R84 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79X80X81X82X83X84X85X86X87X88
2
1OrticeFMN Binding Site - Rotated4005946
GGAAGAGGGUGGAGAAGGGUGUGGGUAAGAAAGAAUUACCCACGCAGGAUAUCCACCCUCAAAAGGAGGUGCUUCGGCACCUCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.539
medium
88.90.0840.9850.5350.79911.67521.67810.78070.0950-0.122800.09500.09490.18940-0.0280.37730.06580.0941-0.17850.03730-0.12170.14040.1402-0.121600.46530.89450.85060.51283.85120.65091.25111.18731.00860.87930.166300.2490.082900.04540.165400.1651-0.03750.20911.93991.43272.67520.72810.41750.15310.1529-0.16160.076400.152500.0762-0.00941.42651.77341.65170.57811.7781.33510.210400.16150.23050.20880.58863.130.5511.84261.6852000000000000
3
2IsrediFMN Binding Site - Rotated4006531
GGAAGGGAGUGGAGAAGGGUGGGUGUGAGAAUAAAUCACGCCCACAGGAUAUCCACUCCCGAAAAGGGUGACUUCGGUCGCCCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
2.803
medium
97.20.0831.0380.561.02851.61182.20841.52430.16660.06240.00180.06410.124500.0830.02240.08280.14620.47340.32920.42960.40730.02150.1622-0.0198-0.080.22280.101300.06150.04030.73951.2231.73942.44981.24781.40061.34732.08350.01190.1660-0.0120.047300.0117-0.11840.0710.31850.47352.92651.45113.01820.7270.40570.16130.0323-0.026400.09670.03220.0966-0.05860.09652.05852.13632.21291.64251.55620.08860.17590.37860.17410.37630.25990.34552.17090.75420.83120.7115000000000000
4
3JR_FMNBindingRot_Sub1FMN Binding Site - Rotated4007357
GGAAGCUGUAUCAGAAGGUGAUAUUGUCAACACAAGAUAAUGUCAAGGAUAUGAUAUAGCAAAAACUCAUACUUCGGUAUGAGAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.366
medium
94.40.0620.6790.370.09522.00251.13191.07760.11640.058200.05810.1161-0.16720.23170.11570.02890.03190.5195-0.05480.42890.19980.08900.14210.1136-0.11190.05830.05670.169800.05781.99812.22020.84390.74120.51931.53921.3149-0.00760.2490.25620.10240.15340.2041-0.07590-0.11010.09330.19420.54520.41691.7274-0.03240.44050.09780.2927-0.06020.03720.29140.29060.16890.09651.07030.75760.64420.93291.3820.64120.18290.1370.13680.22760.22720.1814-0.01760.74640.42910.6920.838000000000000
5
4GeedonFMN Binding Site - Rotated4007513
GGAAGGGAGUGGAGAAGGGUGUGUGAGUAAAUAAGACUCACACGCAGGAUAUCCACUCCCAAAUAGGCUCGCUUCGGCGAGCCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.519
medium
90.30.1251.3730.7491.39882.30991.25290.86070.33490.16720.167000000.019800.92650.19160.09110.11720.08180.163300.163100.1628000.324701.76931.57352.61672.98730.44630.88560.58730.584200000.436400.29020.1449-7.00E-040.50431.62721.81353.8891.19730.38470.1322-0.14470.1321-0.012600.13180.26290.13130.13122.29341.8922.87371.78121.89230.93820.58330.58030.23160.91890.54160.89417.36761.14592.14572.2571000000000000
6
5Starry s Rotated Binding SiteFMN Binding Site - Rotated4019473
GGAAGCUAGUUCAGAAGGACGAUUGAUCGAAAGAAGAUCAAUCGUAGGAUAUGAACUAGCAAAAAGAGUCUCUUCGGAGACUCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.078
medium
84.701.5040.7521.26532.85771.73911.892000000.565100002.2156000.27630000.2756000000.27491.35782.41224.79883.90022.96633.78313.1204000.22240.22200.22160.2211000-0.37592.38061.28362.20490.413600.206400.2061-0.16530-0.32712.09080.39681.56491.35273.00883.10811.44372.47080.87550-0.01461.37923.3060.33252.5191.75951.5771.91592.3383000000000000
7
6Scrumptious (FMN Binding Site - Rotated)FMN Binding Site - Rotated4024149
GGAACGAUGCGUAGAAGGCAUACUAGUCGAUAAAAGACUGGUAUGAGGAUAUACGUAUCGAACAAGCCAUACUUCGGUAUGGCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
2.398
medium
94.40.0891.0320.561.79561.90341.42320.564300.18780.16070.13380-0.0718-0.0548-0.00980.18650.12280.99530.15310.01470.05230.05230.05230.10440.10430-0.0711-0.0899000.2411.37653.88661.70882.37081.47272.02033.21110.08910.0891-0.02580.0890.044500.08880.062800.08870.35360.6930.98323.30010.43230.25050.25560.18690.17890.05450.20660.12380.16490.1360.35232.24761.42420.6971.55731.46480.53190.49180.22650.15080.4880.04880.41071.44090.91330.8340.9705000000000000
8
7
Scrumptious 2 (FMN Binding Site - Rotated / Flipped GC to right rotation closing the FMN)
FMN Binding Site - Rotated4024185
GGAACGAUGCGUAGAAGGGAUACUAGUCGAUAAAAGACUGGUAUCAGGAUAUACGUAUCGAACAAGCCUAUCUUCGGAUAGGCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
2.342
medium
93.10.0981.0890.5931.5190.98061.31090.7236-0.04540.13880.02780.1109-0.04560.13840.0830.2208-0.07810.22030.38430.03990.21860.21820.0545-0.0234-0.077900.05450.08530.05440.1628-0.02350.27061.70563.95882.46032.73352.07012.71251.78310.3650.04560.045600.091100.0910.04550.05940.2720.54132.39361.41233.12890.26780.29410.17490.20920.0140.21520.2080.42040.08280.1240.37071.54371.32760.99881.48861.4310.50050.61170.11470.22840.34160.11340.30161.08440.25960.7360.9534000000000000
9
8
Scrumptious 3 (FMN Binding Site - Rotated / Quad GC and Flipped GC to right rotation closing the FMN)
FMN Binding Site - Rotated4024195
GGAACGAUGCGUAGAAGGGCUACUAGUCGAUAAAAGACUGGUAGCAGGAUAUACGUAUCGAACAAGCUUAUCUUCGGAUAAGCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
2.455
medium
97.20.1041.1540.6290.23880.67071.12780.54960.1608-0.04730.05980.13970.10680.053400.2130.18610.32330.76730.21920.18310.42110.03030.1040.030200.05190.20730-0.16880-0.02171.70984.37282.38453.03741.70872.39892.24440.26170.2177-0.10220.13040.04350.1440.173200.01380.14320.43022.16172.15013.49510.56390.4358-0.0590.07910.15790.08530.11820.13050.23520.03920.51262.09371.15250.67741.84671.31350.54390.39740.03640.14440.35890.25030.17740.9880.63211.10720.7871000000000000
10
9FMN rotated 1FMN Binding Site - Rotated4027827
GGAAGUAUAUAUAGAAGGAUAUAUAUAGGAAAUAACUAUAUAUAUAGGAUAUAUAUAUACAAUAAGGAAAUCUUCGGGUUUCCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.018
medium
79.20.1151.260.6872.97442.6311.0662.319900.11590.231300.23080.230300.45870.456900.1688-0.05840000000000.2266-0.28470.22611.99885.28971.87241.642.51421.68040.9733-0.08820.38730.19330.193000.19260.19230.1920.382702.97980.18590.1856-0.09650.1850-0.096400-0.0960.18410.5496-0.01120.54421.43272.0682.34353.03091.67440.80640.1611.43080.47491.8683.32290.77311.18440.58911.30992.1413000000000000
11
10FMN rotated 2FMN Binding Site - Rotated4027835
GGAAGUAUAUACAGAAGGGUAUAUAUAGGAAAUAACUAUAUAUAUAGGAUAUGUAUAUACAAUAAGCAAAUCUUCGGGUUUGCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
2.582
medium
94.40.1221.3430.7321.18742.11221.96942.21520.12860.19710.06890.34340.13720.126800.34130.05780.5090.36090.3370.24620.33470-0.07830-0.2343-0.156-0.1666-0.07780.07830.033401.67023.66432.82592.35842.42491.5321.1510.32430.0375000-0.38390.17160.228300.52741.48342.92281.90682.88610.36220.15730.30880.0781-0.02470.20510.05120.23070.07720.25460.35531.94283.33122.32312.90063.18450.23550.39830.30890.17631.17721.3780.52431.16560.56931.08580.5403000000000000
12
11FMN rotated 3FMN Binding Site - Rotated4027840
GGAAGUAUAUACAGAAGGGUAUAUAUAGGAAAUAACUAUAUAUACAGGAUAUGUAUAUACAAUAACCAAAUCUUCGGGUUUGGAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.523
medium
94.40.1141.2510.6832.82742.86721.24842.5470.53780.041700.1941-0.1110.12920.04130.16980.12860.38440.51030.50790.37970.2525-0.17510.126100.126-0.0490.12570-0.348500.18821.63353.91921.92592.61522.10381.96851.72290.10760.4287000.10710.21370.10680.10670.21290.10630.52922.48391.22832.69710.49720.12520.09910.1978-0.07330.09870.19710.09850.09840.29440.48862.53082.84821.73812.85281.7550.26260.35120.34910.4320.60151.19020.761.07570.6630.65910.8179000000000000
13
12FMN01FMN Binding Site - Rotated4030236
GGAAGCUGAGUGAGAAGGGAAGAUUUUGGGAAGGACAAAGUCUUCAGGAUAUCACUUAGCAACAACUGCGUCUUCGGAUGUAGAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
8.148good98.60.0571.0050.5311.13041.57631.05371.13230.19670.03690.01060.05330.02910.01140.0483-0.01960.05020.23170.43810.11530.18670.34080.06590.10110.0215-0.0210.05770.0325-0.022-0.0398-0.1038-0.00390.99014.15433.45540.98561.71452.88193.34380.31040.12450.04630.08750.14610.11110.05070.02210.05380.09470.56262.99191.87084.00211.07110.38370.07810.10080.01720.06830.20890.14440.21090.14370.14241.83991.06150.81371.57790.63560.16840.17980.17060.03240.18120.09610.07950.52380.22240.45330.3179000000000000
14
13FMN02FMN Binding Site - Rotated4030250
GGGACGUGAAGGAGAAGGGCAGACUGUGGGAAGGACACAGUCUGUAGGAUAUCCUUCACGAGAGACUCCCUCUUCGGAGGGAGAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
3.992
medium
97.20.0651.2070.6360.83490.63831.73930.74210.11670.16650.0832-0.00460.2910.0662-0.03790.06560.06350.27960.48560.54470.4430.36950.07750.03220-0.02070.13690.03210.06420.0610.0578-0.00321.47824.49444.07930.92692.06962.49612.85840.22670.03750.0374-0.0349-0.0081-0.0136-0.01610.02670.01870.64230.73454.04612.58073.72660.48990.69970.10730.21250.03620.01250.08320.20170.07170.11720.43272.02581.23041.63642.09860.410.66860.09730.1511-0.01280.04310.15080.37572.17870.79420.50640.6000000000000
15
14FMN02FMN Binding Site - Rotated4030261
GGGACGUGAAGGAGAAGGUCUGACUGUGGAAUGAACACAGUCGGAAGGAUAUCCUUCACGAAGAACCACAUCUUCGGAUGUGGAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.888
medium
93.10.1111.2260.6692.40171.54052.70760.250.38410.38950.04330.08650.20720.1720.11990.31560.05930.80420.78460.58420.51150.13760.176-0.0691-0.0279-0.02790.082100.3276-0.1379-0.109700.75443.43544.54710.81883.25211.38861.61630.16440.2792-0.10840.13940.16990.03070.13870.0693-0.1080.1730.47721.52042.02543.69190.31930.19120.14730.19050.06350.019800.12180.2520.12580.76741.62931.89622.27242.17041.3720.73830.67740.33770.11240.23020.0560.16782.14140.65390.75780.8594000000000000
16
15FMN rotationalsFMN Binding Site - Rotated4030771
GGACGGUAUAGGAGAAGGGCAUAUAUGGGAAAGAACCAUAUAUGCAGGAUAUCCUAUACCAAAACGUAUGGCUUCGGCCAUACAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.388
medium
81.90.0680.8450.4560.60230.69360.44110.47610.31650.03960.276200.15760.314300.04020.15670.07830.1376-0.05680.23330.23280.155-0.0387-0.1160.15470-0.038600.385-0.1157-0.03870.2681.68771.00320.14890.55110.73520.80290.145800.0728-0.22930.07280.07280.2178-0.22880.145-0.04180.43311.73181.43682.65420.13650.61110.06790.0678-0.04620.135400.110.55720.0670.53380.59731.48921.45270.80821.17880.81770.68760.06250.74470.55580.49181.25311.82630.59362.18261.6908000000000000
17
16minimizeFMN Binding Site - Rotated4032096
GGAAAGUCUGGGAGAAGGCGCGCAGUGGGAAUAAACCACUGUGUGAGGAUAUUCCAGGCUAAAACACUCAGCUUCGGCUGAGUAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
2.605
medium
91.70.0640.9130.4890.88361.23771.73711.46680.4820.0710.17260.08620000.27950.0759-0.06840.4910.04870.16470.0848-0.2638-0.0581-0.01570.08470.042300.04230.04230.0423-0.0290.90182.69674.46591.17891.07021.93210.67170.03730.03730.07450.01690.07440.22290.07420.01670.03710.05560.05160.57610.81113.03210.28290.35250.07050.10560.03520.07030.22330.07010.15270.130.84312.5472.22881.71621.28351.06540.32420.13980.06340.03810.22110.09470.39312.03020.61350.54950.7881000000000000
18
17
Rotisserie - Brourd - Lab FMN Binding Site - Rotated R1 - Sub 1 (AC/AC Hairpin)
FMN Binding Site - Rotated4041891
GGAAAACUAGACAGAAGGCUGUACCAUGACAAAACCAUGGUACAGAGGAUAUGUCUAGUUAAGAACUCUGACUUCGGUCUGAGAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
6.091good93.10.0490.8920.4710.90292.5552.37082.1090.85030.11220.08040.01310.02750.03610.15770.04630.04850.06370.51940.16030.20140.01230.00410.01250.00830.04980.01870.0020.0082-0.02080.06210.13793.71232.80122.27791.14230.83541.37780.3970.11560.0770.0110.02750.01650.055-0.04410.03280.03840.05490.06010.45820.83273.09120.17990.23920.01630.16540.02090.13980.07990.08150.13240.21991.02282.39661.79352.92592.21811.34160.25530.08410.12090.18360.27560.15930.24280.6990.3160.47810.5858000000000000
19
18Roto - Brourd - Lab FMN Binding Site - Rotated R1 - Sub 2 (AC/AC Hairpin 2)FMN Binding Site - Rotated4041900
GGAAAACUAGACAGAAGGGUCUACCAUGACUAAACCAUGGUAGACAGGAUAUGUCUAGUUAAGAACUGUGUCUUCGGACUCAGAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
6.343good93.10.0750.9920.5331.10511.98142.40371.8140.65150.03860.14160.05070.04370.09240.20180.06860.06690.13680.44330.27920.2770.21930.17940.03590.02390.01850.0304-0.0108-0.050900.01190.81812.86242.27062.35611.51291.08431.39160.06510.04120.07820.01850.02510.06750.05290.03170.07790.0950.03670.28352.84251.07813.1930.36970.22720.14140.13880.02920.03390.02140.13320.17160.23130.91472.5141.97152.56462.42211.22520.13880.29330.12110.26620.19730.16230.17070.78720.35860.42430.2848000000000000
20
19Rotary - Brourd - Lab FMN Binding Site - Rotated R1 - Sub 3 (CA/CA Hairpin)FMN Binding Site - Rotated4041902
GGAAAACUAGACAGAAGGAUCUACCAUCCAAAACAGAUGGUAGAUAGGAUAUGUCUAGUUAAGAAGUGUGUCUUCGGACUCACAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
8.264good93.10.0551.0820.5681.18012.0912.31622.37260.8640.16980.09330.0340.01260.04950.15520.03640.1210.12760.40170.19590.1320.23130.12230.02720.01810.03920.0060.00150.0256-0.02410.03310.12191.94733.86283.00822.74181.52690.76340.44550.02260.01510.04730.02680.05510.03320.02060.0620.04650.24640.26863.21380.85353.22080.1830.22550.11430.09710.00980.03870.08280.06280.080.21981.16742.53492.65482.98262.09722.29230.63440.46570.24460.26530.18520.18540.21180.75440.27480.5230.3333000000000000
21
20Floatated - Jieux - FMN Binding Site - RotatedFMN Binding Site - Rotated4051237
GGAAGCUGUGAGAGAAGGGCAUACGUGGGAAAUAACCACGUAUGCAGGAUAUCUCACAGCAAAAAGCUCGUCUUCGGACGAGCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.059
medium
87.500.8330.4170.64111.31240.79862.379800.1398000.278900-0.2022000.27820.01920.20710.13790000.1377-0.20080000.137600.21082.47581.71271.10241.08782.02220.62840.1255-0.27190-0.1983000000.12530.252.12732.23462.68271.040.46030.03280.11470000.2291.0210.56441.16591.44921.67440.91070.91831.4140.52130.7250.4229-0.09190.11340.4090.76171.94590.89290.63870.4404000000000000
22
21Gloatated - Jieux - FMN Binding Site - RotatedFMN Binding Site - Rotated4051244
GGAACGACACUCAGAAGGCGUAUGCACCGAAAUAAGGUGCAUACGAGGAUAUGAGUGUCGAAUAAGCUCGUGUUCGCACGAGCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.267
medium
90.30.1061.1710.6390.20280.94461.37260.63780.27650.1381000.13790.27510.13740.137200.08040.7570.27080.27010.13490000000.13470.13460.13440.13430.87113.72783.60772.59762.06622.78162.07920.22660.2262-0.3821000.113000.11290.22530.22480.11230.33591.65450.32990.329-0.0812-0.19040.1376-0.18970.02860.10890-0.08030.56772.862.29231.9371.87730.79250.77810.67670.57700.10120.38240.76163.22211.72221.34331.0644000000000000
23
22Bloatated - Jieux - FMN Binding Site - RotatedFMN Binding Site - Rotated4051246
GGAACCAGAGGGAGAAGGGCGUACCAGCGAAAUAAGCUGGUAUGCAGGAUAUCUCUCUGGAAUAAGGUCGUGUUCGCACGACCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.874
medium
93.10.1171.3360.7261.58873.1131.45350.67220.1119-0.12430-0.02470.099-0.0619-0.06190.5546-0.1236-0.02530.44110.15970.48380.271900.10870000-0.12262.21340.21101.62432.83082.47173.14222.74751.80722.24910.14850.08970.26840.147200.26710.177800.2660.17710.61642.49661.5853.48220.732-0.03870.042500.162100.16180000.60361.46942.24612.28242.11730.91490.39550.65790.21890.5084-0.11270.36081.4953.39050.76261.55341.348000000000000
24
23FMN BINDING SITE ROTATEDFMN Binding Site - Rotated4052041
GGAAUAUAUAUUAGAAGGUUAAUAUUAUAAUAAUAAUAAUAUUAAAGGAUAUAAUAUAUAAUAAAAGAUAUAUUCGUAUAUCUAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
0.387weak76.400.8510.4260.04883.81970.758800.37810-0.3328-0.3318000-1.95620.37680.37560.3743-0.08970.555900000.73630.36690-0.64460-0.27510.364500.363400.36222.1317-0.28311.39890.34860.347600.34650-0.633600.34540.34440.68450.38740.67421.33232.28390-0.30120000.646900.64320.32070.95382.18212.14041.8051.15331.1291.66770.28480.56660.84360.28050.835200.5540.82491.08921.34512.627000000000000
25
24FMNB - 1FMN Binding Site - Rotated4053033
GGACGAAUUAACAGAAGGCAUAUAUAUGGCUAAAACAUAUAUAUGAGGAUAUGUUAAUUCAAAACCUAAUUCUUCGGAAUUAGAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.205
medium
84.70.0510.5610.3060.03560.84930.70930.35510.35340.38250.0660.12710.1269-0.0307-0.04710.01640.06340.06330.12650.06320.22080.09450.03190000.12580000.12560.25070.56130.77241.13030.60870.48490.42260.3611-0.06710.1801-0.09360.06-0.03360.119800.0599-0.0934-0.09340.11960.50150.65051.53840.40640.08080.1736-0.0703-0.03510.17310.13750.45880.05730.11450.53361.07152.04831.8121.37070.09520.16080.10710.21370.37280.33190.1060.15881.07450.44380.28640.4409000000000000
26
25JR_FMNBinding_Sub3FMN Binding Site - Rotated4053608
GGAACACGCAUCAGAAGGAUAGCGAUUCCAGAUCAGAAUCGCUAUAGGAUAUGAUGCGUGAAGAACACUGUCUUCGGACAGUGAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
2.308
medium
1000.0771.0380.5580.37811.64911.08690.5409-0.01770-0.2226-0.05170.0166-0.08570.05070.1265-0.08560.25970.49770.3270.45950.19790.01310.0494-0.1756-0.08520.049200.09840.09830.14720.34252.99962.26393.6933.25341.4840.9260.80410.06340.081-0.04910.1265-0.09120.10170.0841-0.06660.1260.28930.3092.70770.60742.86250.28720.45360.2009-0.04860.07790.40480.1159-0.24030.15410.0770.36691.69621.20452.23171.78071.74470.35970.27920.10460.38220.17770.07360.31471.24830.7310.55820.9516000000000000
27
26fbsrFMN Binding Site - Rotated4057610
GGACGGAGCUCCAGAAGGGCAGAGGACCGAGAAGAGGUCCUCUGCAGGAUAUGGAGCUCCACAAAGCCUGGGUUCGCCCAGGCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
0.681weak91.700.7460.3730.88112.53951.71320.21370.2133000-0.28700-0.0733000.4242-0.92180.13920.4203000-0.28190-0.2812-0.55970.1396000.41712.64712.50151.28861.54471.14660.94740.1892-0.27710.18880.18850000-0.08820.187902.92770.54633.69750.250.07440.34830.17390.1736000.17330001.36980.30231.50870.83190.38860.16520.32930.49180.32690.32600.64822.3790.31630.62911.2441000000000000
28
27fbsr-2FMN Binding Site - Rotated4057612
GGACGGAGCUCCAGAAGGGCAGAGGUCCGAGAAGAGGACCUCUGCAGGAUAUGGAGCUCCACAAAGCCUCGGUUCGCCGAGGCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
0.79weak90.300.7470.3731.23820.70250.70930.20460.2043000000000.20390.2035-0.636400.405600000000.202400.19170.99952.73021.7281.70180.35312.21290.550500.365800.182600.18230000.1820.54341.43050.3232.56620.51820.515800.68360.1706000.34020000.46621.08841.40540.65750.97761.44740.48040.63690.159-0.20970.31710.47361.24890.31140.61932.275000000000000
29
28fbsr-3FMN Binding Site - Rotated4057614
GGACGGACCUCCAGAAGGGCAGAGGUCCGAGAAGAGGACCUCUGCAGGAUAUGGAGGUCCACAAAGGCUCGGUUCGCCGAGCCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
0.923weak94.40.0911.0020.5471.18942.88111.029700.07190.102600.20480.204400.20410.203700.60771.003800.20040.20.1997000.19930.19900000.35811.05083.40022.94292.25291.27760.41650.87510.174700.174500.3479000-0.05860.17340.51782.03341.00753.18690.18580.48350.09110-0.069400.3200.1598-0.22940.15950.79211.25311.84651.44170.2250.45160.15030.29980.1497-0.07850.44680.3651.60610.57031.64272.9214000000000000
30
29FMN AverageFMN Binding Site - Rotated4071634
GGAAGCUUGAGCAGAAGGAUUCUCAUUCGAAAUAAGAAUGAGAAUAGGAUAUGCUCAAGCAAGAAGCCCAACUUCGGUUGGGCAAAAGAAACAACAACAACAAC
....(((((((((.....((((((((((.......))))))))))......))))))))).....(((((((....))))))).....................
1.418
medium
88.90.0741.0580.5660.75951.82661.16890.62750.1254-0.14110-0.140900.0470.0625-0.01560.06240.1870.37280.15270.61550.18430.1228-0.140100000-0.279400.12262.28222.41743.0781.7372.1951.90831.87170.10570.17770.3153000.105-0.0334-0.27600.10480.07143.74150.50332.57010.19590.39040.19480.097300.09730.04861.4957-0.1780.2860.09531.50381.57531.82310.81441.07551.15311.26470.34930.26130.34740.25990.43150.51540.59811.09991.2549000000000000
31
30JR_ShapeCUPilot2B_Sub1SHAPE Profile - C-U Mismatch - Pilot Run 2B4007341
GGAACCCAUAGGAAACGAUACCCGAAAGUGUAUCGAAAGCAUAUCACCCUAUGCGGAAAACUCAUAGUGGAUAUUCAAACCUAUGUGAAAAGAGAAUCUUCGGAUUCUCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.763weak79.60.1151.270.6931.02750.2891.38810.9178000.4570.45520-0.39490-0.39352.23040.88511.31210000000.21830.258901.2870.42731.68370.41930.41780.416200.8263000.41161.62262.38212.33251.34430.9521.5028-0.01631.1122-0.2135-0.1943.229500000.53570.17830-0.7707002.09912.39652.99871.64150.32730.65090-0.384000.32451.283100.63791.26140.31451.16780.92262.99320.59551.46911.451.148100.28630.852400.56540.7380.55691.64623.1983
32
31Catching JeeSHAPE Profile - C-U Mismatch - Pilot Run 2B4007395
GGAACCUAGCACAAAGUACAGCCGAAAGUCUGUACAAAGCUUGUGACCUACUGCGGAAAACUCAGUAUGCACAAUCAAAGUGCUAUGAAAAGUUCGUCUUCGGACGAACAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.716weak92.90.1351.4870.811-3.58671.29521.1931.180401.1681-1.105500.0310.578001.70763.84732.156100000-1.08930.53640.53392.09551.03811.53572.010801.4881000-0.542001.46852.711.86040.46320.9187000.457500.45562.232700000000.8860.44132.16360.85882.51844.43411.97990.78640.3918000.390400.38910.3877000.38640.38510.23060.2281.4991.11312.18272.1411.06030.352300.351200.16890.51070.68741.50051.9888
33
32XezabidiedSHAPE Profile - C-U Mismatch - Pilot Run 2B4010673
GGAACCAGGAGAAAAGUACGGCCGAAAGUCCGUACAAAGCAUGCUACCGUCGACGGAAAACUUCGACUGAGCAUUCAAAUCUCCUUGAAAAGUAGUGCUUCGGCACUACAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
1.182
medium
90.80.1892.121.155-0.27843.5420.26940.9940.49481.465-0.365600-0.726400.96821.54151.87172.73880-0.36090-0.3597000.90550.89831.33142.24230.43180.43010.42851.6881000.4204000.26972.25323.18411.95531.54271.1452000004.04710.366700000001.44791.7812.77881.01614.60560.97830.61471.2783000000.31870.3178000.31690.63020.93732.7431.14942.92822.85353.05320.27690.27620.54970.27421.0861.07560.26820.70734.0585
34
33C-U Mismatch funSHAPE Profile - C-U Mismatch - Pilot Run 2B4018977
GGAACCGCAUACAAAGGAUGGCCGAAAGUCCAUCCAAAGCGAUGCACCGAUAGCGGAAAACUCUAUCUGGCAUCUCAAAGUAUGUUGAAAAGCAUAGCUUCGGCUAUGCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.694weak86.70.1411.550.8451.93521.67710.73182.15320.71320.70871.399600.695402.04810.81872.63441.94151.279600000000.636101.2581.2441.835401.2104000000.60192.93081.16023.64760.27991.10841.63830.5435000.27113.92350.52070.5183000-0.527800-1.04580.51592.52131.49262.43361.44140.4784000000.47640000000.42424.53210.45141.77691.74910.43560.43391.7090.42560.4240.42240.83852.05770.2992.3987
35
34Starry - CU MismatchSHAPE Profile - C-U Mismatch - Pilot Run 2B4019691
GGAACCGAUUGCAAAGAUAGCCCGAAAGUGCUAUCAAAGCGAUGCACCGAUCUCGGAAAACUAGAUCUGGCAUCUCAAAGCAAUCUGAAAAGACACUCUUCGGAGUGUCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.975weak85.70.1311.4410.7862.52490.09621.96872.2663-0.34351.49080.37150.18540.211100.36780.36660.54723.01711.05480000-0.3414000.87220.18681.36780.67972.32950.4970.48390.32790000.32701.13281.41492.79560.55831.515200.3022000.75053.3490.290500.28970.57640.287500.85580.28460.5131.06111.91871.62082.89450.89430.5166-0.14450.25650.25590000.2553-0.0736000001.18051.97512.41551.66571.1773-0.09150.234500.2340.4660.23250.92242.81242.1973
36
35Miss C.U. Match (CU Mismatch 2B - one AU)SHAPE Profile - C-U Mismatch - Pilot Run 2B4027261
GGAACCUCUACGAAAGUAAUGCCGAAAGUCAUUACAAAGCGAUGGACCUAACGCGGAAAACUCGUUAUGCCAUCUCAAACGUAGAUGAAAAGAGCUACUUCGGUAGCUCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.82weak87.801.6710.836-0.22041.02510.31390.93380.61910.6157000-0.528201.2180.75123.48342.2750.56590000.5630.56020.55740.55471.09840.54651.34981.3338-0.52082.60540-0.518400.51870-0.5162.03692.48951.4740.73220.243500000.72597.0293-0.06190-0.06140.8925000000.88551.31260.43585.39281.23080000001.2174-0.10460.802900000.43.8620.26051.00912.94721.09440000-0.99972.84420.354401.7444
37
36Miss C.U. Match 2 (CU Mismatch 2B - one AU)SHAPE Profile - C-U Mismatch - Pilot Run 2B4027285
GGAACCAGUACGAAAGUAAUGCCGAAAGUCAUUACAAAGCGAUGGACCUAAGCCGGAAAACUGCUUAUGCCAUCUCAAACGUACUUGAAAAGAGCAUCUUCGGAUGCUCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.891weak83.70.1071.1740.642.98392.51071.86880.47810.37011.293800.72340.36050.359400.09561.84681.73011.36720.679400.3387000.337700.50420.16781.32670.33070.98330.06550.649800.16220.16200.16180.48323.1310.93151.8325-0.10821.0574-0.260100000.7691-0.129800000.29890.2981-0.21940.59150.03721.45561.71982.80941.64810.54670.272700.015400.13580.9428-0.256000.013300.26810.26753.121.28372.26120.49440.989400.24680.23780.73230.24360.95171.1922.53692.0253
38
37Miss C.U. Match 3 (CU Mismatch 2B - one AU)SHAPE Profile - C-U Mismatch - Pilot Run 2B4027303
GGAACCGAUACGAAAGUACUACCGAAAGUUAGUACAAAGCGAUGGACCUAAGCCGGAAAACUGCUUAUGCCAUCUCAAACGUAUCUGAAAAGUGCAUCUUCGGAUGCACAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
1.135
medium
85.70.1561.7190.9381.63810.68630.89881.769300.65960.21940.2190.65310.4337-0.26851.70852.9122.83821.2033-0.26790000.39970.1310.79080.12742.31531.14581.13421.69261.10071.090.3622000.36100.09514.65551.6012.97091.3630.96750.32160000.63942.805400000000.31081.22970.91471.50412.35592.02411.14480.3066000.566600.28260.01960.56090.27980.279100.2784002.71612.2622.47232.54321.752400.24980.74440.24760.2470.73621.43022.67033.1713
39
38CU Mismatch PR2B 2SHAPE Profile - C-U Mismatch - Pilot Run 2B4027724
GGAACCUAUAUCAAAUAUAUGCCGAAAGUCAUAUAAAAGCUAUACACCGAUUUCGGAAAACUAAAUCUGGUAUGUCAAAGAUAUGUGAAAAGAAUCUCUUCGGAGAUUCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.385weak64.301.3850.6922.7757-2.57831.33753.87360.004-1.2461000000.01572.441603.546300000001.1697001.157601.14581.134200001.12284.31781.06913.11813.0335001.0021-0.2257000.49441.463900.967500.959201.8860.935101.83950.91232.67140.88344.24951.67441.64971.6257002.38650.78990.78440.7789001.53641.51560.752700.74772.19900.72822.8391.05461.73040.68790.683700.80851.97861.38451.274
40
39spc/umpr2b-2SHAPE Profile - C-U Mismatch - Pilot Run 2B4048646
GGAACCGGUAGCAAAGAGAGCCCGAAAGUGCUCUCAAAGCGGUCCACCGGACCCGGAAAACUGGUCCUGGGACCUCAAAGCUACCUGAAAAGGCUCUGUUCGCAGAGCCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.504weak75.501.1970.5980.34840.0172.80262.73410000.9041.14970.8826001.73781.71121.68540.8364000000.83020.824100.81810.812100.8063001.589700003.09153.735400.742100000.36981.81911.43660.71370000001.40950002.74973.97791.328201.287800000-0.62250000001.89893.07781.21771.79731.76880-0.61911.16690.5804-0.64720.57451.69732.15010.5491
41
40CU-MM2B-02SHAPE Profile - C-U Mismatch - Pilot Run 2B4049168
GGAACCCAUAGCAAAGAUAUGCCGAAAGUCAUAUCAAAGCGCGGGACCUUACGCGGAAAACUCGUAAUGCCUGCUCAAAGCUAUGUGAAAAGCCGAUCUUCGGAUCGGCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.468weak80.601.3450.673-0.40811.08710.54090.53831.066400-0.94891.05630005.04362.94653.79540-0.94090000001.8662.73073.52630.874700.8679000.43230.430600.854603.31720.701300000.8113002.382000.788400000.7829001.54422.26930.75130.74630000.74140.73650001.453900000.72222.81630.69972.06032.02311.33270000.66240.65850.37633.16223.07530.6117
42
41C-U Later B - Jieux - SHAPE Profile - C-U Mismatch - Pilot Run 2BSHAPE Profile - C-U Mismatch - Pilot Run 2B4051391
GGAACCCUUAGCAAAGGAUAGCCGAAAGUCUAUCCAAAGCCUAUGACCGAUAGCGGAAAACUCUAUCUGCAUAGUCAAAGCUAAGUGAAAACCCACUCUUCGGAGUGGGAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.473weak85.701.7330.8661.46950.94311.40711.38971.3726000000-0.94551.3563.92532.55710000001.26412.47233.58952.34291.159302.27162.2264000-0.9375001.10222.16182.12091.0505000001.04075.91420000000.9771001.92071.88824.52953.510.87070.86390.85730.8508000000000.844401.6637002.4412.38893.84470-1.3889-0.4610-0.15090.59970.74843.62081.7816
43
42MishSHAPE Profile - C-U Mismatch - Pilot Run 2B4066889
GGAACCCUGCCCAAAGGUGGUCCGAAAGUACCACCAAAGCAGAGGACCUAGCACGGAAAACUUGCUAUGCUUCUUCAAAGGGCAGUGAAAACCUGCUCUUCGGAGCAGGAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.549weak75.501.1440.5720.93890.17511.4930.74150.15820.7318000000.72712.13952.09940.8068000000.6869002.023500.67041.975802.573800000000.63981.8871.85571.22361.21040.90051.480900.58920.58621.160200000000.57711.14242.78491.64644.22451.562100.51830.51590.5135-0.57250.51121.01310.504300.99950001.47950.4911.69251.667300.474300-0.56960.4723-0.56670.37291.38771.82021.7911
44
43C-U 2BSHAPE Profile - C-U Mismatch - Pilot Run 2B4072369
GGAACCGCUAGCAAAGCUACGCCGAAAGUCGUAGCAAAGCGAUCGACCGUAGCCGGAAAACUGCUACUGCGAUCUCAAAGCUAGCUGAAAAGCUAAUGUUCGCAUUAGCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
1.286
medium
88.80.1241.3650.744-0.26741.75651.46681.31770.78510.54080.25930.258700.89810.12820.25571.3891.98452.545400000000.24190.7212.35290.70141.83970.45810.2286000.22810.45430.22670.22621.45152.0822.56951.06050.632700.210500-0.23834.78830.20070.598800.3978000-0.0388-0.03861.17672.67981.8821.79630.91630.36530.36410.1818-0.05430.1812000.18090-0.235300.54010.35890.53581.93052.00111.35931.27421.81390.49250.16390.4896-0.07090.16270.48611.12294.46620.9165
45
44CU again straight upSHAPE Profile - C-U Mismatch - Pilot Run 2B4109024
GGAACCGAUAGCAAAGCAUACCCGAAAGUGUAUGCAAAGCGUACGACCGUAUCCGGAAAACUGAUACUGCGUACUCAAAGCUAUCUGAAAAGCUUUGCUUCGGCAAAGCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.776weak83.701.5590.780.2876-0.94492.51754.818300.797300.79171.56130001.15883.37174.32200.715700000.711200.70671.39572.05522.01811.329400000000.66083.20921.89290.62741.24100.61710004.158901.7544000000.581801.71854.40242.68543.13231.03452.0314000.50550.5033000.997600.4966000.494400.49220.01961.92643.27271.839400000.9122-0.01430.90125.09960.4265
46
45Fiskers CU mismatch D2SHAPE Profile - C-U Mismatch - Pilot Run 2B4118382
GGAACCGUUACCAAAGACUAGCCGAAAGUCUAGUCAAAGCCAUAGACCGUUACCGGAAAACUGUAACUGCUAUGUCAAAGGUAACUGAAAACGAAUGGUUCGCCGUUCGAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
1.641
medium
87.80.1181.3030.711-1.3610.33941.08611.6757-0.15280.75310.1507-0.15210.37550.22480.14970.14950.44671.75080.9910.1443-0.151-0.15080000.28780.28711.83550.75961.72361.41311.14380.1344-0.150200.53510.26690.53120.72572.13562.40631.27450.42270.248200.3711000.24693.70.32580.1187000.23690.118300.23620.23570.93491.49892.66063.69542.35470.31740.10570.52610.210.20960.10470.20910.72690.31070.30980.30900.71630.15730.96270.70281.68122.13411.57080.32730.0950.37880.28340.5093-0.14791.65413.03931.111
47
46Fiskers CU mismatch D3SHAPE Profile - C-U Mismatch - Pilot Run 2B4118386
GGAACCGUCGACAAAGACUAGCCGAAAGUCUAGUCAAAGCCAUAGACCGUAUCCGGAAAACUGAUACUGCUAUGUCAAAGUCGACUGAAAACGUUUGGUUCGCCGAACGAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
2.043
medium
88.80.1171.2860.702-0.05151.4471.43862.1030.13820.70120.06120.122200.0137-0.10830.72771.14052.24251.00470.34770.115800.1156-0.10790.23080.23030.62991.5251.45171.32091.19791.5570.48110.10680.10670-0.10770.2131.10732.22232.1791.69680.83270.19760-0.1160.197100.19673.8927-0.01240.37820.47070.1880.09390.18750.18720.37310.46450.87392.05621.7742.64141.74770.17020.25480.16960.25380.040-0.10650.31410.33540.08380.08370.16720.66480.57870.82060.81471.57871.97062.46680.14260.229800.22940.07640.07640.90882.73362.1023
48
47SP C-U 2B V2SHAPE Profile - C-U Mismatch - Pilot Run 2B4143809
GGAACCCACUGCAAAGGACCUCCGAAAGUAGGUCCAAAGCGAGAUACCGAUCACGGAAAACUUGAUCUGAUCUCUCAAAGCAGUGUGAAAACUAGUACUUCGGUGCUAGAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
1.116
medium
88.80.1151.2610.688-1.26050.84781.88110.27410.26550.26490000.26430.263601.5542.28651.2429000000.25011.72360.83691.32511.42710.94340.93550.92781.14780.457200000.22820.68031.89491.64740.87170.0875-0.2594-0.12960.21710.43250.43083.34370.6235-0.25850.20740.207000.20670.411802.02192.11683.07922.37361.22670.73680.7320.5463-0.2561-0.32810.1815-0.07320.18090.54020.53760.357200.17830.17810.88331.91162.12431.83873.08820.32410.230900.161100.95850.95041.2531.0938
49
48
C-Usp of RNA greatness - Brourd - Lab SHAPE Profile - C/U mimatch 2B R1 - Sub 2 (Design 2)
SHAPE Profile - C-U Mismatch - Pilot Run 2B4147127
GGAACCCAGUAGAAACAGUGUCCGAAAGUACACUGAAAGCGUAUGACCUGAUCCGGAAAACUGAUCAUGCAUACUCAAACUACUGUGAAAAUAGAUCCUUCGGGAUCUAAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
0.69weak89.80.1411.5530.8471.7702-0.89422.1241-0.4920.70360.6992000.6948-0.97550.204903.34942.133300000000.65041.91781.26412.47230.74120.608-0.47941.202901.19010002.33072.28311.68661.18420.55111.0915-0.47530.54310.5405005.15560.51320000.510900.50850.50621.49841.96282.40081.88823.65323.96420.43870.4370.86730.43200000.430300.4287000.4271.26663.67492.0050.3230.39670.395300.78510.39120.7770.38710.38580.76632.5122
50
49Mat - Mod of HyphemaSHAPE Profile - C-U Mismatch - Pilot Run 2B4149332
GGAACCAGUACGAAAGUAAUGCCGAAAGUCAUUACAAAGCGAUGGACCUAAGCCGGAAAACUGCUUAUGCCAUCUCAAACGUACUUGAAAAGAUGAUCUUCGGGUCGUCAAAAGAAACAACAACAACAAC
....((((((((...((((((.(....).))))))...(((((((.(((((((.(.....).))))))))))))))...))))))))....(((((((....))))))).....................
2.423
medium
89.80.1261.3890.7581.29021.72092.00011.2340.71520.55190.20270.05060.1733-0.057400.44442.2152.1722.08420.09470.01550.3770.094200.28180.28110.60581.6982.00240.80431.32460.66670.401600.08730.04360.05190.08710.18991.2872.92722.21310.73070.88610.08050.24260.08020.08010.12322.53930.07750.077900.155600.23290.07690.53880.45911.58171.41721.82843.85810.8780.27230.3490.19250.2776-0.07770.13860.13850.2675-0.034200.06020.13740.06860.41032.34352.1411.61592.07820.63040.17440.14260.4377-0.01450.0791.06481.11322.3051.925
51
50JR_ShapeUAVar1.1_Sub1SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14007295
GGACGAUGUACGAUGUAUGUAGUAGCUAUGUACGUUGCAUGUAGGAAACUAUAUGCACGUAUAUAGCACUAUAUACACGUAUAUCGAAAAGUCUAAGUUCGCUUAGACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.335weak77.300.340.170.856-1.0150.60220-0.3535000.200400001.189400.099-0.2535000000.19750.19720.5884000.1958000-0.15590002.29740.19110.19080000000.190500.7810.562800000-0.161900.187000000.186700.1863000000.1860.1857000000000000.5544-0.66930.3672-0.34480.91050.55941.2503
52
51IcelandSHAPE Profile - Most Likely Base Pair U/A - Variation 1.14007355
GGAGUACAGGUGAUGACGGCAGUAGUGCGUGUAGUUGCAGUGGCAAAAGCCACUGCACUACACGCACACUGCCGUCACACCUGUACAAAAGUCUGGCUUCGGCCAGACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.075weak82.501.7150.858-6.9009000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
53
52EsabeinreSHAPE Profile - Most Likely Base Pair U/A - Variation 1.14011456
GGAGGACGGGUGAUGGAAUGGGUAGGUGAUAGGGUUGAAGGGAGAGUACUCCCUUCACCCUAUCACCACCCAUUCCACACCCGUCCAAAAGGGUCGCUUCGGCGACCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.009weak81.400.7070.3535.1564000004.9293000000000000000000000000000000000000000000000000000000000000000000000000000000000
54
53OnmamavediSHAPE Profile - Most Likely Base Pair U/A - Variation 1.14011934
GGAGGAGCGGAGAUGGGAGGAGUAGAGGUGGUAGUUGUGGGUCGAGCCCGACCCACACUACCACCUCACUCCUCCCACUCCGCUCCAAAAGGGUGCGUUCGCGCACCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.077weak84.500.9130.457-6.3721000000000004.7074000000002.305200000000000000000000000000000000000000000000000000000000000000002.25870
55
54EsorceusSHAPE Profile - Most Likely Base Pair U/A - Variation 1.14012624
GGAGACGGGAGGAUGAUGGGUGUAGGGAGGGAGGUUGGUGUAGGGCAACCUACACCACCUCCCUCCCACACCCAUCACCUCCCGUCAAAAGCGUACCUUCGGGUACGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0weak80.408.2424.1210000000000111.8523000000000000000000000000000000000000000000000000000000000000000055.9377000000000037.294427.9718
56
55Likely U/A V1.1 2SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14027617
GGAGAUAUAUAGAUGUAUAUAGUAGUAUAUAUUGUUGUAUAUAUGAAAAUAUAUACACAAUAUAUACACUAUAUACACUAUAUAUCAAAAGUGGGAUUUCGAUCUCGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.776weak81.400.5060.2530.70031.25181.95290.0070.48330.160900.480600.1600.47781.87920-0.23520.156400.23410.0780001.23381.22030.304300-0.23470000002.23630.297400.14850000.296200.44250.44080.71270.50760.14480.43280.5742000000.1434000000.143200-0.23380.143-0.46560.1428000.14260000-0.23230.142400000.284200.14190.42410.70241.45582.5075
57
56Adoration of Magi (Most Likely Base Pair U/A 1.1)SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14032767
GGACGUAAUGUGAUGUAGUAUGUAGUCUAUUCAGUUGGAUGGUCGAUAGACUAUCCACUGGAUAGACACAUGCUACACACAUUACGAAAAGUACAUCUUCGGAUGUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.459weak81.400.620.312.09390.4883000.344700.343600000.6830.34050.339500000.338400.33740-0.04244.0467000.16160.482800.321000.320.63640.946600000000003.36631.50950.301100000000000.300300000.14990.14970000000000.298700.297900000.2971-0.7856000.29551.45843.9396
58
57Adoration of Magi 2 (Most Likely Base Pair U/A 1.1)SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14032777
GGACGUAGUACGAUGUACUAUGUAGUCUAUUCAGUUGCAUGGUCGAUAGACUAUGCACUGGAUAGACACAUGGUACACGUAUUACGAAAAGUACUACUUCGGUAGUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.462weak80.400.9310.466-0.86511.8132.942200000-0.8585000.58542.85220.567500.56470000000.28164.07080000000000.54010.80440.798700000000.52991.56751.54583.49431.477800000000000000.490400000.488300.4862000-0.8520000000.48410000.11430.47790.94760.93972.7974
59
58BackbendSHAPE Profile - Most Likely Base Pair U/A - Variation 1.14042178
GGAGCUAUCAAGAUGAAGCUAGUAGCAACGUAAGUUGCUCAAGCGAAAGCUUGAGCACUUACGUUGCACUAGCUUCACUUGAUAGCAAAAGCUUAGCUUCGGCUAAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.222weak78.403.4871.74429.75880000000009.1119021.968800000000000000000000000000000000000000000000000006.87316.47540000000000000000006.12125.8037015.066809.2171
60
59
A nucleotide to die for - Brourd - Lab SHAPE Profile - MLBP U/A 1.1 R1 - Sub 1 (Sequence 1)
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14053136
GGAAAGCACAUGAUGUAGUCUGUAGAUCUAUCAGUUGUACCAUCGAAAGAUUGUACACUGAUUGAUCACAGUCUACACAUGUGCUUAAAACUCAGUCUUCGGACUGAGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.064weak80.400.6070.3032.92460001.44350000000-1.85440000.7080.70360001.389702.71201.33980001.323901.95120.64671.27851.2641000001.2500001.23621.22260000000000000000000000000000000001.20940-3.1861001.19651.18382.3186
61
60JR_ShapeUAVar1.1SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14053539
GGACGUUAAAAGAUGUUUAUUGUAGUUUUAUUUGUUGUUUAUUGGAAACAAUAAACACAAAUAAAACACAAUAAACACUUUUAACGAAAACGUGUACUUCGGUGCACGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.26weak78.400.5440.2720.2779-0.11070000000.5398000.53724.634700.51260000.510300001.510100000000.5011000.99340.49450000000001.46400.9676000.481700000.95520.4756000.4736000.471600000000.469600000000.46760000000.92750.91990
62
61spmlbpu/av1.1SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14054568
GGAGCUGAUAGGAUGGACUAGGUAGGAGGCUGGGUUGCAGGAGGGAUACCUCCUGCACCCAGCCUCCACCUAGUCCACCUAUCAGCAAAAGUAGAACUUCGGUUCUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0weak86.609.2734.6370-12.05730000000000111.852300000000000000000000000000000000055.9377000037.2944000027.9718000000000000000000000000000037.29715.984672.7326
63
62spmlbpu/av1/1-2SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14054570
GGAGCUGAUAGGAUGGUCUAGGUAGGAGGCUGGGUUGCAGGAGGGAUACCUCCUGCACCCAGCCUCCACCUAGACCACCUAUCAGCAAAACAUCUUCUUCGGAAGAUGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.071weak84.501.9550.9770000000000000006.3721000000000000000000000000000000011.44120000000000000005.4424000000005.18990000004.959900000-7.30819.589610.6365
64
63spmlbpu/av1/1-3SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14054575
GGAGCAGAUAGGAUGGUCUAGGUAGGAGGCAGGGUUGCAGGAGGGAUACCUCCUGCACCCUGCCUCCACCUAGACCACCUAUCUGCAAAACAUCUUCUUCGGAGGAUGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.231weak76.301.5370.7693.2795000000003.18613.097900000000003.01440000000000002.93540000000000002.86030002.7890000005.313202.5952.536200000000002.4800000000002.42622.37472.32546.56672.1469
65
64Free EnergySHAPE Profile - Most Likely Base Pair U/A - Variation 1.14062159
GGAGGCGGCCCGAUGGGCCGGGUAGGCGGCCGGGUUGCCCGGCCGAAAGGCCGGGCACCCGGCCGCCACCCGGCCCACGGGCCGCCGAAACCCGGCCUUCGGGCCGGGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0weak85.603.0441.5220000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
66
65MLB 1.1 Humble PieSHAPE Profile - Most Likely Base Pair U/A - Variation 1.14066857
GGAGCACCUAGGAUGCUGUAGGUAGCUCAGGAGGUUGCAAUAUGGAAACAUGUUGCACCUUUUGAGCACCUAUAGCACCUGGGUGCAAAAGGCUUACUUCGGUAAGCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.336weak81.400.9490.474-0.76712.13691.18080.2944000000.58580.582702.83971.124500000000-1.14472.468100000000002.67671.06050000000.5278000.525300.52280.52040.51800000000000000.51560000000000000000000.5132001.51880.5042.705
67
66Likely 1SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14072350
GGAGCUAGUACGAUGUACUAUGUAGUCUAGUACGUUGCAUAUCGGAAACGAUAUGCACGUACUAGACACAUAGUACACGUACUAGCAAAAGCACUAGUUCGCUAGUGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.175weak77.300.8790.43903.73241.835601.805900001.77730001.7495000000000.8682.54460000000001.671100000000000001.646500003.1989000000000000001.5769001.55500000000000000001.5337
68
67Most Likely Base Pair U/A - Variation 1.1 - v2SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14112839
GGAGUCUCUCUGAUGAUCCAUGUAGAUCUACAUGUUGUAGGUACGAAAGUACCUACACAUGUAGAUCACAUGGAUCACAGAGAGACAAAACCUCGUCUUCGGACGAGGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.024weak84.503.1581.579111.85230000000000000000000000000000000037.289227.9689000000000000000000000000000000000000000000000000000037.2944
69
68Likely 2SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14130072
GGAGCAUGUAUGAUGUAUCUAGUAGCAUGCAUGGUUGCAUAUGGGAAACCAUAUGCACCAUGCAUGCACUAGAUACACAUACAUGCAAAAGGUUUCCUUCGGGAAACCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.038weak85.601.0450.5230-12.057300000000003.279500000000003.186100000000003.0979000000000003.01442.93540000000000000002.8603000000000000000000000000
70
69SP U/A V1.1 V1SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14138868
GGAGGAUCGUCGAUGACGUCAGUAGCUAGUCAUGUUGGUCGACCGAAAGGUCGACCACAUGACUAGCACUGACGUCACGACGAUCCAAAAGGUGUACUUCGGUACGCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.098weak79.402.9031.452000000000012.057300000000000019.839200000000000000000000000000000000009.11190000000008.4258000000000000007.83570000
71
70SP U/A V1.1 V3SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14138884
GGAGGAUCGUCGAUGGAGUCAGUAGACAGUCACGUUGAGUGACCGAAAGGUCACGCACGUGACUGUCACUGACUCCACGACGAUCCAAAAGCUGUACUUCGGUGCGGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.14weak78.400.5420.271-1.664101.115001.1040000001.0932000000001.082600000001.072200000000000001.06200001.052100000001.0423000-1.6397000000000001.032600001.0232001.013901.9918001.95692.86031.4121
72
71Fiskers variation D2SHAPE Profile - Most Likely Base Pair U/A - Variation 1.14147169
GGAGCGAUCUAGAUGUGGCUAGUAGUCGAAUCUGUUGACGUGACGAAAGUCAUGUCACAGGUUCGACACUAGUCACACUAGAUCGCAAAAGUGUUCGUUCGCGAACACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.098weak83.501.5160.7580-1.11413.49890000000006.5863.19890000000003.10990000000003.025900000000002.946200000000000000000000000000000000000000002.870612.72137.1454
73
72Mat - Mod of EliSHAPE Profile - Most Likely Base Pair U/A - Variation 1.14149292
GGAGCGAUCUAGAUGUGGCUAGUAGUCGAAUCUGUUGACGUGACGAAAGUCAUGUCACAGGUUCGACACUAGUCACACUAGAUCGCAAAAGUGUUCGUUCGCGGACACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.304weak78.400.9770.488-0.18520.82061.00230001.96931.93530-1.1894002.829500.935300000.92750003.5910000000000-0.28630.8836000000000.87670.869800.8631000000.856500000.850000000.84360000000000.8373-1.16460-1.1526000.83110.8250.818900.8132.38690.79
74
73Mat - Mod of TelsaSHAPE Profile - Most Likely Base Pair U/A - Variation 1.14149295
GGAGCACCUAGGAUGCUGUAGGUAGCUCAGGAGGUUGCAAUAUGGAAACAUGUUGCACCUUUUGAGCACCUAUAGCACCUGGGUGCAAAAGGCAGACUUCGGUUUGCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.745weak81.400.510.2550.89310.64232.3683000000.492300-0.26844.11010.15790.1576-0.2678000.1574000.15720.85792.0669000000.15290.1527000.07633.61750.8790.146300000.1461000.58140.28991.43120.42770.56740000.0158000000.28230.14100.14080-0.266500000000.28090000.14030.2798000.279100.13940.13920.42580.2761.50320.67341.0011
75
74Mat - Mod of HyphemaSHAPE Profile - Most Likely Base Pair U/A - Variation 1.14149298
GGACGUAGUACGAUGUACUAUGUAGUCUAUUCAGUUGCAUGGUCGAUAGACUAUGCACUGGAUAGACACAUGGUACACGUAUUACGAAAAGUGCGCCUUCGGGUGUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
1.066
medium
89.70.0410.4460.2431.34560.91120.4885-0.04910.07330-0.04910.21930.21880-0.1222-0.08561.91840.21440.071400.14260-0.12180.14250.071200.2842.02180.13930000.0696000001.17060.221600-0.12150.068600-0.12140.20540.51131.32720.89810.46380.06620.06620.066100.0661000.06610000000.06600.06600.20820.065700-0.120600.19690.13110.06550.196200.06540.06530.0751000.3251-0.055401.09391.08910.8266
76
75Could be wrongMost Likely Base Pair U/A - Variation 1.1B4007380
GGAAAGUCUAGUUGUGCUCAAAAGAGCACACUAGACAAGAAGUUCGACUUCGGUCGAACAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................0.808weak85.40.1511.6570.9042.22282.31592.02141.24921.7220.4899000.2444-0.39490.24392.68930.236600.23610.70400.93080.75942.69710.44772.23261.50960.8560.426400.42480.42320.21120.21080.2104000.02981.03830.61953.01581.9672.48812.23492.50511.25760.53640.88690.7051.22030.52060.82021.85690.33661.16582.2841000000000000000000000000000000000000
77
76BeveraisMost Likely Base Pair U/A - Variation 1.1B4021773
GGAAAGGAGGGUUGUAUGCAUGCGCAUACACCCUCCGAAAAGGAUGGCUUCGGCCAUCCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................0.725weak83.30.1691.8631.0161.76551.18160.99381.30960.32640.325500000.15981.90850000000.63265.5022.63092.29072.24481.111200.27710.55150.27510.54750.273100-0.48320003.44070.78844.53861.73761.95120.48570.9630.95481.16521.16371.57711.35423.70970.65082.33662.8969000000000000000000000000000000000000
78
77Likely U/A V1.1B 1Most Likely Base Pair U/A - Variation 1.1B4027632
GGAAAGAUAUGUUGGUAUAGAAAUAUAUCACGUAUCAAUAACGGCAAUUUCGAUUGCCGAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................2.883
medium
93.80.090.9950.5431.42871.63791.92271.50451.20590.22570.08140.19780.05410.10810.21582.88120.1834-0.00610.0590.07840.06540.23440.1750.21351.02670.54180.73560.37920.3121-0.04050.10060.05510.10990.02510.10020.1594-0.03590.17460.19920.22361.7442.25831.72132.12170.61810.45630.27310.04630.09110.11380.54040.69372.57540.61910.57981.4782000000000000000000000000000000000000
79
78Leonardo 2 (Most Likely Base Pair U/A 1.1B)Most Likely Base Pair U/A - Variation 1.1B4032794
GGAAAGCGUCGUUGUAGUCGUAAGACUACACGAUGCAACAAGCUACACUUCGGUGUAGCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.961
medium
93.80.0840.9290.5070.90261.53781.85440.98020.9340.0865-0.05210.18940.129100.0291.9210.71320.0838-0.069100.05660.0565-0.02710.41651.2890.86960.83330.21370.22150.2040.051700.120200.160.13980.19050.09070.01110.55411.46271.5391.09530.97951.66990.0430.29580.48370.08420.2930.07320.94752.11710.68961.22531.7542000000000000000000000000000000000000
80
79Leonardo 3 (Most Likely Base Pair U/A 1.1B)Most Likely Base Pair U/A - Variation 1.1B4032805
GGAAAGCGUAGUUGUAGUCGUAAGACUGCACUAUGCAACAAGCUAGUCUUCGGACUAGCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................2.685
medium
97.90.0750.8210.4480.69131.65962.03911.4272.27550.21360.04830.11880.14120.07050.21282.00180.45830.02270.15980.02290.09070.06810.11310.38411.36191.08310.52680.10820.04220.04390.0220.06580.04390.10960.08760.0290.18560.1506-0.00410.31271.84031.37921.03641.68691.37150.17180.17130.38150.18040.21470.13980.36271.01650.33380.31330.3256000000000000000000000000000000000000
81
80Starry U/A 1.1BMost Likely Base Pair U/A - Variation 1.1B4042210
GGAAAGCUUAGUUGUCGAGGAAACUCGACACUAAGCAAAAAGCUCAGCUUCGGCUGAGCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.114
medium
85.40.1081.3280.7180.50781.58871.74641.38752.02820.11260.11240.22440.1121-0.21860.22840.66850.66080.1100.1099-0.10760-0.15920.49070.54260.96830.74810.2133000.10660.10650.1064000.10630.10180.7368-0.11051.51131.70851.18541.57591.93581.43322.03430.8364-0.14590.64520.42990.96751.92382.77560.86073.09643.6433000000000000000000000000000000000000
82
81Ua Var 11B-03Most Likely Base Pair U/A - Variation 1.1B4049107
GGGAAGGCUUGUUGGCCGCGGAAGUGGUCACGAGUCGAAAGGGCCACCUUCGGGUGGCCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.233
medium
85.40.1031.1280.6151.25171.83272.39141.94030.92690.4191-0.0419000.22980.74192.57150.44370.11080.110700.110600.11050.11042.90271.17020.42390.31700.525900.10510.1050.10490-0.05180.15710.82980.20710.4642.0672.51881.0170.23390.23280.19380.67420.19230.95330.56910.37811.12291.11170.55312.10292.4045000000000000000000000000000000000000
83
82
Can Neighbours Change Our Relationship - Brourd - Lab Most Likely Base Pair U/A 1.1B R1 - Sub 2 (U/G)
Most Likely Base Pair U/A - Variation 1.1B4052914
GGAAAGUCGUGUUGUGAUCGAAAGAUCGCACGCGACAAAAAACUGGACUUCGGUCCAGUAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.896
medium
85.40.1091.2020.6561.36571.66152.49611.37991.60980.16630.33160.1104-0.04190.16530.46642.29260.1174-0.022800.0534-0.13070.07330.15880.32610.99310.53580.42140.36070.1030.1542000.05140.05140.2051-0.04420.20460.22370.80211.5743.55622.27531.62452.65812.0610.81990.77740.2940.32190.34740.33230.71871.57280.78581.1220.6502000000000000000000000000000000000000
84
83
Stuck in the middle with A - Brourd - Lab Most Likely Base Pair U/A 1.1B R1 - Sub 3 (U/A)
Most Likely Base Pair U/A - Variation 1.1B4052938
GGAAAGUCCUGUUGUCAUCGAAAGAUGACACAGGACAAAAAUCUGCACUUCGGUGCAGAAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................0.498weak83.30.1121.2270.6692.47132.31811.13690.5810.80750.53570.53320.266000.26531.82690.51960.259200000-0.24260.01590.76690.76171.4982-0.49450.24880.24830.49430.24660.24610.24550.24500.47910.96310.71772.30883.82952.63940.6011.92650.42650.36060.84021.040400.20770.06552.02080.80250.90731.9469000000000000000000000000000000000000
85
84JR_Shapeuavar1.1BMost Likely Base Pair U/A - Variation 1.1B4053554
GGAAAGCUUAGUUGUUGAGGAAACUCGACACUGAGCAAAAACGAGUACUUCGGUGCUCGAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................6.873good93.80.0750.8270.4511.30421.7711.83421.37141.23510.13050.10410.05820.18510.16670.18342.18930.98510.0830.01360.02580.08550.03890.13980.38871.24830.84610.53860.08770.05090.01260.07920.06060.07510.04520.00320.13640.09260.10090.19310.70331.72261.64111.6511.4690.66540.16510.19050.14820.19720.45490.14330.1371.23660.38830.58440.5806000000000000000000000000000000000000
86
85MLB 1.1 LeaperMost Likely Base Pair U/A - Variation 1.1B4066827
GGAAAGCUAGGUUGCAGUCGAAAGACUGCACCUAGCAAGAAGCCGUCCUUCGGGUCGGCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.326
medium
93.80.0921.0670.5791.6650.8691.92911.4110.77070.20980.06990.1396-0.078800.20891.70040.68060.20380.0552-0.0802-0.1718-0.07970.05530.80351.4540.39510.37750.32680.4556-0.01660.065000.1298000.32360.19380.38630.19281.62462.0492.78511.87532.32790.46380.5193-0.1461-0.03060.40211.86390.84090.68890.33281.65571.4685000000000000000000000000000000000000
87
86MLB 1.1 GriffleMost Likely Base Pair U/A - Variation 1.1B4066833
GGAAAGUCAGGUUGUAGUCUUCGGACUGCACCUGACAAGAAGACGUCCUUCGGGACGUCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.041
medium
87.50.1161.2740.6952.87411.92152.5391.32753.137900.14240.14230.142100.7062.07851.42550-0.07620.13620000.81130.19210.53630.26750.18810.53060.1325-0.21130.13230.13220.1320.26340.13160.13140.05130.19630.18071.23152.26181.35041.88111.55582.68640.52310.2321.03450.17780.47391.93291.53060.86782.59611.1083000000000000000000000000000000000000
88
87Likely 1.1BMost Likely Base Pair U/A - Variation 1.1B4072353
GGAAAGCUACGUUGCAUCGGAAACGAUGCACGUAGCAAGAAGCUACAGUUCGCUGUAGCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.149
medium
93.80.1081.1840.6461.74671.02750.54151.24881.702800.37710.19580.09390.18750.09371.97791.048500-0.08860-0.08840.09080.5421.06950.61850.43830.43850.26250.43580.1740.0870.1736-0.00440.08660.1730.60210.42850.25650.24841.51231.81842.31821.32692.79390.38670.76810.53510.15270.15250.45550.97842.06830.87951.58941.461000000000000000000000000000000000000
89
88Meechl MLBP UA 1.1BMost Likely Base Pair U/A - Variation 1.1B4075402
GGAAAGAUUAGUUGAUAACUAAUGUUAUCACUAAUCAAUAAGUGAUUCUUCGGAGUUACAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................6.424good97.90.1531.6820.9171.53362.1152.42561.56911.35740.24940.05540.08290.08830.08280.21471.80710.83840.2250.09630.10620.17610.08990.68236.64785.70223.54732.23340.4140.39840.04440.0531-0.0214-0.03-0.0040.09060.05950.10150.14960.22810.34081.62393.22722.26042.7592.15070.67830.45290.45310.57340.64150.29510.25010.81560.44070.66440.5845000000000000000000000000000000000000
90
89Most Likely Base Pair U/A - Variation 1.1B - v2Most Likely Base Pair U/A - Variation 1.1B4112869
GGAAAGACGUGUUGUCGACGAAAGUCGACACACGUCAAGAAGCACGUGUUCGCACGUGCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................0.318weak81.20.0931.5640.829-2.5951.14510.12010.55831.10550.550-0.504700001.084100.53940-1.04230002.11691.56541.0340.514600.5123000.5099000.50761.00610.50080.49860.49632.90094.18853.16551.78011.31930.87271.71860.85270.42481.67361.2413-0.21124.72071.16792.2881.5048000000000000000000000000000000000000
91
90MLBP U/A V1.1B V1Most Likely Base Pair U/A - Variation 1.1B4138901
GGAAAGGACUGUUGUCAUCGAAAGAUGACACAGUCCAAAAACUAUGUCUUCGGAUAUGGAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.923
medium
91.70.0810.8930.4870.49111.78311.64821.39610.86650.42280.17780.21230.0701-0.03320.10851.89030.68320.06840.17031.00E-040.1356-0.13530.06770.20261.00160.72920.69280.2160.1963-0.03620.06530.19560.03060.0306-0.002-0.1013-0.20210.1603-0.06851.17721.84862.51462.22841.9690.90690.34190.71540.41520.55510.33340.13340.26560.52690.24380.41070.391000000000000000000000000000000000000
92
91diceMost Likely Base Pair U/A - Variation 1.1B4145627
GGAAAGAUACGUUGCUAUGGAAACAUAGCACGUAUCAACAAGGAAGGCUUCGGCCUUCCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.086
medium
87.50.0870.9580.5231.46941.83842.73022.14231.5840.10550.42040.105000.15732.43530.23220.0280.1018000.10170.10160.02740.70530.80021.08960.19780.19740.0986000000.120.1195-0.07660.19570.06982.40131.66691.14291.38191.52350.09630.62230.61890.08830.440.61260.60932.71750.75910.33641.0826000000000000000000000000000000000000
93
92Fiskers variation D1Most Likely Base Pair U/A - Variation 1.1B4147205
GGAAAGCUACGUUGGUAUCGAAAGAUACCACGUAGCAAUAACACGAUGUUCGCAUCGUGAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................1.327
medium
89.60.11.1190.6091.56343.01021.88711.67910.78060.1732-0.06820.19050.0862-0.1543-0.0251.98730.83930.0973-0.15370.08370.13670.248800.08290.90430.7350.81070.40390.2498-0.14370.160500.24030.080.080.07990.07990.0798-0.07230.56131.49042.77212.48712.53951.2910.85410.2131-0.00910.14170.63410.4911.21422.37690.77561.59551.314000000000000000000000000000000000000
94
93Mat - Mod of EliMost Likely Base Pair U/A - Variation 1.1B4149306
GGAAAGCUACGUUGGUAUCGAAAGAUACCACGUAGCAAUAACACGUUGUUCGCAGCGUGAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................2.387
medium
95.80.0931.0230.5580.95051.31772.27371.05321.46440.18160.21750.08140.0362-0.02720.15331.88790.53660.09920.0423-0.07340.57660.03490.34830.41641.23530.68210.37860.27110.23670.00930.06750.06750.038200.0674-0.02470.3690.10050.20070.2081.25563.4491.75722.09320.70360.21210.18110.03040.21270.24250.18160.45222.90680.72921.18331.1932000000000000000000000000000000000000
95
94Mat - Mod of HyphemaMost Likely Base Pair U/A - Variation 1.1B4149314
GGAAAGCGUCGUUGUAGUCGUAAGACUACACGAUGCAACAAGGAACUGUUCGCGGUUUCAAAAGAAACAACAACAACAAC
.....((((((..((((((....)))))).)))))).....(((((((....))))))).....................3.536
medium
95.80.0720.7920.4320.83091.24482.30221.17011.2050.09290.031-0.02290.07330.04390.14781.81340.53050.04470.10040.04330.10150.10290.08690.27341.28080.89440.97480.09490.01350.1364-0.0278-0.08220.02690.05450.0408-1.00E-040.0950.08130.05390.22282.17862.03530.78341.69570.84790.15720.27560.8430.32230.3460.1850.35840.42010.25620.74840.6146000000000000000000000000000000000000
96
95zzzzSHAPE Profile - Most Likely Base Pair U/A - Variation 1.34007348
GGAGUACAGGUCAUCACGGCACUACUGCCUGUACUUCCAGUGCCAAAAGGCACUGGAGUACAGGCAGAGUGCCGUGAGACCUGUACAAAAGUCUGCCUUCGGGCAGACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0weak84.507.7213.86100000000000000000000000000000000000000000000000000000000000000000000000000000000000000111.852355.9377
97
96IsinrariSHAPE Profile - Most Likely Base Pair U/A - Variation 1.34013483
GGACCGCACUUCAUCUUAAAUCUACUCUUAUCUCUUCUUCACCAUCUUUGGUGAAGAGAGAUAAGAGAGAUUUAAGAGAAGUGCGGGAAAGAUGUGCUUCGGCACAUCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.19weak83.502.0841.042002.6391000000000000000000000000000000000000000002.578200000000-5.1564000000000000000000000000000002.5202002.46470
98
97BierarSHAPE Profile - Most Likely Base Pair U/A - Variation 1.34014734
GGACACCGCUUCAUCAUUACCCUACUCGUCAAUCUUCACCUCGCUUGGGCGAGGUGAGAUUGACGGGAGGGUAAUGAGAAGCGGUGAAAAGCGCUCCUUCGGGAGCGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.009weak79.402.8051.402-111.85230008.337800000000000000000000000000000000000000000000000000007.7596000000000000000000000000000000
99
98Likely U/A V1.3 1SHAPE Profile - Most Likely Base Pair U/A - Variation 1.34027549
GGAGUAUAUAUCAUCAUAUAUCUACAUAUAUAUCUUCGUAUAUAGAAAUAUAUAUGAGGUAUAUAUGAGAUAUAUGAGAUAUAUACAAAAGAUCAUCUUCGGAUGAUCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.129weak83.500.7610.380.8651000000000004.9607000000001.629501.60610001.5834001.56131.5398001.518900000000002.95752.88130000001.4224000000001.4045000000000000000000001.387101.37011.35353.9184
100
99Speed Skating (Most Likely Base Pair U/A v1.3)SHAPE Profile - Most Likely Base Pair U/A - Variation 1.34038185
GGAGUAUUAGUCAUCGAUCAUCUACGUAAUGUGCUUCAGAUAGCGAUAGCUAUCUGAGCAUAUUACGAGAUGGUCGAGACUGAUACAAAAGCGACUCUUCGGAGUUGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.593weak89.700.5720.286-0.35281.21881.58880.1322-0.26440.2635000.52460.2617003.30170.2534000000000.75512.7840-0.3937000000000.4871.2043000.24030.478600000.71343.12061.81920.79030000000000000.2253000.224900.2244000.2240000000000000.22350.223100.22260.27171.09581.9382
Loading...
Main menu