Eterna Scores R96 cooperativity
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBN
1
FilterID
SubmissionPuzzle_Name
FilterEternaNumber
Switch_Direction
NumberOfClusters
Baseline_Subscore
Folding_Subscore
Switch_Subscore
Cooperativity_Subscore
Eterna_Score
Sequence
hillfmaxnoFMN
hillfmaxFMN
hillfmaxmiR
hillfmaxnoFMN_std
hillfmaxFMN_std
hillfmaxmiR_std
hillfmaxnoFMN_sem
hillfmaxFMN_sem
hillfmaxmiR_sem
hillfmaxnoFMN_MAD
hillfmaxFMN_MAD
hillfmaxmiR_MAD
hillnnoFMNhillnFMNhillnmiR
hillnnoFMN_std
hillnFMN_std
hillnmiR_std
hillnnoFMN_sem
hillnFMN_sem
hillnmiR_sem
hillnnoFMN_MAD
hillnFMN_MAD
hillnmiR_MAD
hilldGnoFMN
hilldGFMNhilldGmiR
hilldGnoFMN_std
hilldGFMN_std
hilldGmiR_std
hilldGnoFMN_sem
hilldGFMN_sem
hilldGmiR_sem
hilldGnoFMN_MAD
hilldGFMN_MAD
hilldGmiR_MAD
hillKDnoFMNhillKDFMNhillKDmiR
hillKDnoFMN_sem_factor
hillKDFMN_sem_factor
hillKDmiR_sem_factor
hillKDnoFMN_MAD_factor
hillKDFMN_MAD_factor
hillKDmiR_MAD_factor
AsCs
Gs
UsA_percC_percG_percU_perc
Sequence_Length
2
5460136salish99-ex2-06Exclusion 293-11728.9829.470.000.0058.45
GAAAGGGCAGGAUAUGCAGAGAGAGAGAGAGAGAGAAAAAAACAUGAGGAUCACCCAUGUAGAAGGGCCGAAAG
0.720.781.141.240.441.370.300.110.330.310.320.691.101.010.640.270.570.340.070.140.080.280.270.40-17.13-17.21-16.540.420.593.290.100.140.800.380.621.5336.4533.4565.361.111.152.221.461.854.6033926644.5912.1635.148.1174
3
5463592JR_SS001_Sub012Same State 19313615.2730.002.830.0048.10
AACAUACAUGAGGAUCACCCAUGUUCCGGCAGGACAGGAUAUACAUCGAAAGUGUUAUAAGUAGAAGGGUCAUAAA
1.191.112.25123.401409.521941.8720.57234.92323.650.430.632.120.980.790.500.360.360.230.060.060.040.240.250.25-16.31-16.28-15.633.285.8915.770.550.982.630.341.011.4782.6385.14163.561.732.6713.861.412.744.362913181638.1617.1123.6821.0576
4
5463789Default titleExclusion 193-14527.3630.000.640.0058.00
AAUAAACAUGAGGAUCACCCAUGUGAGGAUAUACAGAUUAUAAGAAAAAAAAAAAAAAGUAGAAGGCACAUAUA
0.890.721.071.16254.20873.980.1737.89130.290.350.490.751.440.830.673.497.440.520.521.110.080.600.390.37-17.15-16.91-16.500.6211.7513.450.091.752.010.500.701.2035.6045.1368.451.105.777.431.642.013.31408131354.0510.8117.5717.5774
5
5463938Mod of Disincluded 3 (little more stable fmn state)Exclusion 193-11994.4130.0013.200.0047.61
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGAUGCGAAUAAAGAAAGAAGAAAGCAUCAGAAGGCACAUAUG
1.121.181.391253.921864.392410.5388.89132.16170.880.350.780.770.920.720.600.293.863.830.020.270.270.190.290.28-16.21-14.60-15.483.337.269.100.240.510.650.511.481.5791.22456.89188.441.271.671.911.664.414.833510181147.3013.5124.3214.8674
6
5463947
Mod of Disincluded 3 v.2 (little more stable fmn state, double sided switch of the MS2 seq)
Exclusion 193-11344.2730.0012.280.0046.56
CUUAAACAUGAGGAUCACCCAUGUGAGGAUAUGAUGCGAAUAAAGAAAGAAGAAAGCAUCAGAAGGCACAUAUG
1.141.171.431928.481274.22717.20166.60110.0861.960.410.830.770.920.670.590.325.403.460.030.470.300.200.250.30-16.17-14.45-15.473.237.4811.110.280.650.960.601.881.5094.77532.10190.841.321.912.611.836.574.483211181343.2414.8624.3217.5774
7
5463967
Mod of Disincluded 3 v.3 ( mildly more stable fmn state, double sided switch of the MS2 seq)
Exclusion 193-1400.0030.0013.750.0043.75
CUUAGACAUGAGGAUCACCCAUGUGAGGAUAUGAUGCGAAUAAAGAAAGAAGAAAGCAUCAGAAGGCACAUAUG
1.131.061.123.982884.55287.420.63456.0945.450.361.030.670.920.660.670.330.530.300.050.080.050.260.290.28-15.56-13.84-15.701.819.616.270.291.520.990.893.461.41175.59978.48152.251.334.572.702.4431.824.083111191341.8914.8625.6817.5774
8
5464072Mod of Disincluded 3 v.5 (rmoved G boost in 1-2 loop of MS2 state at nt4)Exclusion 193-11300.0030.005.450.0035.45
CCUAAACAUGAGGAUCACCCAUGUGAGGAUAUGAUGCGAAUAAAGAAAGAAGAAAGCAUCAGAAGGCACAUAGG
1.231.941.75293.792241.402160.2825.77196.58189.470.562.591.500.680.530.450.245.640.250.020.490.020.180.240.21-14.66-10.84-13.073.9012.2313.570.341.071.191.458.954.58428.9619579.772108.401.412.923.294.267725.4597.913212191143.2416.2225.6814.8674
9
5464570Ex2 Malc#2Exclusion 293-1220.0030.005.820.0035.82
AAAACGUCAGGAUAUACAGAAGAGAUCACAAAAAAAAAAAAACAUGAGGAUCACCCAUGUAGAAGGGACAAAAA
1.131.591.441.97577.558.260.42123.131.760.401.140.760.940.550.611.350.210.190.290.040.040.260.200.19-16.01-14.12-15.460.644.312.390.140.920.510.222.000.96111.80735.74192.551.152.511.661.257.402.60411114855.4114.8618.9210.8174
10
5464701Design 30 :P Sub-opt 6Exclusion 193-134530.0030.0011.250.0071.25
AACUGACAUGAGGAUCACCCAUGUCAGGAUAUGCUUCAUAAAAACAAACAAAAAUGAUGCAGAAGGGACAUGGA
1.161.031.19387.741271.371047.4220.8868.4556.390.300.470.461.150.670.762.190.341.430.120.020.080.310.260.33-17.94-16.47-17.762.297.749.940.120.420.540.331.240.7216.2270.0619.371.131.521.711.393.472.053213161343.2417.5721.6217.5774
11
5464947SS! 1 MT 5Same State 1931426.5030.000.000.0056.50
AAAAUACAUGAGGAUCACCCAUGUGAAAAUAUGGGAGGAUAUACCGAAAAAAAAAAAAAGGUAGAAGGCCCAAAAA
1.251.052.060.373.22570.170.191.61285.090.290.110.981.010.770.340.320.250.310.160.130.160.170.110.10-17.18-16.84-12.970.334.1615.450.162.087.720.410.404.2334.7348.612326.691.188.002258.841.511.4968.844010161052.6313.1621.0513.1676
12
5465180SS! MT 16Same State 19311930.0030.0024.500.0084.50
AAAAAACAUGAGGAUCACCCAUGUGAAAAUAUGGGAGGAUAUACAAACACGAAAGUGAAAGUAGAAGGCCUAAAAA
1.020.981.130.30142.85572.690.0732.77131.380.240.330.400.980.810.630.260.551.430.060.130.330.220.500.30-15.79-17.39-15.900.5912.818.300.132.941.900.431.091.25139.1828.10124.771.1418.896.711.532.973.473810171150.0013.1622.3714.4776
13
5465184SS! MT 18Same State 19313930.0030.0018.860.0078.86
AAAAAACAUGAGGAUCACCCAUGUAAAAAUAUGGGAGGAUAUUCAAACACGAAAGUGAAAGAAGAAGGCCUAAAAA
1.091.071.100.440.47972.380.070.08155.710.260.330.481.000.910.700.320.390.540.050.060.090.180.340.22-16.30-17.70-16.080.861.2710.110.140.201.620.470.840.8183.3520.63103.771.151.235.051.612.322.243910161151.3213.1621.0514.4776
14
5465186SS! MT 19Same State 19311730.0030.0013.350.0073.35
AUAAAACAUGAGGAUCACCCAUGUAAAAAUAUGGGAGGAUAUGCGAAAUAAAAUAAAUAAGCAGAAGGCCUAAAAA
1.101.041.220.391599.96218344.950.09388.0552956.430.250.430.581.050.750.680.400.470.270.100.110.070.100.430.20-16.62-17.30-16.280.4015.408.080.103.731.960.261.400.9160.3930.8284.751.1041.887.101.294.042.47399151351.3211.8419.7417.1176
15
5466297JR_Exc004_Sub210Exclusion 493-12240.0029.352.330.0031.68
AACGCGUCAGGAUAUAGCGAAACUUAGGUAGUACAACCAUACUAGAAGGGACAUGAGGAUCACCCAUGUGGGUA
0.791.041.38691.531232.592068.5746.2082.36138.210.340.701.100.910.700.490.703.092.170.050.210.150.300.310.24-15.66-14.81-14.806.647.5811.680.440.510.780.891.752.15157.78371.09375.501.561.662.182.435.788.592614201435.1418.9227.0318.9274
16
5467172Mod of Janderson's WEB Mod v.1 Exclusion 293-116530.0030.0023.480.0083.48
AGCUAGUCAGGAUAUACGUAAAUGUCGAAAGACGUAUUGGGACAUGAGGAUCACCCAUGUAGAAGGGACUAGCA
1.011.211.18278.352326.62537.2621.67181.1341.830.270.640.541.120.800.680.336.050.320.030.470.020.290.270.26-17.56-15.23-17.372.674.7011.390.210.370.890.381.050.8023.70242.2528.501.231.442.431.462.852.232612211535.1416.2228.3820.2774
17
5467372Ex2 Design 116: Not so Super Stable 3Exclusion 293-16730.0030.0022.260.0082.26
AGUAGAUCAGGAUAUACGUGAAAGGUCAAAGUGUCCAAUAUACAUGAGGAUCACCCAUGUAGAAGGGAUCUACA
1.181.681.358.462358.971523.031.03288.19186.070.431.450.541.090.570.690.354.680.450.040.570.060.270.210.34-17.44-14.13-17.202.357.8613.480.290.961.650.422.530.8926.66727.6133.801.332.615.191.5212.582.442812181637.8416.2224.3221.6274
18
5467742Ex2 Design 139: Sub-opt 3Exclusion 293-124430.000.002.810.0032.81
AGUCAGAGAGGAUAUACAUGGGAAAAAAAAGUAAGAUCCCUACAUGAGGAUCACCCAUGUAGAAGGCUCUGACA
0.220.400.58363.76852.041165.3523.2954.5574.600.230.490.660.940.600.428.097.097.230.520.450.460.720.500.34-16.78-15.32-15.3016.9823.5547.161.091.513.022.014.205.0451.84222.53225.772.974.5220.477.4766.98154.723013181340.5417.5724.3217.5774
19
5467804Ex2 Design 162: Sub-opt 26Exclusion 293-133230.0030.0019.870.0079.87
AGCUGGAGAGGAUAUACGUAGGAAAAAAAAGUCUGAUCACUACAUGAGGAUCACCCAUGUAGAAGGCUCUGGCA
1.131.221.351058.012935.0414730041.8358.07161.08808416.070.360.690.611.160.630.701.841.870.460.100.100.030.310.250.30-17.76-15.28-17.593.698.419.750.200.460.540.391.560.7719.37231.8522.861.221.591.711.484.782.152713201436.4917.5727.0318.9274
20
5468135Ex 3 May 12Exclusion 393-110430.0030.0016.820.0076.82
AAAUGAUGAGGAUAUACAUGAGGAUCACCCAUGUGUAAAAAUAAAUACACAAAAGAAAGUAGAAGGCAUCAAAA
1.111.251.3184.12370.58560.468.2536.3454.960.220.640.581.120.650.700.320.270.310.030.030.030.290.200.33-17.32-15.03-17.152.873.629.840.280.360.960.391.550.7330.04296.1335.771.321.432.621.474.722.07389141351.3512.1618.9217.5774
21
5468168Ex 3 May 23Exclusion 393-12330.0030.0015.310.0075.31
AAAAAUCGAGGAUAUACAUGAGGAUCACCCAUGUGGGACCAAGAAAACACAAAAGAAAGUAGAAGGCGAUAAAA
1.181.341.14734.80281.13517.50153.2258.62107.910.280.770.411.010.750.680.310.370.730.060.080.150.220.240.31-17.18-15.74-17.176.576.6910.001.371.392.090.481.561.0234.64146.4534.883.934.038.051.614.752.78371117950.0014.8622.9712.1674
22
5468309Ex 3 May 43Exclusion 393-12327.8730.007.550.0065.42
AAAGAUGGAGGAUAUACAUGAGGAUCACCCAUGUAGAAAAAAAAUUGGGAAAAAGAAAGUAGAAGGCCAAAAAA
1.231.361.541.522041.86909.690.32425.76189.680.410.540.831.050.710.600.170.290.290.040.060.060.120.270.37-17.16-16.27-17.111.037.3813.340.221.542.780.220.860.4635.1386.0937.051.244.6616.141.252.361.58397181052.709.4624.3213.5174
23
5468330Ex 3 May 48Exclusion 393-13614.3830.0019.610.0064.00
AAAAAGUGAGGAUAUACAUGAGGAUCACCCAUGUAAUAAAAAAAAAGGGUGGAAGAAAGUAGAAGGCACCAAAA
1.211.871.020.315950.181260.390.05991.70210.070.231.760.481.010.560.654.620.380.290.770.060.050.250.160.27-16.55-12.77-16.100.788.488.350.131.411.390.534.071.1064.932835.92101.751.144.114.021.7058.693.01388181051.3510.8124.3213.5174
24
5468909EX3 229: Super Stable 29Exclusion 393-181430.0030.000.000.0060.00
ACCAAUGCAGGAUAUACAUGAGGAUCACCCAUGUAUAACCUACAUAGAUGAUCAUCAUGUAGAAGGGCAAUGGA
0.820.750.9113646.021824.482156.77478.2963.9575.590.230.330.421.240.990.781.092.031.920.040.070.070.350.570.41-18.07-18.12-18.043.3913.7712.530.120.480.440.390.800.8514.1513.5614.691.131.621.551.482.232.342814161637.8418.9221.6221.6274
25
5470172JR_Exc002_Sub304Exclusion 293-19330.0030.000.000.0060.00
UCGAUGCGAGGAUAUACUAAGGCAACUACUGCAGCUCAAAAACAUGAGGAUCACCCAUGUAGAAGGCGCAUAUA
1.431.281.641.626142.211843.420.17636.92191.150.460.490.761.140.940.680.380.590.390.040.060.040.280.300.29-17.98-17.87-17.800.489.709.970.051.011.030.350.640.7315.5017.3518.571.052.732.811.421.902.072716171436.4921.6222.9718.9274
26
5471412V1Same State 1931100.007.030.220.007.26
GGAACACAUGAGGAUCACCCAUGUCAAGGAGGUCGAGGAUAUAGGAAAAAAAAAAAAAAAUUAGAAGGUGAGGAGG
0.580.700.55363.83346.090.67115.05109.440.210.270.610.340.780.740.610.540.950.720.170.300.230.190.320.19-14.74-14.59-13.957.578.382.242.392.650.710.861.661.78397.97458.84871.4510.9514.172.032.375.255.92358231046.0510.5330.2613.1676
27
5471541Ex 1 Tesla 3Exclusion 193-15830.0030.006.010.0066.01
ACAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCGAAACAAACAAACAAACAAACAAAGCAGAAGGCACAACAA
1.181.131.181.024916.061043.980.13645.51137.080.300.500.551.270.780.710.400.290.360.050.040.050.410.260.29-17.65-16.86-17.661.087.009.780.140.921.280.560.960.8121.6247.3821.441.152.513.611.762.622.24391613652.7021.6217.578.1174
28
5471617Web Mod 74% 2Exclusion 293-13821.9430.0022.370.0074.30
AGCUAGUCAGGAUAUACAAACAUGUCAAAAGACGUGAAGGGACAUGAGGAUCACCCAUGUAGAAGGGACUAGCA
0.991.081.310.303925.80547.330.05636.8588.790.260.810.710.990.880.590.450.820.310.070.130.050.150.460.31-16.83-14.90-16.440.536.6813.220.091.082.140.350.950.9649.18336.6972.531.092.958.531.422.592.612913201239.1917.5727.0316.2274
29
5471806Hyphema Seclusion Mod 62% 5Exclusion 293-15330.0030.0019.020.0079.02
AAGAGUAGAGGAUAUACGAAAAAAGAGUCGAAAGACUCGGGACAUGAGGAUCACCCAUGUAGAAGGCUACUCAA
0.971.121.290.50739.72840.770.07101.61115.490.290.540.541.110.750.590.733.550.350.100.490.050.270.290.30-17.52-15.52-17.010.616.4918.020.080.892.480.510.931.3824.64181.4941.181.092.4411.891.662.543.993112201141.8916.2227.0314.8674
30
5471823Fiskers exclusion D2 62% 4Exclusion 293-18327.7330.0022.300.0080.03
AAAAAGGCAGGAUAUACGAGUCAAAGAAAAGACAAAAAGGGACAUGAGGAUCACCCAUGUAGAAGGGCCAAAAA
0.901.131.230.632586.682793.140.07283.93306.590.280.560.521.040.750.700.523.790.460.060.420.050.390.280.26-17.14-14.80-16.911.124.927.100.120.540.780.421.250.9536.14375.4845.251.131.722.181.533.502.59371119750.0014.8625.689.4674
31
5471826Fiskers exclusion D2 62% 5Exclusion 293-12730.0030.0014.910.0074.91
AAAAAGGCAGGAUAUACGAGUCAAAGAAAAGACAAAAGGAGACAUGAGGAUCACCCAUGUAGAAGGGCCAAAAA
0.931.521.471.43791.281009.840.28152.28194.340.190.841.321.070.670.610.300.250.350.060.050.070.270.270.39-17.51-15.57-16.750.566.7112.190.111.292.350.291.292.2824.80172.1553.141.113.6410.441.333.639.74371119750.0014.8625.689.4674
32
5471837PK2Exclusion 193-13928.0230.0011.640.0069.67
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCUAAAAAAAUCCGCAUGAAAAAAUAGCAGAAGGCACAUAAA
1.211.121.220.611250.890.760.10200.300.120.430.640.401.130.730.710.474.960.200.080.790.030.250.330.19-17.20-15.57-17.100.476.171.420.080.990.230.331.330.5433.86173.6437.381.082.691.261.393.771.713712141150.0016.2218.9214.8674
33
5471906Tetraloop... 61% 2Exclusion 293-14028.9830.0021.930.0080.91
AAUAACAGAGGAUAUACGAAAAUAAGCGGAAACGCAAAGGGACAUGAGGAUCACCCAUGUAGAAGGCUGGAUAA
1.651.722.074644.2812072.542513.31734.331908.84397.390.591.251.781.030.710.620.471.370.750.070.220.120.390.260.35-17.09-14.74-16.694.986.6614.560.791.052.300.731.581.6237.65397.7356.332.202.8710.002.074.865.043311201044.5914.8627.0313.5174
34
5471950EX3 270: Random 6Exclusion 393-119030.0030.000.000.0060.00
ACAUGAUCAGGAUAUACAUGAGGAUCACCCAUGUAAAUCAAAAAAAAACUUUCUUUAUGUAGAAGGGAUCUUGU
1.591.321.55311.913264.48870.6822.63236.8363.170.590.640.751.180.930.792.202.770.430.160.200.030.350.460.33-18.01-17.84-17.905.257.279.750.380.530.710.320.770.7515.1117.8716.791.461.702.031.372.162.122911132139.1914.8617.5728.3874
35
5472105salish99-ex1-21Exclusion 193-111026.2830.007.710.0063.99
GGAAAACAUGAGGAUCACCCAUGUAAGGAUAUGCAAAAGGAUAUAGAAGGAAAAAAAAGCAGAAGGUACAAAGG
1.030.951.160.612128.911669.410.06202.98159.170.340.380.431.140.730.680.380.590.490.040.060.050.270.230.28-17.02-15.98-16.760.636.467.970.060.620.760.391.101.0340.42114.7552.871.061.852.141.483.012.8037820950.0010.8127.0312.1674
36
5472269EX4 308: Super Stable 8Exclusion 493-117830.0030.003.500.0063.50
AUUAUGUCAGGAUAUCAGUAGUAAAAAAAAAAAAUUACUACUGAGAAGGGACAUGAGGAUCACCCAUGUCAAAA
1.121.071.3683.03832.82959.276.2262.4271.900.360.440.701.060.800.732.740.570.550.210.040.040.340.340.35-17.59-17.10-17.402.6310.3710.850.200.780.810.460.810.7523.0237.4827.841.222.172.251.592.262.113410141645.9513.5118.9221.6274
37
5472520EX4 331: Super Stable 31Exclusion 493-157130.0030.008.160.0068.16
CUCAUGUGAGGAUAUCAGUAGUAAAAAAAUAAAAUUACUACUGAGAAGGCACAUGAGGAUCACCCAUGUGUCUU
1.011.041.2831.493009.8513288.331.32125.96556.100.300.530.491.180.610.740.591.521.270.020.060.050.340.290.36-17.94-16.56-17.871.719.799.250.070.410.390.351.590.7316.1164.0617.361.071.511.471.424.912.072812151937.8416.2220.2725.6874
38
5472548salish99-ex1-70Exclusion 193-1180.0030.0018.440.0048.44
GGAUUACAUGAGGAUCACCCAUGUGAGGAUAUCGAUGUCCAGUAAUACGUGCGGGACUCGAGAAGGCACUUGGA
1.013.551.260.943744.933998.220.22882.69942.390.234.530.690.910.530.590.480.240.170.110.060.040.290.230.20-15.98-10.33-15.010.969.606.270.232.261.480.888.012.06114.9432556.86302.651.259.614.392.423012.787.812114231628.3818.9231.0821.6274
39
5472577EX4 337: Super Stable 37Exclusion 493-134530.0030.007.100.0067.10
CUCAUGUGAGGAUAUCAGUAGUAAAAAAAUAAAAUUACUACUGAGAAGGCACAUGAGGAUCACCCAUGUGCCAA
1.081.021.30273.882180.321470.6014.75117.3879.170.280.480.501.230.690.813.190.511.920.170.030.100.310.310.34-17.99-16.92-17.963.859.4910.980.210.510.590.331.100.5815.3644.6815.911.231.671.811.393.001.793013151640.5417.5720.2721.6274
40
5472642EX4 344: Super Stable 44Exclusion 493-132125.1030.0025.670.0080.77
CUUUUGUGAGGAUAUCAGUAGUAAAAAAAUAAAAUUACUACUGAGAAGGCACAUGAGGAUCACCCAUGUUCCUC
1.071.301.19740.262567.66565.8641.32143.3131.580.300.870.511.130.720.810.485.613.270.030.310.180.240.280.26-17.01-14.14-16.892.796.896.100.160.380.340.341.660.6140.83724.8646.041.171.471.411.415.241.842713142036.4917.5718.9227.0374
41
547278375%, Ex5 sub 1, 7Same State 19316330.0030.0016.680.0076.68
AGGAAACAUGAGGAUCACCCAUGUAAAAAUAUGGGAGGAUAUGCGAAAAGAAACAAAGAAGCAGAAGGCCUAAGAA
1.061.031.50679.311692.381149.4585.58213.22144.820.310.340.870.960.760.533.580.414.900.450.050.620.240.290.22-16.19-17.20-15.153.468.9214.610.441.121.840.401.061.5493.3733.94263.111.553.086.301.502.884.65371020948.6813.1626.3211.8476
42
547280471%, Same state of confusion2, 3Same State 19313818.1030.0010.090.0058.19
AAACCACAUGAGGAUCACCCAUGUCAAGAGAGACUAGGAUAUCUGAAUUAAUUAAAUUAAGGAGAAGGAGUGAAAA
1.151.031.520.45319.941430.240.0751.90232.020.250.440.701.130.910.620.300.580.270.050.090.040.210.300.24-15.86-16.64-15.550.513.9911.820.080.651.920.410.630.89128.9559.14177.171.091.916.811.511.882.443410171544.7413.1622.3719.7476
43
547280771%, Same state of confusion2, 4Same State 19316130.0030.0024.750.0084.75
AAAAAACAUGAGGAUCACCCAUGUAAAAAAAUGGGAGGAUAUCUGAAUUAAUUAAAUUAAGGAGAAGGCCUAAAAA
1.080.981.361.74397.9226239.440.2250.953359.620.380.251.020.990.800.620.390.940.290.050.120.040.210.310.30-15.28-16.93-14.550.906.046.350.110.770.810.580.851.55230.6844.27478.991.122.172.251.782.344.71388151550.0010.5319.7419.7476
44
547292659%, Flamingo, 5Same State 19314430.0030.0027.820.0087.82
AAACCACAUGAGGAUCACCCAUGUAAAAAUAUGGGAGGAUAUCGGAAUAAAAUAAAGAAACGAGAAGGCCUAAAAA
0.980.921.40879.552430.101011.79132.60366.35152.530.220.470.871.020.910.630.300.400.400.050.060.060.280.370.37-15.28-17.31-14.554.855.3213.490.730.802.030.410.791.83231.7830.26481.232.082.237.651.502.216.223811161150.0014.4721.0514.4776
45
547318975%, Ex sub1, 11Same State 19311330.0030.0011.850.0071.85
AGGAAACAUGAGGAUCACCCAUGUAAGAUAUACACAGGAUAUGCGAAAAGAAACAAAGAAGCAGAAGGGUGGAAAA
0.881.021.211.430.581816.400.400.16503.780.400.760.311.110.890.610.300.400.350.080.110.100.280.680.38-16.93-17.63-17.080.791.7815.280.220.494.240.500.710.8344.6222.0438.281.241.6469.301.652.032.30371020948.6813.1626.3211.8476
46
547333275%, Ex sub1, 32Same State 19311730.0030.009.740.0069.74
AGGAAACAUGAGGAUCACCCAUGUAAAAAAGUGGGAGGAUAUACUAGAAGAAACAAAAUAGUAGAAGGCCUAAAAA
1.151.251.03416.022693.220.41100.90653.200.100.490.840.201.040.760.670.330.380.270.080.090.060.170.510.17-17.05-17.37-16.926.0415.641.791.473.790.430.271.420.7239.2428.4844.694.3344.421.541.324.142.06389181150.0011.8423.6814.4776
47
5473487SS2 504: MS2 4Same State 29315030.0030.000.000.0060.00
AAAAUAAAAUAAAAGGAUAUAAAAUAAAAUACAUGAGGAUCACCCAUGUAUAAAAUAAAAAAAUAAAAGAAGGAAUAAAAAUAAA
1.501.361.700.954.10867.760.130.58122.720.340.560.711.320.840.830.300.380.350.040.050.050.190.340.29-17.53-17.17-17.362.631.748.390.370.251.190.250.780.5624.4234.7928.961.451.283.281.292.191.7556591565.885.8810.5917.6585
48
5475227salish99-ex2-12Exclusion 293-15230.0030.0023.300.0083.30
GGCUAGUCAGGAUAUACGAACAUGUCAAAAGACGUGAAGGGACAUGAGGAUCACCCAUGUAGAAGGGACUAGCA
0.871.021.250.381168.871175.630.05162.09163.030.260.480.591.050.810.560.550.260.280.080.040.040.310.270.29-17.37-15.16-16.830.594.019.230.080.561.280.410.951.0628.73261.2548.971.091.743.601.512.592.892713221236.4917.5729.7316.2274
49
5475308salish99-Ex2-17Exclusion 293-19330.0030.0022.700.0082.70
AGCUAGUCAGGAUAUACGAACAUGUCAAAAGACGUGAAGGGACAUGAGGAUCACCCAUGUAGAAGGGACUAGCC
0.931.041.2150.31684.862876.065.2271.02298.230.240.410.510.980.880.610.554.810.360.060.500.040.330.320.29-17.40-15.31-17.132.773.7713.890.290.391.440.480.841.0527.66225.2236.421.331.484.221.612.322.852714211236.4918.9228.3816.2274
50
5475318Denovo 18Exclusion 193-19915.7130.0010.920.0056.63
AAAACACAUGAGGAUCACCCAUGUGAGGAUAUGCUAUGGAAAAUAAAAAUAAAACAUAGCAGAAGGCACAAAGG
0.921.221.361260.021554.651382.40126.64156.25138.940.290.860.770.860.680.590.284.360.280.030.440.030.220.290.26-16.40-14.98-15.892.787.5811.350.280.761.140.651.871.5375.72313.09126.211.322.143.131.926.484.643611161148.6514.8621.6214.8674
51
5476900JR_SS002_Sub401Same State 2931870.0030.000.000.0030.00
AAUACAAAUAGUCAGGAUAUCAAAAAUAAGACAUGAGGAUCACCCAUGUAAUAAGUAAAAGUAAAUGAGAAGGGACAGGGUGAAA
1.351.402.67550.591281.682900.9159.03137.41311.010.410.922.340.680.720.510.204.050.230.020.430.020.120.270.19-14.86-14.44-13.404.345.6910.720.460.611.150.951.562.72352.90533.851516.731.591.843.152.574.7615.20429191549.4110.5922.3517.6585
52
5477399JR_Exc002_Sub408Exclusion 293-17220.9230.0026.870.0077.79
ACUAUACGAGGAUAUACUGACGGGCCUCAGGCAUCCAUCAGACAUGAGGAUCACCCAUGUAGAAGGCGUAUACU
1.082.141.681128.072058.771243.40132.94242.63146.540.331.981.061.010.620.590.543.714.130.060.440.490.280.250.24-16.71-13.09-16.293.069.059.780.361.071.150.573.251.2155.422064.3684.471.432.903.161.7725.793.372318181531.0824.3224.3220.2774
53
5479677Exclusion 4.1f (Exclusion4-cac2 - changed GC at 6/50 to AU )Exclusion 493-16030.0030.0017.420.0077.42
AACGUGUAAGGAUAUGCUGCUCGUCACGAAAGUGAUGAGUAGCAGAAGGUACAUGAGGAUCACCCAUGUAAAGA
1.031.101.362263.34938.98385.10292.20121.2249.720.340.460.561.070.710.740.310.240.340.040.030.040.330.250.35-17.66-15.68-17.393.613.529.390.470.451.210.361.390.9821.39154.8527.991.591.573.361.434.032.662612211535.1416.2228.3820.2774
54
5479932Exclusion Z2Exclusion 193-1740.0030.000.880.0030.88
AAAAUACAUGAGGAUCACCCAUGUCAGGAUAUGCUAAAAAAAAAAUUAAAAAAAAAAUGUAGAAGGGACUAAAA
1.081.021.310.49766.562921.090.0689.11339.570.410.450.611.140.850.632.460.483.350.290.060.390.260.310.31-16.24-15.93-15.450.655.878.840.080.681.030.531.051.7388.71121.15194.141.081.982.791.692.865.67418121355.4110.8116.2217.5774
55
5480109MerneithExclusion 193-15329.8030.001.100.0060.90
AGGAAACAUGAGGAUCACCCAUGUGAGGAUAUUUGAAAGAAAAGAAAAGAAAGAAGAAGAAGAAGGCACAAGAA
1.221.171.320.811197.367225304.290.11164.47992471.870.360.430.441.210.950.730.344.010.310.050.550.040.340.380.35-17.34-17.02-17.290.445.589.770.060.771.340.391.070.6429.4540.6730.991.062.153.831.482.921.9039720852.709.4627.0310.8174
56
5480225NeferkaExclusion 193-13529.6430.000.000.0059.64
AGGGAACAUGAGGAUCACCCAUGUGAGGAUAUACAAAAGAAAAGAAAAGAAAGAAGAAGUAGAAGGUACAAGAA
1.030.951.240.354476.13487.620.06756.6082.420.280.390.561.201.070.711.720.510.370.290.090.060.420.420.28-17.31-17.18-17.200.535.536.070.090.931.030.410.720.4830.3934.5233.911.092.552.791.502.061.6239720852.709.4627.0310.8174
57
5480276Nebkaure Khety II Exclusion 193-110130.0030.004.700.0064.70
AAGAAACAUGAGGAUCACCCAUGUGAGGAUAUGAAAAAGAAAAGAAAAGAAAGAAGAAUCAGAAGGCACAAAGG
1.131.131.27966.513195.36860.5496.17317.9585.630.300.520.541.190.800.783.800.301.020.380.030.100.310.280.27-17.38-16.73-17.192.856.4714.500.280.641.440.260.750.7128.3154.4234.201.331.904.231.302.122.0340819754.0510.8125.689.4674
58
5480462Sankhenre SewadjtuExclusion 293-14616.5430.000.000.0046.54
AAGAAGGCAGGAUAUACAAAAUAAAAGAAAAGAAAGAAAGAACAUGAGGAUCACCCAUGUAGAAGGGUCAAGAA
1.031.041.040.611.3716895.990.090.202491.180.370.500.411.100.850.800.334.760.350.050.700.050.330.380.24-16.62-16.63-16.662.631.509.250.390.221.360.370.740.4860.5260.0058.311.471.253.911.452.091.6240818854.0510.8124.3210.8174
59
5480509Seheqenre SankhptahiExclusion 293-110624.8730.000.000.0054.87
AAGAAGUCAGGAUAUGCUAAAGAAAUAAAAAGAAAGAAAGAACAUGAGGAUCACCCAUGUAGAAGGGACAAGAA
1.041.001.324.321064.16901.390.42103.3687.550.300.360.601.170.870.740.380.690.450.040.070.040.270.340.35-17.01-16.79-16.970.414.7311.360.040.461.100.320.670.5941.1451.1442.501.041.583.011.381.951.8039818952.7010.8124.3212.1674
60
5481091JL Lego Mod 9Exclusion 393-16317.0330.0025.310.0072.34
AGUCGGCGAGGAUAUACAUGAGGAUCACCCAUGUGAGAGAUAAAAGUGAGUUAGACAAGUAGAAGGCGCUGACA
1.041.461.141.854873.5111219.250.23614.001413.490.351.400.581.060.630.700.601.194.170.080.150.530.290.250.34-16.64-12.95-16.541.427.489.310.180.941.170.622.741.1259.632370.6665.761.202.563.231.8615.443.072711231336.4914.8631.0817.5774
61
5481093JL Lego Mod 10Exclusion 393-14222.4730.0024.580.0077.04
AGUCGGCGAGGAUAUACAUGAGGAUCACCCAUGUGAGAGAAUAAAGUGAGUUAGACAAGUAGAAGGCGCUGACA
0.981.151.071.02759.36546.570.16117.1784.340.310.860.531.090.590.690.683.820.340.110.590.050.330.200.27-16.90-13.40-16.722.1310.006.240.331.540.960.452.000.7345.731517.2254.751.394.682.621.567.352.072711231336.4914.8631.0817.5774
62
5481133JL Lego Mod 23Exclusion 393-1336.9630.0019.970.0056.94
AGUAUGCGAGGAUAUACAUGAGGAUCACCCAUGUGAGAGAUAAAAGUGAGAAAGACAAGUAGAAGGCGCGUACA
0.931.431.210.522584.761348.330.09449.95234.710.301.390.800.980.720.605.918.225.041.031.430.880.240.430.21-16.38-13.33-16.490.559.7315.200.101.692.650.553.452.1876.721627.0568.931.105.4414.091.7331.538.843010221240.5413.5129.7316.2274
63
5481855JR_SS001_Sub610Same State 1931470.0030.002.130.0032.13
CCCUCACAUGAGGAUCACCCAUGUCCUAGCAGGUCAGGAUAUAGCCCGCAUCCGCUGCGGCUAGAAGGGACAGCUG
0.991.072.061.15707.881626.960.17103.25237.320.330.531.630.950.850.480.440.380.320.060.060.050.260.310.18-15.39-15.58-14.281.135.6711.480.170.831.670.761.212.62207.49172.02630.211.182.295.342.143.3513.681824211323.6831.5827.6317.1176
64
5481860JR_SS001_Sub611Same State 19311750.0030.003.350.0033.35
CCCUCACAUGAGGAUCACCCAUGUCCUAGCCCGUCAGGAUAUAGCCCGCAUCCGCUGCGGCUAGAAGGGACAGCUG
1.021.151.70463.581919.941722.2835.04145.13130.190.380.611.250.990.760.533.665.033.190.280.380.240.230.300.24-15.25-15.00-13.962.946.6310.050.220.500.760.561.442.42238.54305.12863.381.251.652.141.754.2411.261726201322.3734.2126.3217.1176
65
5482118JR_SS001_Sub703Same State 1931640.0017.390.000.0017.39
CGUACACAUGAGGAUCACCCAUGUCAGAUUUGGUCAGGAUAUGGGCGGCAUCCGCUAUUGCCAGAAGGGACUGUUG
0.671.27420.27569.831488.162119.0471.23186.02264.880.431.28622.230.640.520.343.401.087.300.420.130.910.220.220.15-15.64-13.397.756.3810.5432.680.801.324.081.925.1830.57161.971523.652324974737966.032.223.7359.436.80178.4618912518128391.901817231823.6822.3730.2623.6876
66
5482123JR_SS001_Sub705Same State 19317330.0030.004.550.0064.55
CGUUCACAUGAGGAUCACCCAUGUCAGAUUUGGUCAGGAUAUGGUCGGCUUCCGCUAUUGCCAGAAGGGACUGUUG
1.051.021.351.88477.181357.750.2255.85158.910.270.500.830.910.660.580.444.070.260.050.480.030.240.320.21-17.10-17.14-16.430.709.5412.140.081.121.420.451.481.2437.3536.1673.251.093.054.141.574.393.441617222121.0522.3728.9527.6376
67
5482146JR_SS001_Sub712Same State 19313230.0030.003.820.0063.82
CGCCGACAUGAGGAUCACCCAUGUCACAACUGGUCAGGAUAUGGUAUGAUUUGGCUAUUGCCAGAAGGGACCUCAG
1.130.981.380.36421.74898.050.0674.55158.750.430.420.841.020.710.640.280.330.740.050.060.130.290.320.35-17.27-17.18-16.780.699.4229.370.121.675.190.480.941.1731.5634.7551.771.135.29179.971.622.573.212018211726.3223.6827.6322.3776
68
5482171JR_SS002_Sub705Same State 29316130.0030.008.350.0068.35
UAUCAUUACACGAAGGAUAUCGAUAAUUGAACAUGAGGAUCACCCAUGUGAUAUAUUUUACAGUUCGAGAAGGUCGAGGGUGAAG
1.261.391.640.81667.843974.460.1085.51508.880.610.700.871.150.920.680.350.500.540.050.060.070.260.410.32-17.23-17.63-17.010.7210.8918.920.091.392.420.340.750.8532.7922.0441.081.104.0311.281.402.112.332912212334.1214.1224.7127.0685
69
5482451SS1 - 20Same State 19318730.0030.004.790.0064.79
AAAAGACAUGAGGAUCACCCAUGUCAAGACGUGGGAGGAUAUGCAUGGAAAACAUGCUGUGCAGAAGGCCCGUGUC
1.101.061.32225.822452.01944.0024.21262.88101.210.350.420.491.080.870.710.303.010.270.030.320.030.290.370.28-17.58-17.75-17.513.787.3410.650.400.791.140.360.690.8323.2919.6424.841.502.203.131.431.982.292515231332.8919.7430.2617.1176
70
5482500SS1 - 34Same State 19316630.0030.0014.180.0074.18
AAAAGACAUGAGGAUCACCCAUGUGAAAACGUAGGAGGAUAUGUCGUGAAAAAAGACUUGACAGAAGGCCUGUGUC
1.231.111.422939.76372.14951.71361.8645.81117.150.290.480.700.930.850.620.210.893.430.030.110.420.200.350.25-16.07-17.08-15.344.964.398.570.610.541.050.430.781.25105.2338.16217.491.841.722.871.542.183.502912211438.1615.7927.6318.4276
71
5482544SS1 - 49Same State 193143214.3430.0011.270.0055.61
AAAAGACAUGAGGAUCACCCAUGUAAAAACAUAGGAGGAUAUGUCAUGAAAAAAGACUUGACAGAAGGCCUUUGUC
1.271.251.87511.432633.696211.4524.61126.71298.850.420.611.360.790.630.500.381.352.680.020.060.130.160.230.20-15.25-15.73-13.942.089.4415.020.100.450.720.691.502.50239.11147.03883.511.111.582.061.994.4712.213212171542.1115.7922.3719.7476
72
5482675SS1 - 85Same State 193112530.0030.006.770.0066.77
AAAAGACAUGAGGAUCACCCAUGUGAAAACAUACAAGGAUAUGUGUGGAAACCGUACUAUACAGAAGGUGUAUGUC
1.141.041.345.711424.8415697.070.51127.441403.990.250.440.521.190.890.700.350.462.470.030.040.220.270.360.31-17.19-17.59-17.150.858.6614.180.080.771.270.370.730.6834.0822.9635.801.082.173.561.452.081.983012181639.4715.7923.6821.0576
73
5482690SS1 - 90Same State 1931700.000.000.000.000.00
GACAGACAUGAGGAUCACCCAUGUACAAACGUACAAGGAUAUGUGUGGAAACCGUACUAUACAGAAGGUGUCUGUC
0.471.064.082176.312079.912446.90260.12248.60292.460.411.405.890.730.520.448.867.325.881.060.880.700.420.260.24-15.16-12.16-6.888.5815.9018.531.031.902.212.498.1315.82261.475252.931024167.862.796.699.1612.083397.717426422.692615191634.2119.7425.0021.0576
74
5482976JL Maslow Revisted mod 3Exclusion 393-14812.3730.0024.120.0066.49
AACAGUACAGGAUAUACAUGAGGAUCACCCAUGUGAGAAUUAUGUGGCGUACCACAAAGUAGAAGGGUACUGGA
1.301.761.18937.271937.34505.64135.28279.6372.980.431.550.521.120.610.690.310.470.260.050.070.040.250.170.20-16.57-12.80-16.163.577.565.130.521.090.740.383.050.7463.382758.8295.561.672.982.101.4621.192.112712201536.4916.2227.0320.2774
75
5483001JL Maslow Revisted mod 5Exclusion 393-17227.4930.0022.340.0079.83
AACAGUACAGGAUAUACAUGAGGAUCACCCAUGUGAGAUUUAAGUGGCGUACCACAAAGUAGAAGGGUACUGGA
1.211.981.41336.754550.941936.2039.69536.33228.180.322.120.601.110.520.740.395.610.290.050.660.030.270.190.27-17.16-12.75-17.033.4010.0620.910.401.192.460.424.250.7135.182915.2940.281.493.2711.761.5369.792.032712201536.4916.2227.0320.2774
76
5483008JL Maslow Revisted mod 8Exclusion 393-1232.6730.0027.350.0060.02
AACAGUACAGGAUAUACAUGAGGAUCACCCAUGUGAGACUUAAGUGGCGUACCACAAAGUAGAAGGGUACUGGA
1.101.371.551.251780.551549.090.26371.27323.010.201.430.661.140.670.580.317.230.520.061.510.110.360.240.31-16.27-13.15-15.160.419.828.510.092.051.780.362.362.1785.661946.37261.941.097.765.901.4310.578.772713201436.4917.5727.0318.9274
77
5483048JL Maslow Revisted mod 14Exclusion 393-15128.6630.0032.990.0091.66
AACAGUAGAGGAUAUACAUGAGGAUCACCCAUGUGAUAUUUACGUGGCGUACCACGAAGUAGAAGGCUACUGGA
1.182.181.327.732749.10138.301.08384.9519.370.412.660.401.150.570.770.284.760.380.040.670.050.280.200.36-17.25-12.08-16.830.359.055.150.051.270.720.384.710.9332.145647.0349.021.053.552.061.46110.982.532513201633.7817.5727.0321.6274
78
5483749Menkheperre Thutmose IIIExclusion 393-13730.0030.000.000.0060.00
AAGAAGUCAGGAUAUACAUGAGGAUCACCCAUGUAAAAGAAAGAAAAGGGAAAGAAAAGUAGAAGGGACAAGAA
1.161.121.490.30376.770.760.0561.940.120.280.550.581.060.890.610.304.3512.810.050.722.110.160.330.22-17.48-17.46-17.200.405.371.070.070.880.180.330.620.7125.7426.1233.971.072.421.191.401.862.0439720852.709.4627.0310.8174
79
5484075Darius IIISame State 29311212.7730.0015.990.0058.77
AAAGAAGAAAGACAGGAUAUGGAUGGGUAAACAUGAGGAUCACCCAUGUAUAAGAAAGAAAGAAACCAGAAGGGUCAAAAGAAAA
1.021.011.160.240.63432.230.070.18124.770.170.330.490.860.870.660.250.180.230.070.050.070.210.080.14-15.08-16.41-14.340.542.314.290.160.671.240.370.290.66281.9974.37591.771.171.953.451.451.341.93449221051.7610.5925.8811.7685
80
5484297Gaius TurraniusExclusion 193-1621.2230.006.300.0057.52
AAGAAACAUGAGGAUCACCCAUGUGAGGAUAUGCAAGAAAGAAAGAAAGAAAGAAGAAGCAGAAGGCACAAAGG
1.231.021.220.350.553.340.140.221.360.470.510.501.080.650.860.410.190.470.170.080.190.090.240.48-16.86-15.08-17.030.661.334.650.270.541.900.271.321.2547.47281.6340.031.311.726.681.313.723.4838921651.3512.1628.388.1174
81
5484834JR_SS002_Sub1210Same State 2931260.0029.510.000.0029.51
GACUGCGUUAUGAAGGAUAUCCGCGUCUGGACAUGAGGAUCACCCAUGUAUACUUGGAUCGUGCAGGAGAAGGUCAAGGGUGAUU
0.643.16618.24455.701654.042737.8789.37324.38536.940.474.06915.860.680.570.374.790.420.340.940.080.070.360.210.14-14.32-10.664.778.3913.1716.951.642.583.322.638.0026.99604.2123364.37117895025248.495.1813.2427.7613.812990.78524333189156.042215272125.8817.6531.7624.7185
82
5484853JR_SS002_Sub1213Same State 29313530.0030.0016.850.0076.85
GGCUGCGUUGUGAAGGAUAUCCGCGUCUGGACAUGAGGAUCACCCAUGUAUGCUUGGAUCGUGCCGGAGAAGGUCACGAAUGAUU
0.870.961.450.31135.991043.730.0522.99176.420.240.310.720.830.730.460.260.530.260.040.090.040.180.320.24-16.46-17.80-16.080.815.9714.080.141.012.380.730.721.5271.2118.66103.771.152.7410.812.072.054.571917282122.3520.0032.9424.7185
83
5484855JR_SS002_Sub1214Same State 29314130.0030.008.130.0068.13
GGCUGCGUUGUGAAGGAUAUCCGCGUCUGGACAUGAGGAUCACCCAUGUAUGCUUGGAUCAUGCCGGAGAAGGUCACGAAUGAUU
0.951.091.231.15101.04528.440.1815.7882.530.200.430.351.020.660.590.860.600.280.130.090.040.260.280.28-17.24-17.57-17.290.636.6214.300.101.032.230.441.231.1232.7023.3431.001.102.819.331.563.423.062017272123.5320.0031.7624.7185
84
548485777%, More Tesla, 10Same State 29317130.0030.007.520.0067.52
AUAUAUAUAAGGAAGGAUAUCUUAGAAAAAACAUGAGGAUCACCCAUGUAAAUAAAGAAUAAAUGGGAGAAGGUCCAUAUAUAUA
1.181.181.380.45542.33647.420.0564.3676.830.350.360.581.080.790.614.310.400.290.510.050.030.270.420.28-17.34-17.74-16.970.534.106.150.060.490.730.450.971.2129.5819.7342.511.071.632.071.572.643.35418162048.249.4118.8223.5385
85
5485065Designing denovo 24Same State 29314630.0030.0018.760.0078.76
AAAAUAUAAAGAGAGGAUAUCCAAAGAACCACAUGAGGAUCACCCAUGUAAAGAAAGAAUAAGUGGGAGAAGGCUCAAAUAAUAA
1.200.981.62228.651.301047.9133.710.19154.510.380.320.930.910.890.654.190.465.620.620.070.830.210.310.32-15.83-17.38-15.622.951.748.790.430.261.300.430.501.25133.4428.25163.971.541.293.651.541.653.504311181350.5912.9421.1815.2985
86
5485286Ex1: 609Exclusion 193-12730.000.006.850.0036.85
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCUGUAUUCAAUCCUCGGAUUGAAUACAGAGAAGGCACAUGGG
0.380.361.18590.06906.25649.75113.56174.41125.050.330.331.540.950.520.392.1810.930.540.422.100.100.710.350.34-15.64-15.20-13.3915.7011.2223.123.022.164.453.433.756.00161.01250.241523.8920.528.6685.6230.7242.50405.242713181636.4917.5724.3221.6274
87
5485334AJ 18Exclusion 293-13120.7416.0219.230.0055.99
AAGGUACGAGGAUAUACAUAGAUACAGACACAUGUGCAUGUACAUGAGGAUCACCCAUGUAGAAGGCGUAUAUA
0.580.860.900.231311.562562.770.04235.56460.290.240.570.430.960.690.490.470.580.200.080.100.040.260.260.20-16.83-14.03-15.220.749.159.660.131.641.740.682.582.6549.20805.79246.461.145.175.671.9713.2514.162812181637.8416.2224.3221.6274
88
5485456AJ 37Exclusion 293-13930.0030.0027.140.0087.14
AAGUAGGGAGGAUAUACAUAGAUACAGAUUCAUGUAGAACUACAUGAGGAUCACCCAUGUAGAAGGCCCUAAUA
0.850.861.000.364681.280.750.06749.600.120.150.370.421.140.740.751.160.750.300.180.120.050.240.250.29-17.44-14.77-17.230.488.401.570.081.340.250.281.260.6126.60384.3132.841.083.841.281.333.531.832912171639.1916.2222.9721.6274
89
5485677Moding Maslow Revisited (73) 29Exclusion 393-1420.0030.009.120.0039.12
AACAGUACAGGAUAUACAUGAGGAUCACCCAUGUGAGAAACCACUGGCGUACCAGAAAGUAGAAGGGUACUGGA
1.112.141.95195.582434.381397.4830.18375.63215.640.353.031.670.850.500.563.821.300.400.590.200.060.080.210.27-15.53-8.80-14.233.4814.4116.860.542.222.600.6313.142.73180.55150930.87662.991.719.2513.481.88508035.0015.342814201237.8418.9227.0316.2274
90
5485735JL Nando mod 8Same State 2931630.0024.9612.370.0067.34
AAAGAAAAACUAGAGGAUAUCCGAGUGGUAACAUGAGGAUCACCCAUGUGAUGAAAGGAACAUGAGGAGAAGGCUAGAAGAAAAA
0.930.730.700.100.360.450.040.150.180.120.280.201.010.810.920.070.200.540.030.080.220.040.190.61-16.68-17.60-16.730.211.421.040.090.580.420.121.260.8957.2922.7054.031.091.791.531.123.532.433910241245.8811.7628.2414.1285
91
5485829Ex2: 712Exclusion 293-19730.0030.0030.000.0090.00
GUGUACAGAGGAUAUAUAUGGGCAUGGAAACAUGCAACUUCACAUGAGGAUCACCCAUGUAGAAGGCUGUACAC
1.201.481.35269.511965.111536.1927.36199.53155.980.341.080.631.080.630.720.442.590.580.040.260.060.370.240.31-17.36-13.85-17.244.867.149.070.490.720.920.412.290.7828.86966.0632.511.642.062.511.519.852.182514191633.7818.9225.6821.6274
92
5485886Ex2: 722Exclusion 293-18230.0030.0025.790.0085.79
GUGUACAGAGGAUAUAUAUGAGCUAGGAAACUAGCAAACUCACAUGAGGAUCACCCAUGUAGAAGGCUGUACAC
1.101.301.44189.701766.862211.8920.95195.12244.260.290.610.651.250.740.722.404.223.740.270.470.410.260.280.32-17.50-14.80-17.343.644.139.080.400.461.000.331.020.7525.08374.8029.571.491.582.731.392.772.122714181536.4918.9224.3220.2774
93
5485988S1-(23.6);S2-(22.1) [87C]Exclusion 293-14415.0430.0016.630.0061.68
GUUGUGCGAGGAUAUAUGUGAGGUUUGCCUCAACAGGUAAUACAUGAGGAUCACCCAUGUAGAAGGCGCAUGAG
1.092.081.242573.903295.261705.04388.03496.78257.040.332.630.510.970.460.634.352.2310.680.660.341.610.210.170.29-16.49-11.11-15.925.6068.4511.710.8410.321.770.577.361.4968.9114983.83121.952.3230329.375.851.771575.874.452112231828.3816.2231.0824.3274
94
5486163Ex2: 735Exclusion 293-12460.0030.0029.000.0059.00
GUGUACAGAGGAUAUAUAUGAGCUAGGAAACUAGCAAGAUCACAUGAGGAUCACCCAUGUAGAAGGCUGUACAC
1.153.731.54120.23626743.962657.797.6739959.74169.450.365.040.811.010.680.641.456.551.760.090.420.110.200.300.24-15.98-10.55-15.362.089.029.060.130.580.580.466.841.24114.4526115.31214.001.141.781.781.58932.683.462713191536.4917.5725.6820.2774
95
5486165Ex2: 736Exclusion 293-1970.0030.0025.010.0055.01
GUGUACAGAGGAUAUAUAUGAGCAUGGAAACAUGCAAGAUCACAUGAGGAUCACCCAUGUAGAAGGCUGUACAC
1.362.311.83981.512798.22963.0199.66284.1297.780.463.090.971.010.650.620.275.120.240.030.520.020.210.230.23-15.98-11.40-15.542.328.736.700.240.890.680.525.661.12114.7811157.02177.461.272.431.971.68287.543.072713191536.4917.5725.6820.2774
96
5486373May-98Exclusion 493-16926.1630.009.130.0065.29
AUCUUGUCAGGAUAUCGUACAAUAUGGAAAACAUAGAGGUACGAGAAGGGACAUGAGGAUCACCCAUGUAAAAC
1.281.311.840.44828.62849.530.0599.75102.270.370.510.780.960.610.590.262.590.330.030.310.040.200.190.23-16.97-15.39-16.700.594.328.170.070.520.980.381.340.9142.63206.2756.131.071.682.671.463.812.482912181539.1916.2224.3220.2774
97
5486433Ex3: 806Exclusion 393-115828.9230.0024.570.0083.49
CAGUACUGAGGAUAUACAUGAGGAUCACCCAUGUGAAAAAGCUACGAAAGUAGCAAAUGUAGAAGGCAGUACUG
1.161.271.434.753100.921794.330.38246.70142.750.310.700.671.160.770.760.333.140.390.030.250.030.240.280.32-17.23-14.63-17.070.555.746.730.040.460.540.331.170.8032.84444.9638.631.041.581.711.403.232.232912191439.1916.2225.6818.9274
98
5486478Ex3: 818Exclusion 393-14716.2930.0030.710.0077.00
CAGUACUGAGGAUAUACAUGAGGAUCACCCAUGUAUCCUAGCUAGGAAACUAGCAAAUGUAGAAGGCAGUACUG
1.221461.161.37302.663451.97249.4944.15503.5236.390.222161.410.491.060.470.670.364.100.260.050.600.040.310.100.26-16.613.30-16.254.459.6912.260.651.411.790.687.090.8261.3427229125123.3787.471.914.115.981.981199.842.262614181635.1418.9224.3221.6274
99
5486480Ex3: 819Exclusion 393-15630.0030.0027.990.0087.99
CAGUACUGAGGAUAUACAUGAGGAUCACCCAUGUAUCCUAGCUAGGAAACUAGCAAAAGUAGAAGGCAGUACUG
1.161.301.334.20320.672757.900.5642.85368.540.350.550.471.130.730.770.380.460.430.050.060.060.330.180.36-17.95-15.10-17.920.853.799.090.110.511.210.401.080.5715.96277.7216.561.121.663.371.482.941.762714181536.4918.9224.3220.2774
100
5486484Ex3: 821Exclusion 393-18329.0430.0033.440.0092.47
CAGUACUGAGGAUAUACAUGAGGAUCACCCAUGUAUCCAAGCUAGGAAACUAGCAAAUGUAGAAGGCAGUACUG
1.271.671.434.093528.841248.790.45387.34137.070.391.520.641.110.650.750.777.153.090.080.780.340.280.290.30-17.24-13.26-17.060.568.015.620.060.880.620.502.690.7632.721751.3839.041.062.411.851.6514.792.152714181536.4918.9224.3220.2774
Loading...
Main menu