840.27140.03360.28060.26050.31880.61820.56460.36010.34651.2281.09981.16621.42460.11160.15010.09280.76410.16440.25180.97011.32611.01270.79630.15260.24390.16980.22770.17360.79531.52461.88981.59811.53351.72030.47180.21540.08410.13930.29870.16670.70611.35540.63270.99240.3110.14770.17120.12270.07460.06510.35461.24420.59140.31270.15310.11710.03260.34950.56640.24250.28590.1760.07010.20730.13120.03550.28580.95430.76650.4918
Loading...