MS2 88 and 93
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQ
1
ID
Submission
Puzzle_Name
FilterEternaNumber
Switch_Direction
NumberOfClusters
Baseline_Subscore
Folding_Subscore
Switch_Subscore
Eterna_Score
Sequence
KDOFFKDON
FoldChange
FoldChange_err_factor
ddGddG_err
fmaxnoFMN
fmaxFMN
fmaxmiR
fmaxnoFMN_std
fmaxFMN_std
fmaxmiR_std
fmaxnoFMN_sem
fmaxFMN_sem
fmaxmiR_sem
dGnoFMN
dGFMNdGmiR
dGnoFMN_std
dGFMN_std
dGmiR_std
dGnoFMN_sem
dGFMN_sem
dGmiR_sem
KDnoFMN
KDFMNKDmiR
KDnoFMN_sem_factor
KDFMN_sem_factor
KDmiR_sem_factor
foldChange_FMN_miR
foldChange_noFMN_FMN
foldChange_noFMN_miR
AsCsGsUsA_percC_percG_percU_perc
Sequence_Length
Free_E
Free_E_E
Structure
Structure_2
AUGCGUAUpctGCpctGUpctAU_2GC_2GU_2
AUpct_2
GCpct_2
GUpct_2
2
4740738
Power strip
Exclusion 1
88-134926.230965.2
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCUGUAUCCAAAAGGAAGUGUAGGAUCAGAGAAGGCACUAGGA
83.7640.132.091.05-0.740.050.930.941.0438.397.654.332.050.410.23-17.03-16.3-16.950.640.640.560.030.030.0340.1383.7643.691.031.031.030.522.091.093011201340.514.92717.674-14.52-12.72
.....(((((.((....)))))))..(((((....))))).......(((((.............)))))....
..................((..(((......((((.((((.............)))))))).....)))..)).
88147.0647.065.8858038.4661.540.00
3
4747752
Disincluded (MS2 Riboswitches - States energetically close)
Exclusion 1
88-122730305.165.1
AAAAAACAUGAGGAUCACCCAUGUAAGGAUAUGACUUAAAUAAAGAAAGAAGAAAUAGUCAGAAGGUACAAAUA
30.9920.41.521.04-0.420.041.291.11.154.432.2226.740.290.151.77-17.71-17.29-17.460.40.390.590.030.030.0420.430.9926.021.031.031.040.841.521.28398141352.710.818.917.674-9.25-7.05
.....(((((.((....))))))).......(((((....................))))).............
...........((.....)).((((......(((((....................))))).....))))....
66050.0050.000.0065054.5545.450.00
4
4749394
Exclusion 1.1
Exclusion 1
88-13473030060
GUGGAACAUGAGGAUCACCCAUGUGAGGAUAUAGGUUUUUGGGAAAAACUAGGAGAAACUAGAAGGCGCAAGAA
21.9926.240.841.040.180.041.141.071.2114.541.351.370.780.070.07-17.46-17.63-17.670.460.560.540.020.030.0326.2421.9921.211.031.031.030.960.840.81289231437.812.231.118.974-14.7-12.7
(((..(((((.((....))))))).......(((.(((((((......)))))))...))).....))).....
((((..(....)..))))...((((......(((.(((((((......)))))))...))).....))))....
78535.0040.0025.0067631.5836.8431.58
5
4749537
Exclusion 1.2
Exclusion 1
88-143730301.461.4
AAGUAACAUGAGGAUCACCCAUGUGAGGAUAUGAUUUAAGUUGUAAAAGUAAUAAAGGUCAGAAGGUAUGUGAA
34.6730.951.121.03-0.110.031.291.091.1418.472.4212.20.880.120.58-17.29-17.18-17.160.380.480.480.020.020.0230.9534.6735.421.021.021.021.021.121.14306191940.58.125.725.774-9.4-7.2
.....(((((.((....))))))).......((((((..((((......))))..)))))).............
...................((((((......((((((..((((......))))..)))))).....))))))..
85447.0629.4123.5372743.7512.5043.75
6
4749578
Exclusion 1.3
Exclusion 1
88-12423030262
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGAUGAAAGAUUGAAAAAGGUUGAAAGUCAGAAGGUAUGUGAA
35.7330.421.171.05-0.160.041.211.021.19.034.90.770.580.310.05-17.31-17.15-17.120.430.540.520.030.030.0330.4235.7336.561.031.041.031.021.171.2336201544.68.12720.374-9.9-7.7
.....(((((.((....))))))).......((((....((((......))))....)))).............
...................((((((......((((....((((......))))....)))).....))))))..
65440.0033.3326.6752735.7114.2950.00
7
4750370
Exclusion 1
Exclusion 1
88-15863030363
ACAAGACAUGAGGAUCACCCAUGUGAGGAUAUGCUCGGAUGACAUGACGUUAGCUAACGCAGAAGGCACAAUAA
36.6928.721.281.03-0.250.031.151.051.1252.94.6521.592.190.190.89-17.37-17.12-17.160.450.490.50.020.020.0228.7236.6935.151.021.021.020.961.281.222715191336.520.325.717.674-12.9-10.4
.....(((((.((....))))))).......((((..((((......)))).((....))....))))......
...........((.....)).((((......((((..(.((((.....)))).)..).))).....))))....
59329.4152.9417.6568140.0053.336.67
8
4751635
DR Excl. 1
Exclusion 1
88-1124.7303.357.9
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUUCGAAAAAAAAAAAAAAAAAAAAAAAGGAGAAGGGACGAAAA
56.7643.411.31-0.271.491.510.98-16.95-16.68-16.9643.4156.7643.190.761.310.9945814760.810.818.99.574-5.7-3.56
.....(((((.((....)))))))..................................................
.......(((.((....)))))(((......(((........................))).....))).....
34042.8657.140.0046136.3654.559.09
9
4752150
exclusion1-cac1
Exclusion 1
88-1224.90024.9
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUCAUAAAAAAAAAAAAAAAAAAAAAAGUGAGAAGGGACAAAAA
32.6642.940.761.860.270.62-0.640.570.761.630.0401.150.030-16.96-17.24-15.940.460.741.410.330.52142.9432.66119.731.391.692.713.670.762.7946812862.210.816.210.874-5.7-5.55
.....(((((.((....)))))))..................................................
...........((.....)).((((......((((......................)))).....))))....
34042.8657.140.0045140.0050.0010.00
10
4752235
exclusion1-cac2
Exclusion 1
88-164.320.6125.9
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUCGUAAAAAAAAAAAAAAAAAAAAAUGCGAGAAGGGACUGGAA
94.4886.921.091.41-0.080.340.580.881.332.370.410.580.970.170.24-16.26-16.17-16.770.620.570.930.250.230.3886.9294.4851.881.291.261.460.551.090.641915955.412.220.312.274-11.05-9.45
.....(((((.((....)))))))(((..(.(((((....................)))))....)..)))...
..................(((.(((......(((((....................))))).....))))))..
68237.5050.0012.5046136.3654.559.09
11
4752416
exclusion1-cac3
Exclusion 1
88-1616.530046.5
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUCGUUGAAAAAAAAAAAAAAAAAAAAGCGAGAAGGGACACGAA
41.7960.710.691.450.370.3710.690.830.440.340.280.180.140.12-16.62-16.99-16.910.270.860.570.110.350.2360.7141.7945.151.121.421.261.080.690.74411015855.413.520.310.874-8.35-8.25
.....(((((.((....))))))).......(((((....................))))).............
...........((.....)).((((......(((((....................))))).....))))....
56141.6750.008.3346136.3654.559.09
12
4755700
Simple 1
Exclusion 1
88-1616.7300.146.8
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUACGAUAAAAAAAAAAAAAAAAAAAAUGUAGAAGGGACAAAAA
60.860.31.011.33-0.010.290.721.161.071.231.282.250.50.520.92-16.62-16.62-16.750.630.310.690.260.130.2860.360.852.91.291.131.320.871.010.8845812960.810.816.212.274-5.7-3.85
.....(((((.((....)))))))..................................................
...........((.....)).((((......((((......................)))).....))))....
34042.8657.140.0045140.0050.0010.00
13
4756677
Disincluded 2 (MS2 Riboswitches)
Exclusion 1
88-127030307.167.1
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGACGUAAAUAAAGAAAGAAGAAAUCGUCAGAAGGCACACCUA
45.7425.661.781.04-0.580.041.321.031.1919.218.184.251.170.50.26-17.48-16.9-17.310.40.550.540.020.030.0325.6645.7430.381.021.031.030.661.781.183512161147.316.221.614.974-11.65-9.25
.....(((((.((....))))))).......(((((....................)))))..(((....))).
...........((.....)).((((......(((((....................))))).....))))....
69040.0060.000.0047036.3663.640.00
14
4759257
Exclusion I
Exclusion 1
88-1213623.7309.963.6
UUGGGACAUGAGGAUCACCCAUGUAAGGAUAUUGGCGCGCCGGCUCUGUCUGUUCCGCCGAGAAGGUACACGUU
102.3645.532.251.03-0.810.021.090.711.05172.293.9430.883.730.090.67-16.9-16.09-16.550.51.030.670.010.020.0145.53102.3664.731.011.021.010.632.251.421518231820.324.331.124.374-16.5-16.3
.....(((((.((....))))))).......((((((.((.(((...))).))..)))))).............
.((((...((.....)))))).(((......((((((.((.(((...))).))..)))))).....))).....
411322.2261.1116.67512325.0060.0015.00
15
4760098
Disincluded 3 (MS2 Riboswitches)
Exclusion 1
88-1232303010.170.1
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGAUGCGAAUAAAGAAAGAAGAAAGCAUCAGAAGGCACACCUA
59.8626.252.281.05-0.820.051.20.991.067.0348.081.410.463.160.09-17.46-16.63-17.370.440.560.450.030.040.0326.2559.8628.561.031.041.030.482.281.093512171047.316.22313.574-14.47-12.07
.....(((((.((....))))))).......((((((..................))))))..(((....))).
...........((.....)).((((......((((((..................)))))).....))))....
79043.7556.250.0057041.6758.330.00
16
4765253
Meechl MS2 Ex1
Exclusion 1
88-12128.2305.964.1
AGAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCAAAUAUAUACGAAAGAUUAUAAAAGCAGAAGGCACAAAAG
57.7335.81.611.54-0.480.431.10.710.883.763.389.230.820.742.02-17.15-16.67-16.690.691.860.680.150.410.1535.857.7356.691.161.51.160.981.611.583610161248.613.521.616.274-11-10.3
.....(((((.((....))))))).......(((...((((..(....)..))))...))).............
...........((.....)).((((......(((...((((..(....)..))))...))).....))))....
87053.3346.670.0077050.0050.000.00
17
4774794Ex 1
Exclusion 1
88-14230300.960.9
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCGGAAAAGGAAAAAAAAAAAAGAAGACGAGAAGGCACAAAGA
28.5926.641.071.15-0.070.140.960.730.8313.310.610.952.050.090.15-17.44-17.37-17.320.690.570.640.110.090.126.6428.59301.111.091.11.051.071.1341918655.412.224.38.174-6.66-5.96
.....(((((.((....))))))).......(((........................))).............
...........((.....)).((((......(((........................))).....))))....
46040.0060.000.0036033.3366.670.00
18
4774869Ex 1 2
Exclusion 1
88-1427.230057.2
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCUGAAAAAAAAAAAAAAAAAAGAAAAAGAGAAGGCGCAAAGA
35.0637.980.921.330.080.2850.830.938.060.410.54.030.210.25-17.09-17.17-16.650.540.170.50.270.080.2537.9835.0658.651.311.091.291.670.921.5444815759.510.820.39.574-6.3-4.26
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0035133.3355.5611.11
19
4775771
Exclusion 1 - G s
Exclusion 1
88-16430301.861.8
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCGAGAAGAAGAAGAAGAAGAAGAGAACGAGAAGGCACAAAAA
29.9525.781.161.09-0.150.081.510.981.143.422.340.960.430.290.12-17.47-17.32-17.410.380.560.510.050.070.0625.7829.9527.611.051.071.070.921.161.0739920652.712.2278.174-6.3-4.66
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0036033.3366.670.00
20
4777845
Fiskers Exclusion D1
Exclusion 1
88-11593030060
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCGAAAAGUUAAAGAAAAAGACGAAAAUGAGAAGGCGCAAAAA
23.9426.330.911.050.10.051.211.081.137.476.165.580.590.490.44-17.45-17.55-17.450.460.450.530.040.040.0426.3323.9426.441.041.041.041.10.91139917952.712.22312.274-6.3-4.7
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((....(((.........))).....))).....))))....
34042.8657.140.0036325.0050.0025.00
21
4778275
Fiskers Exclusion D3
Exclusion 1
88-114112.830042.8
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCCAAAAGUUAAAGAAAAAGACGAAAAGGAGAAGGCGCAAAAA
40.768.670.591.070.520.071.291.041.0921.161.921.011.780.160.09-16.49-17.02-16.620.480.690.630.040.060.0568.6740.760.531.041.061.051.490.590.88391017852.713.52310.874-8.4-7.3
.....(((((.((....))))))).......(((....(((.........))).....))).............
...........((.....)).((((......(((....(((.........))).....))).....))))....
57138.4653.857.6937225.0058.3316.67
22
4778339
Ex1_Neo
Exclusion 1
88-15343030060
AACAAACAUGAGGAUCACCCAUGUGAGGAUAUCGGAUGUACAGCGCAAUUAGAAUUAACGAGAAGGCACACUUA
22.6422.6811.0300.031.231.081.12238.9910.949.1410.340.470.4-17.6-17.6-17.740.530.550.50.020.020.0222.6822.6419.661.021.021.020.8710.872914171439.218.92318.974-8.12-5.66
..(..(((((.((....)))))))..)......(..(((....((.............)).....)))..)...
...........((.....)).((((......(((........................))).....))))....
49128.5764.297.1436033.3366.670.00
23
4778844
Default title
Exclusion 1
88-13423030060
AUAUAACAUGAGGAUCACCCAUGUCAGGAUAUCGAACCCAACACAACCAAAAUGUCGGCGAGAAGGGACAAAAA
22.6127.510.821.040.20.041.131.021.18.065.6568.020.440.313.68-17.41-17.6-17.650.50.530.550.030.030.0327.5122.6121.541.031.031.030.950.820.783217151043.22320.313.574-9.9-8.3
.....(((((.((....)))))))............(((..(.(..((........)).).)..))).......
...........((.....)).((((......(((...((.(((.........))).))))).....))))....
311021.4378.570.0059035.7164.290.00
24
4779144
Ex1Try2_Neo
Exclusion 1
88-1160522.33013.365.5
UAGAUACAUGAGGAUCACCCAUGUGAGGAUAUCGUUUGUACUAAUCUUUUAGUAUUUUCGAGAAGGCACAUAUA
143.2448.532.951.03-1.080.031.030.911.0623.572.958.010.590.070.2-16.84-15.76-16.840.580.920.620.010.020.0248.53143.2448.351.011.021.020.342.9512311152531.114.920.333.874-16.2-15
....((((((.((....))))))))......(((...(((((((....)))))))...))).............
..(((........)))....(((((......(((...(((((((....)))))))...))).....)))))...
97250.0038.8911.11116161.1133.335.56
25
4779798
Meechl MS2 Ex1 2
Exclusion 1
88-126725.63010.766.3
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCAAAUAAAGGCACAUGAGAAGGCAUAUGAGAAGGCACAUGAA
99.3441.42.41.09-0.880.090.710.750.9236.713.8917.842.250.851.09-17-16.12-16.460.891.120.90.050.070.0641.499.3470.941.061.071.060.712.41.713411181145.914.924.314.974-8.8-8.3
.....(((((.((....)))))))....................((((.(....(......)....).))))..
...................((((((......(((.......((.(.......)))...))).....))))))..
58038.4661.540.0057041.6758.330.00
26
4779928
JR_Exclusion1_Sub4
Exclusion 1
88-124424.7301.656.2
AAAGAACAUGAGGAUCACCCAUGUGAGGAUAUACGAGCGUGAGAAAGAUAAAACGAGCGUAGAAGGCACAAGAA
49.2843.41.141.05-0.130.051.070.951.075.662.417.620.360.150.49-16.95-16.83-17.030.580.480.540.040.030.0343.449.2840.221.041.031.040.821.140.93331121944.614.928.412.274-13.4-12.7
.....(((((.((....))))))).......((((..(((............)))..)))).............
...........((.....)).((((......((((..(((............)))..)))).....))))....
68042.8657.140.0058038.4661.540.00
27
4779950
JR_Exclusion1_Sub5
Exclusion 1
88-134624.7303.558.2
UGUGAACAUGAGGAUCACCCAUGUGAGGAUAUACGAGCGUGAGAAAGAUAAAACGAGCGUAGAAGGCACAAGAA
57.5343.291.331.04-0.280.041.1711.1414.026.362.990.750.340.16-16.96-16.67-17.070.540.60.540.030.030.0343.2957.5338.531.031.031.030.671.330.893011221140.514.929.714.974-16.5-14.1
((((.(((((.((....))))))).......((((..(((............)))..)))).....))))....
.((((.(.....).))))...((((......((((..(((............)))..)))).....))))....
810044.4455.560.0079043.7556.250.00
28
4780001
JR_Exclusion1_Sub6
Exclusion 1
88-115928.730058.7
CGCAAACAUGAGGAUCACCCAUGUGAGGAUAUGUGAGCACGAGAAAGAUAAAGUGAGCACAGAAGGCACAAGCG
27.3334.840.781.070.240.061.010.981.164.561.1325.690.360.092.04-17.17-17.42-17.410.610.530.590.050.040.0534.8427.3327.491.051.041.051.010.780.79291422939.218.929.712.274-17.5-16.6
(((..(((((.((....))))))).......((((..(((............)))..))))..........)))
(((........((.....)).((((......((((..(((............)))..)))).....)))).)))
611035.2964.710.00511031.2568.750.00
29
4783355
Brourd - Exclusion 1 - Sub 1
Exclusion 1
88-17228.1306.864.9
AAAAAACAUGAGGAUCACCCAUGUAAGGAUAUCGUGCAGAAAAAAAAAAAAAACUGCACGAGAAGGUACAAGGA
62.6836.051.741.16-0.550.150.790.830.952.780.750.890.330.090.1-17.14-16.59-16.790.740.990.770.090.120.0936.0562.6851.091.091.121.10.821.741.42381116951.414.921.612.274-17.84-17.84
.....(((((.((....))))))).......((((((((..............)))))))).............
..................((.((((......((((((((..............)))))))).....)))).)).
69040.0060.000.0068042.8657.140.00
30
4783357
Brourd - Exclusion 1 - Sub 2
Exclusion 1
88-17030305.365.3
AAAAAACAUGAGGAUCACCCAUGUUAGGAUAUCGUGCAGAAAAAAAAAAAAAACUGCACGAGAAGGAACAAGGA
44.929.131.541.11-0.430.110.910.790.865.640.483.430.670.060.41-17.35-16.92-16.930.470.750.520.060.090.0629.1344.944.51.061.091.060.991.541.53381116951.414.921.612.274-18.74-17.44
....((((((.((....))))))))......((((((((..............)))))))).............
..................((.((((......((((((((..............)))))))).....)))).)).
79043.7556.250.0068042.8657.140.00
31
4783366
Brourd - Exclusion 1 - Sub 3
Exclusion 1
88-111924.821.18.854.7
AAAAAACAUGAGGAUCACCCAUGUAAGGAUAUCGUGCAGAAAAAAAAAAAAAACUGCACGAGAAGGUACUUGGA
87.9143.082.041.12-0.710.110.580.720.914.861.481.941.360.140.18-16.96-16.25-16.790.970.770.710.090.070.0643.0887.9151.151.091.071.070.582.041.193611161148.614.921.614.974-17.84-17.84
.....(((((.((....))))))).......((((((((..............)))))))).............
..................(((.(((......((((((((..............)))))))).....))).))).
69040.0060.000.0068042.8657.140.00
32
4784982
Mystem Exclusion 1
Exclusion 1
88-110722.9301.554.4
AAUAAACAUGAGGAUCACCCAUGUCAGGAUAUCCUAAAUAAAAAAAUAUAAAGAAGAAGGAGAAGGGACUAAAA
53.4647.221.131.08-0.120.081.190.891.035.413.5728.760.520.352.78-16.87-16.74-16.520.490.630.750.050.060.0747.2253.4666.861.051.061.081.251.131.42399141252.712.218.916.274-8-6.45
.....(((((.((....))))))).(((....))).......................................
.......(((.((....)))))(((......((((......................)))).....))).....
46040.0060.000.0057041.6758.330.00
33
4795119
Gess I got it^^
Exclusion 1
88-1128.5302.160.6
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUAGGAAAAAAAAAAAAAAAAAAAAAAACUAGAAGGCACAAAAA
41.7435.221.19-0.171.420.742.62-17.16-16.99-17.0935.2241.7438.020.911.191.0847812763.510.816.29.574-6.3-4.56
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0045044.4455.560.00
34
4799136
Starryjess mod
Exclusion 1
88-11303030060
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUCUGGAGAAACGGAAAGAAAAAGAAACGGAGAAGGGACAUAAA
28.4629.640.961.070.040.061.070.920.9725.80.772.242.260.070.2-17.33-17.37-17.490.550.490.560.050.040.0529.6428.4625.321.051.041.050.890.960.8537101985013.525.710.874-9.2-7.65
.....(((((.((....))))))).......((((......)))).............................
....................(((((......((((......................)))).....)))))...
46136.3654.559.0944144.4444.4411.11
35
4800175
Jean Baudrillard
Exclusion 1
88-111030030
ACAUGACAUGAGGAUCACCCAUGUGAGGAUAUGCGAAAAAAAAAAAAAAAAAAAAUUGGCAGAAGGCACAAAAU
153.21201.980.761.560.280.440.760.590.751.360.240.370.410.070.11-15.42-15.69-15.440.761.260.940.230.380.28201.98153.21196.611.261.461.331.280.760.973910151052.713.520.313.574-9.1-6.77
...(.(((((.((....))))))).).............................(((((.....)).)))...
...........((.....)).((((......(((.((..................)).))).....))))....
67046.1553.850.0056045.4554.550.00
36
4800189
George Ritzer.
Exclusion 1
88-13523.3301.334.6
ACAUGACAUGAGGAUCACCCAUGUGAGGAUAUGCGAAAAAAAUUUUUAAAAAAAAUUGGCAGAAGGCACAAAAU
99.1188.951.111.05-0.110.051.030.961.111.922.050.920.640.110.05-16.24-16.13-16.230.570.680.690.030.040.0488.9599.1189.671.031.041.040.91.111.013410151545.913.520.320.374-9.1-6.8
...(.(((((.((....))))))).).............................(((((.....)).)))...
...........((.....)).((((......(((......((((((.....)))))).))).....))))....
67046.1553.850.0096060.0040.000.00
37
4809436e1
Exclusion 1
88-118630302.662.6
AACAAACAUGAGGAUCACCCAUGUCAGGAUAUCGAAACAACAAACAACAAACAACAAACGAGAAGGGACAACAA
23.7719.191.241.07-0.210.071.191.111.069.935.717.620.730.420.56-17.77-17.55-17.790.520.750.710.040.050.0519.1923.7718.821.041.061.050.791.240.98391712652.72316.28.174-6-4.96
..(..(((((.((....)))))))..)...............................................
...........((.....)).((((......(((........................))).....))))....
35037.5062.500.0036033.3366.670.00
38
4809438e1-2
Exclusion 1
88-12303030060
AACAAACAUGAGGAUCACCCAUGUGAGGAUAUCGAAACAACAAACAACAAACAACAAACGAGAAGGCGCAACAA
17.3218.810.921.050.080.051.0411.0728.732.627.651.890.170.5-17.79-17.87-17.850.570.550.610.040.040.0418.8117.3217.761.041.041.041.030.920.94381713651.42317.68.174-6.6-4.26
..(..(((((.((....)))))))..)...............................................
...........((.....)).((((......(((........................))).....))))....
35037.5062.500.0026122.2266.6711.11
39
4809440e1-3
Exclusion 1
88-114130302.862.8
AACAAACAUGAGGAUCACCCAUGUCAGGAUAUGCAAACAACAAACAACAAACAACAAAGCAGAAGGGACAACAA
25.0919.941.261.05-0.230.051.271.161.219.313.447.051.630.290.59-17.73-17.5-17.890.420.470.470.040.040.0419.9425.0916.941.041.041.040.681.260.85391712652.72316.28.174-6.16-6.06
..(..(((((.((....)))))))..)....(((........................))).............
...........((.....)).((((......(((........................))).....))))....
47036.3663.640.0036033.3366.670.00
40
4811233
Sh dynasty
Exclusion 1
88-1133030161
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCAAAAAAAAAAAAAAAAAUAAAAAAGCAGAAGGCACAAAAA
33.2230.621.091.33-0.080.290.781.171.111.421.120.490.390.310.14-17.3-17.22-16.940.810.640.460.220.180.1330.6233.2244.041.251.191.141.331.091.4446912762.212.216.29.574-7.4-5.76
.....(((((.((....)))))))..................................((.....)).......
...........((.....)).((((......(((........................))).....))))....
36033.3366.670.0036033.3366.670.00
41
4811348
Erbelaed
Exclusion 1
88-145323.130053.1
AGAAAACAUGAGGAUCACCCAUGUGAGGAUAUCGAUGUCCAAAAAAAAGUGCGGGACUCGAGAAGGCACUUGGA
32.4946.620.71.040.360.040.860.911.0920.18.0362.180.940.382.92-16.88-17.24-17.560.680.580.480.030.030.0246.6232.4923.731.031.031.020.730.70.512813211237.817.628.416.274-17.02-16.42
.....(((((.((....)))))))..(((((....)))))......((((((.............))))))...
..................(((.(((......((((.((((.............)))))))).....))).))).
89144.4450.005.5659035.7164.290.00
42
4811857Atanri
Exclusion 1
88-151624.73012.767.4
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGUAUAUCCCUAAAAAAGUGUGGGACUACAGAAGGCACUUGGA
122.1543.342.821.06-1.040.060.710.770.9924.915.165.271.10.230.23-16.95-15.92-16.790.721.060.570.030.050.0243.34122.1551.091.031.051.030.422.821.182912181539.216.224.320.374-14.4-14.4
..................(((.(((......((((..((((...........)))).)))).....))).))).
..................(((.(((......((((..((((...........)))).)))).....))).))).
68042.8657.140.0068042.8657.140.00
43
4812947
Seclusion
Exclusion 1
88-15930306.566.5
AAAAGACAUGAGGAUCACCCAUGUUAGGAUAUCGUGCAGAAAAAAAAAAAAAACUGCACGAGAAGGAACAAGGA
51.9430.51.71.11-0.530.111.040.830.9714.990.560.61.950.070.08-17.31-16.77-16.850.560.590.540.070.080.0730.551.9448.121.081.081.070.931.71.5837111795014.92312.274-19.14-17.44
....((((((.((....))))))))......((((((((..............)))))))).............
..................((.((((......((((((((..............)))))))).....)))).)).
69137.5056.256.2568042.8657.140.00
44
4813057
Tweaking Brourd
Exclusion 1
88-137929.5305.264.7
AAAACACAUGAGGAUCACCCAUGUGAGGAUAUCGUGCAGUAGACGAAAGUCUACUGCACGAGAAGGCACAAGGA
50.2432.981.521.05-0.420.041.051.011.09610.272.122.4231.350.110.12-17.23-16.81-17.210.550.660.610.030.030.0332.9850.2433.451.031.031.030.671.521.012815201137.820.32714.974-36.6-34.9
....((((((.((....))))))))......(((((((((((((....))))))))))))).............
..................((.((((......(((((((((((((....))))))))))))).....)))).)).
912042.8657.140.00811042.1157.890.00
45
4813762EXCL-I
Exclusion 1
88-16223.830356.8
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCCUGGUUGAAAAAAAAAAAACAACCAGGAGAAGGCACAAAAA
57.7645.171.281.1-0.250.090.890.820.928.41.651.161.070.210.15-16.91-16.67-16.850.550.480.630.070.060.0845.1757.7648.271.071.061.080.841.281.07381215951.416.220.312.274-19.7-19
.....(((((.((....))))))).......(((((((((............))))))))).............
...........((.....)).((((......(((((((((............))))))))).....))))....
79043.7556.250.0069040.0060.000.00
46
4813786EXCLS-II
Exclusion 1
88-1122.703.826.5
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCCUAAAAAAAAAAAAAAAAAAAAAAAGGAGAAGGCACAUAAA
64.8547.581.36-0.310.20.380.54-16.86-16.55-16.147.5864.85101.371.561.362.1345912860.812.216.210.874-8.4-7.35
.....(((((.((....))))))).(((....))).......................................
....................(((((......((((......................)))).....)))))...
46040.0060.000.0054055.5644.440.00
47
4819253
Meechl MS2 Ex1
Exclusion 1
88-120130302.162.1
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUUAAAAAUAAGAAGGCAUAAAAAAAAAUAAGAAGGCACAUGAA
33.1927.941.191.07-0.170.070.970.881.0293.475.811.416.590.410.1-17.39-17.22-17.470.50.780.590.040.060.0427.9433.1925.811.041.061.040.781.190.92418141155.410.818.914.974-6.3-4.46
.....(((((.((....)))))))..................................................
...................((((((......(((........................))).....))))))..
34042.8657.140.0063066.6733.330.00
48
4820896
Inspired by Nando
Exclusion 1
88-110630301.161.1
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCGAAAAGUCAAAGAAAAAGACGAAAACGAGAAGGCGCAAAAA
25.9823.751.091.07-0.090.071.191.081.198.524.7132.80.830.463.19-17.56-17.47-17.360.450.520.520.040.050.0523.7525.9828.881.041.051.051.111.091.22391117752.714.9239.574-9.6-8.5
.....(((((.((....))))))).......(((....(((.........))).....))).............
...........((.....)).((((......(((....(((.........))).....))).....))))....
58038.4661.540.0038125.0066.678.33
49
4821761
4 GC Strong
Exclusion 1
88-113019.37.857.1
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCAAAAAAAAAAAAAAAAAAAAAAAAGCAGAAGGCGCAAAAA
38.8820.591.89-0.640.560.590.43-17.7-17.06-17.3720.5938.8828.50.731.891.3846913662.212.217.68.174-7.4-5.36
.....(((((.((....)))))))..................................((.....)).......
...........((.....)).((((......(((........................))).....))))....
36033.3366.670.0026122.2266.6711.11
50
4822700
Exclusive 1
Exclusion 1
88-11893030060
AACAAACAUGAGGAUCACCCAUGUAAGGAUAUACGAAACAAACAAACAAACAAACAAAGUAGAAGGUACAGGAA
16.3417.260.951.060.060.061.240.981.0567.3322.897.374.91.670.54-17.87-17.93-17.960.560.550.790.040.040.0617.2616.3415.861.041.041.060.970.950.92401313854.117.617.610.874-6.3-4.56
.....(((((.((....)))))))..................................................
..................((.((((......(((........................))).....))))))..
34042.8657.140.0054055.5644.440.00
51
4828732
Mat - Mod of Eli
Exclusion 1
88-110714.630044.6
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCCAAAAGUUAAAUAAAAAGACGAAAAGGAGAAGGCGCAAAAA
39.4164.890.611.070.50.071.41.041.078.863.181.430.860.310.14-16.55-17.05-16.570.510.470.560.050.050.0564.8939.4163.461.051.051.061.610.610.98391016952.713.521.612.274-8.4-7.3
.....(((((.((....))))))).......(((....(((.........))).....))).............
...........((.....)).((((......(((....(((.........))).....))).....))))....
57138.4653.857.6937225.0058.3316.67
52
4828749
Mat - Mod of Nando
Exclusion 1
88-12373030565
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGACUUAAAUAAAGAAAGAAGAAAUAGUCAGAAGGCACAAAUA
42.9428.581.51.05-0.410.051.281.11.181754.572.858.14113.970.180.53-17.37-16.96-17.290.410.60.470.030.040.0328.5842.9430.981.031.041.030.721.51.08389151251.412.220.316.274-9.25-8.55
.....(((((.((....))))))).......(((((....................))))).............
...........((.....)).((((......(((((....................))))).....))))....
66050.0050.000.0056045.4554.550.00
53
4828765
Mat - Mod of Eli 2
Exclusion 1
88-17030305.465.4
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCGAAAAGUCAAAGAAAAAGACGAAAACGAGAAGGCACAAAAA
43.5728.091.551.1-0.440.091.351.231.234.71.111.970.560.130.24-17.39-16.95-17.420.550.550.430.070.070.0528.0943.5727.181.071.071.050.621.550.97401116754.114.921.69.574-9.6-8.9
.....(((((.((....))))))).......(((....(((.........))).....))).............
...........((.....)).((((......(((....(((.........))).....))).....))))....
58038.4661.540.0048033.3366.670.00
54
4829537
4736266_48166_1
Exclusion 1
88-139300030
GAUCCACAUGAGGAUCACCCAUGUGAGGAUAUCGUGCAGAAAAAAAAAAAAAACUGCACGAGAAGGCACAUGGG
13.0119.350.671.560.40.450.220.150.241.690.190.190.270.030.03-17.76-18.16-17.712.041.912.050.330.310.3319.3513.0120.41.391.361.391.570.671.053114191041.918.925.713.574-32.54-32.54
(((((......))))).((((((((......((((((((..............)))))))).....))))))))
(((((......))))).((((((((......((((((((..............)))))))).....))))))))
813038.1061.900.00813038.1061.900.00
55
4829693
4736266_48166_2
Exclusion 1
88-19228.512.2040.7
AAUCCACAUGAGGAUCACCCAUGUGAGGAUAUCGUGCAGAAAAAAAAAAAAAACUGCACGAGAAGGCACAUGGA
20.235.110.581.270.550.240.460.220.4235.670.280.433.720.030.04-17.16-17.72-16.881.311.851.750.140.190.1835.1120.246.671.151.211.22.310.581.333314171044.618.92313.574-26.44-26.44
.((((......))))...(((((((......((((((((..............)))))))).....))))))).
.((((......))))...(((((((......((((((((..............)))))))).....))))))).
811042.1157.890.00811042.1157.890.00
56
4829714
4736266_48166_3
Exclusion 1
88-14626.719.412.158.3
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCGUGCAGAAAAAAAAAAAAAACUGCACGAGAAGGCACAUGAA
104.5438.952.681.33-0.990.290.560.460.691.630.930.470.240.140.07-17.06-16.07-15.760.971.671.10.140.250.1638.95104.54142.751.151.281.181.372.683.6737121695016.221.612.274-20.34-20.34
...................((((((......((((((((..............)))))))).....))))))..
...................((((((......((((((((..............)))))))).....))))))..
68042.8657.140.0068042.8657.140.00
57
4830788
close no cigar
Exclusion 1
88-116729.430059.4
UAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCGAAAAAAAAAAAUUAAAAAAGGAAGCGAGAAGGUACGGGAU
33.2133.3111.0600.060.990.980.986.281.481.020.490.110.08-17.22-17.22-17.130.420.610.480.030.050.0433.3133.2136.271.031.051.041.0911.0937818115010.824.314.974-6.3-4.96
.....(((((.((....)))))))..................................................
.................(((..(((......(((........................))).....))))))..
34042.8657.140.0026122.2266.6711.11
58
4831471
water s exclusion 1 again
Exclusion 1
88-1426.130056.1
AAAAAACAUGAGGAUCACCCAUGUAAGGAUAUGCUAAAAAAAAAAAAAAAAAAAAAAUGCAGAAGGUACAAAAA
40.1740.410.991.390.010.331.481.110.910.740.760.360.370.380.18-17.02-17.03-16.790.530.40.460.270.20.2340.4140.1750.981.311.221.261.270.991.2646811962.210.814.912.274-6.96-4.76
.....(((((.((....))))))).......(((........................))).............
...........((.....)).((((......(((........................))).....))))....
46040.0060.000.0045044.4455.560.00
59
4831827try 1
Exclusion 1
88-11924.53014.468.9
AAAGGACAUGAGGAUCACCCAUGUGAGGAUAUGCUCUACGAACGAAUACACAUGAGAAGCAGAAGGCACAUAAG
141.8443.83.241.32-1.180.280.920.891.089.450.835.782.170.191.33-16.94-15.77-16.090.680.991.380.160.230.3243.8141.84102.381.171.261.370.723.242.343014191140.518.925.714.974-8.83-8.23
.....(((((.((....))))))).......((((((.................)).)))).............
....................(((((......((((((.................)).)))).....)))))...
67046.1553.850.0065054.5545.450.00
60
4831840try 2
Exclusion 1
88-150921.43011.362.7
UAAGGACAUGAGGAUCACCCAUGUGAGGAUAUGCUCUACGAACGUUUAUUUAUGAGAAGCAGAAGGCACAUUUU
126.850.422.511.05-0.920.051.110.871.0252.14.42.552.310.20.11-16.8-15.88-16.490.540.920.730.020.040.0350.42126.868.971.021.041.030.542.511.372412182032.416.224.32774-10.3-8.6
.....(((((.((....))))))).(((((.(((.((.(.....((((....)))).....).))))).)))))
...........((.....)).((((......((((((..(((......)))...)).)))).....))))....
108445.4536.3618.1877146.6746.676.67
61
4831847try 2
Exclusion 1
88-154925309.364.3
CACGGACAUGAGGAUCACCCAUGUGAGGAUAUGCUCUACGAACGUUUUCCCACGAGAAGCAGAAGGCACAUUUC
90.8242.632.131.05-0.760.041.10.861.0634.536.6251.781.470.282.21-16.97-16.21-16.920.570.870.670.020.040.0342.6390.8244.741.021.041.030.492.131.052219181529.725.724.320.374-11.5-9.7
..(..(((((.((....)))))))..)....((((((.((............)))).)))).............
...........((.....)).((((......((((((.((............)))).)))).....))))....
610037.5062.500.0059035.7164.290.00
62
4831917
Exclusion one redone
Exclusion 1
88-12133030060
GGAAAACAUGAGGAUCACCCAUGUGAGGAUAUUGAAACAAACAAAACAAACAAACAAACAAGAAGGCACAGGAA
20.0720.680.971.050.030.051.080.990.9665.0410.90.764.460.750.05-17.69-17.72-17.80.510.530.560.030.040.0420.6820.0718.521.041.041.040.920.970.9391315752.717.620.39.574-6.3-4.46
.....(((((.((....)))))))..................................................
..................((.((((......(((........................))).....))))))..
34042.8657.140.0045044.4455.560.00
63
4833121
Ex1 sub 1
Exclusion 1
88-16330307.667.6
AAUAAACAUGAGGAUCACCCAUGUAAGGAUAUGCGAACAAUAAGAAGACAAUAAUAAAGCAGAAGGUACAAGAG
50.0127.011.851.08-0.620.081.220.991.086.330.963.240.80.120.41-17.43-16.81-16.980.390.470.50.050.060.0627.0150.0142.431.051.061.060.851.851.57371016115013.521.614.974-7.16-4.96
.....(((((.((....))))))).......(((........................))).............
...........((.....)).((((......(((........................))).....))))....
46040.0060.000.0045044.4455.560.00
64
4833126
Ex1 sub 2
Exclusion 1
88-125828.430058.4
AACAAACAUGAGGAUCACCCAUGUCAGGAUAUCCGAAAUAAAGAAACAAUAAUAAUAAGGAGAAGGGACUAAAU
34.0835.450.961.050.040.051.371.121.0936.337.4914.972.260.470.93-17.16-17.19-17.190.370.710.60.020.040.0435.4534.0834.361.021.051.041.010.960.97371114125014.918.916.274-7.4-5.96
.....(((((.((....)))))))..((....))........................................
.......(((.((....)))))(((......(((........................))).....))).....
36033.3366.670.0047036.3663.640.00
65
4833142
Excalibur
Exclusion 1
88-162330308.468.4
AGAAAACAUGAGGAUCACCCAUGUAAGGAUAUGCUAAGGGUGGCUUCGGCCACCCAAUGCAGAAGGUACAAAUA
40.7320.481.991.03-0.690.031.31.121.2621.922.142.370.880.090.09-17.7-17.02-17.280.380.530.520.020.020.0220.4840.7331.351.021.021.020.771.991.532715191336.520.325.717.674-27.9-25.7
.....(((((.((....))))))).......(((...(((((((....)))))))...))).............
...........((.....)).((((......(((...(((((((....)))))))...))).....))))....
512029.4170.590.00511031.2568.750.00
66
4834178
Banishment 1 - Jieux - Exclusion 1
Exclusion 1
88-138927.9304.462.3
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCUGUAUCCAAAAGGAAGUGUAGGAUCGGAGAAGGCACUAGGA
52.3236.461.441.04-0.360.041.120.981.127.045.524.820.360.280.24-17.13-16.77-17.270.440.570.560.020.030.0336.4652.3231.661.021.031.030.611.440.872911211339.214.928.417.674-14.52-12.02
.....(((((.((....)))))))..(((((....))))).......(((((.............)))))....
..................((..(((......((((.((((.............)))))))).....)))..)).
88147.0647.065.8848130.7761.547.69
67
4834185
Banishment 2 - Jieux - Exclusion 1
Exclusion 1
88-115024.3301.355.5
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCCAAAAGUCAAAGAAAAAGACGAAAAGGAGAAGGCACAAAAA
49.1144.251.111.06-0.10.061.3111.0813.071.250.781.070.10.06-16.93-16.83-17.020.470.510.550.040.040.0444.2549.1140.681.041.041.050.831.110.92401116754.114.921.69.574-10.5-9.8
.....(((((.((....))))))).......(((....(((.........))).....))).............
...........((.....)).((((......(((....(((.........))).....))).....))))....
58038.4661.540.0048033.3366.670.00
68
4834195
Banishment 3 - Jieux - Exclusion 1
Exclusion 1
88-17430306.766.7
AAAAAACAUGAGGAUCACCCAUGUUAGGAUAUCCUGCAGAAAAAAAAAAAAAACUGCAGGAGAAGGAGCAAGGA
44.4925.781.731.12-0.550.111.110.90.894.732.492.530.550.290.29-17.47-16.93-16.720.540.770.850.060.090.125.7844.4954.581.061.091.11.231.732.1237111795014.92312.274-19.54-18.24
....((((((.((....))))))))......((((((((..............)))))))).............
..................((.((((......((((((((..............)))))))).....)))).)).
79043.7556.250.0058135.7157.147.14
69
4834540
Mod of jnicol
Exclusion 1
88-18925.318.61054
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUCGUGCAGAAAAAAAAAAAAAACUGCACGAGAAGGGACAUGAA
94.8741.962.261.21-0.820.190.550.370.582.040.260.490.220.030.05-16.99-16.17-15.950.741.61.330.080.170.1441.9694.87117.791.081.181.151.242.262.8137121695016.221.612.274-20.64-20.64
...................((((((......((((((((..............)))))))).....))))))..
...................((((((......((((((((..............)))))))).....))))))..
68042.8657.140.0068042.8657.140.00
70
4835712coft
Exclusion 1
88-121728306.664.6
AUUAAACAUGAGGAUCACCCAUGUGAGGAUAUGCAAAAAAAAUUAUAUUAAAAAAAAAGCAGAAGGCACAUAUA
62.2836.281.721.07-0.540.070.850.750.88143.5325.1716.979.741.711.15-17.13-16.59-17.120.630.810.680.040.060.0536.2862.2836.721.041.061.050.591.721.01389121551.412.216.220.374-8-5.96
(((..(((((.((....)))))))...)))............................((.....)).......
....................(((((......(((........................))).....)))))...
56141.6750.008.3344050.0050.000.00
71
4835770
Insulation 1
Exclusion 1
88-11453030363
AUAAAACAUGAGGAUCACCCAUGUAAGGAUAUGCGAAAAUAAAAUAAAAUAAAAUAAAGCAGAAGGUACAAAAA
37.2629.111.281.07-0.250.071.060.971.1286.933950.9988.987.22328.117.39-17.35-17.11-17.140.50.660.490.040.060.0429.1137.2636.051.041.061.040.971.281.24428121256.810.816.216.274-7.16-4.96
.....(((((.((....))))))).......(((........................))).............
...........((.....)).((((......(((........................))).....))))....
46040.0060.000.0045044.4455.560.00
72
4835782
Fancy Pants
Exclusion 1
88-125127.4304.461.7
AUAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCUAAAAUAAAAUAAAAUAAAAUAAUGCAGAAGGCACAAAUA
53.8337.651.431.05-0.360.051.081.061.24150.529.63.979.51.870.25-17.09-16.74-17.020.420.650.560.030.040.0437.6553.8340.491.031.041.040.751.431.08399121452.712.216.218.974-7.9-6.26
.....(((((.((....))))))).................................(((.....)))......
...........((.....)).((((......(((........................))).....))))....
46040.0060.000.0036033.3366.670.00
73
4835810
High Five
Exclusion 1
88-13773030262
AUAAAACAUGAGGAUCACCCAUGUCAGGAUAUACGAUAUUAAAUUUAAUAUAUUUAUAGUAGAAGGGACAAAUA
37.0731.591.171.04-0.160.041.130.961.0989.745.668.124.620.290.42-17.27-17.11-17.170.460.50.540.020.030.0331.5937.0734.951.021.031.030.941.171.11338122144.610.816.228.474-7.8-6.6
.....(((((.((....))))))).....((((..((((((....))))))...))))................
...........((.....)).((((......(((.((((((....)))))).......))).....))))....
134076.4723.530.00105066.6733.330.00
74
4836811
7-pair stack
Exclusion 1
88-131430307.567.5
AAGAAACAUGAGGAUCACCCAUGUCAGGAUAUGCAAGACUGACGAAAGUCAGUCAAAAGCAGAAGGGACUAGAA
51.5428.031.841.04-0.610.041.171.031.1113.871.910.890.780.110.05-17.39-16.78-17.20.460.60.490.030.030.0328.0351.5433.941.031.031.030.661.841.213213191043.217.625.713.574-22.3-21
.....(((((.((....))))))).((..(.(((..(((((((....)))))))....)))....)..))....
.......(((.((....)))))(((......(((..(((((((....)))))))....))).....))).....
811140.0055.005.00711038.8961.110.00
75
4836868
5-pair stack
Exclusion 1
88-124430307.167.1
AAGAAACAUGAGGAUCACCCAUGUCAGGAUAUGCAAAACUGACGAAAGUCAGAAGAAAGCAGAAGGGACUAGAA
51.9929.121.791.05-0.580.051.291.021.1328.632.583.631.830.170.23-17.35-16.77-17.120.460.550.480.030.030.0329.1251.9936.771.031.041.030.711.791.26341219945.916.225.712.274-17.2-15.9
.....(((((.((....))))))).((..(.(((....(((((....)))))......)))....)..))....
.......(((.((....)))))(((......(((....(((((....)))))......))).....))).....
710138.8955.565.56610037.5062.500.00
76
4836870
8-pair stack
Exclusion 1
88-135230307.867.8
AAGAAACAUGAGGAUCACCCAUGUCAGGAUAUGCAGGACUGACGAAAGUCAGUCCAAAGCAGAAGGGACUAGAA
56.5329.881.891.05-0.640.051.191.041.1433.6210.9121.790.580.11-17.33-16.69-17.160.530.730.540.030.040.0329.8856.5335.261.031.041.030.621.891.183014201040.518.92713.574-25.9-24.6
.....(((((.((....))))))).((..(.(((.((((((((....))))))))...)))....)..))....
.......(((.((....)))))(((......(((.((((((((....))))))))...))).....))).....
812138.1057.144.76712036.8463.160.00
77
5452508
Ex 1 Tesla 1
Exclusion 1
93-1428.830058.8
AUAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCGAAAUAAAGAAAUAAAUAAAUAAAGCAGAAGGCACAAUAA
21.8734.60.631.230.460.210.920.560.722.620.160.3411.310.080.17-17.18-17.64-17.990.220.360.60.110.180.334.621.8715.451.121.191.350.710.630.45399141252.712.218.916.274-7.4-6.46
.....(((((.((....)))))))..................................((.....)).......
...........((.....)).((((......(((........................))).....))))....
36033.3366.670.0036033.3366.670.00
78
5453962
salish99-Ex1-03
Exclusion 1
93-11030303.363.3
GAGGAACAUGAGGAUCACCCAUGUGAGGAUAUCGGAGGAGGAGGAGGAGGAGGAGGAGCGAGAAGGUACAAGAG
29.8122.721.311.26-0.270.230.770.840.939.130.370.492.890.120.16-17.6-17.33-17.520.410.60.570.130.190.1822.7229.8124.731.141.211.20.831.311.0926833735.110.844.69.574-6.3-3.16
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0035133.3355.5611.11
79
5453966
salish99-Ex1-04
Exclusion 1
93-1530309.669.6
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUCGGAGGAGGAGGAGGAGGAGGAGGAGCGAGAAGGUACAAAAA
31.4914.422.182.4-0.780.870.881.090.8516.060.730.347.180.320.15-18.05-17.27-17.850.281.930.340.120.860.1514.4231.4917.611.132.371.160.562.181.2231828741.910.837.89.574-6.3-3.16
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0035133.3355.5611.11
80
5453991
salish99-Ex1-06
Exclusion 1
93-1103022.6658.7
GAGAGACAUGAGGAUCACCCAUGUGAGGAUAUCGGGAGGAGGAGGAGGAGGAGGAGGACGAGAAGGCACGGAAG
35.2821.561.641.45-0.490.370.60.50.630.370.150.210.120.050.07-17.65-17.16-17.390.810.851.050.260.270.3321.5635.2828.131.291.311.390.81.641.325934633.812.245.98.174-6.86-5.76
.....(((((.((....))))))).......(((........................))).......(....)
..((..(....)..)).....((((......(((........................))).....))))....
47036.3663.640.0036130.0060.0010.00
81
5455409
Exclusion 1 Lab (2)
Exclusion 1
93-11613.130043.1
AGAUGACAUGAGGAUCACCCAUGUAAGGAUAUACGAGUAGGAGAAUAAAAUGAUAGAAGUAGAAGGUACGUAGA
58.0567.950.851.170.160.160.90.740.876.850.240.31.710.060.07-16.5-16.66-16.660.410.490.730.10.120.1867.9558.05581.111.131.210.850.85327211443.29.528.418.974-6.4-3.4
.....(((((.((....)))))))..................................................
......(((.....((.((..((((......))))....)).)).....)))......(((.....))).....
34042.8657.140.0076150.0042.867.14
82
54572791-May
Exclusion 1
93-1921.9303.855.7
AGAAAACAUGAGGAUCACCCAUGUCAGGAUAUCCAAAUAAAAAUAAAAUAAAAUAAAAGGAGAAGGGACAAAAG
66.9249.191.361.17-0.310.152.651.251.281.524.130.320.511.380.11-16.83-16.52-16.390.220.410.550.070.140.1849.1966.9276.531.081.151.21.141.361.56419141055.412.218.913.574-7.4-6.26
.....(((((.((....)))))))..((....))........................................
...........((.....)).((((......(((........................))).....))))....
36033.3366.670.0036033.3366.670.00
83
54572952-May
Exclusion 1
93-1629.9301.461.2
AGAACACAUGAGGAUCACCCAUGUCAGGAUAUUCAAACAAAAACAAAACAAAACAAACGAAGAAGGGACAAAAG
36.0532.281.121.14-0.110.131.361.030.933.081.781.11.260.730.45-17.25-17.14-17.290.20.240.390.080.10.1632.2836.0530.871.091.11.170.861.120.96401413754.118.917.69.574-5.7-3.86
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0045044.4455.560.00
84
54573453-May
Exclusion 1
93-189.422.7032.1
GGAACACAUGAGGAUCACCCAUGUCAGGAUAUGUAGAUAAAAAGAAAAUAAAAUAAAAACAGAAGGGACAAAAG
73.3375.980.971.290.040.250.60.90.9326.360.610.339.320.210.12-16.39-16.43-16.460.590.420.50.210.150.1875.9873.3370.91.231.161.190.970.970.93399161052.712.221.613.574-5.7-3.86
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0045044.4455.560.00
85
54573554-May
Exclusion 1
93-1416.830046.8
GGAACACAUGAGGAUCACCCAUGUCAGGAUAUGUAGAUAAAAAGAAAAUAAAAUAAAAGCAGAAGGGACAAAAG
44.5260.160.741.320.30.281.3611.263.160.350.611.580.180.31-16.63-16.93-16.50.460.320.260.230.160.1360.1644.5268.131.261.171.141.530.741.13389171051.412.22313.574-5.7-4.16
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0035133.3355.5611.11
86
5457426
amethyst 6
Exclusion 1
93-127.1007.1
GGAAAACAUGAGGAUCACCCAUGUCAGGAUAUGUGAAAAAAAAAAAAAAGAAAAGAAAACAGAAGGGACAAAAG
23.2580.810.291.591.250.46-0.571.671.71.831.371.461.290.971.03-16.33-17.58-17.130.190.630.770.130.450.5580.8123.2536.511.141.561.731.570.290.4542817756.810.8239.574-5.7-4.76
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0045044.4455.560.00
87
54574387-May
Exclusion 1
93-1130300.260.2
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUGCAGAAAAAGAAAAAAAGAAAAGAAAGUAGAAGGGACAAAAA
31.831.21.02-0.021.321.181.15-17.28-17.26-17.6831.231.821.050.661.020.6743816758.110.821.69.574-5.7-4.06
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0035133.3355.5611.11
88
54574498-May
Exclusion 1
93-1173030060
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUACAAAAUAAAAUAAAAAUAAAAUAAAGUAGAAGGGACAAAAA
25.4428.540.891.110.110.11.710.981.114.760.460.363.580.110.09-17.37-17.49-17.760.280.330.350.070.080.0828.5425.4419.291.071.081.090.760.890.68448111159.510.814.914.974-5.7-4.06
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0045044.4455.560.00
89
54574619-May
Exclusion 1
93-1153030363
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUACAAAAAUAAAUAAAAAUAAAAUAAAGUAGAAGGGACAAAAA
36.9428.941.281.15-0.240.141.230.911.091.041.582.280.270.410.59-17.36-17.11-17.390.350.430.470.090.110.1228.9436.9427.981.11.121.130.761.280.97448111159.510.814.914.974-5.7-4.06
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0045044.4455.560.00
90
5457474
Amethyst 7
Exclusion 1
93-1630305.965.9
AUAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCGAAACAAAGAAACAAACAAACAAAGCAGAAGGCACAAUAA
39.1824.231.621.37-0.480.322.191.421.452.190.940.760.90.390.31-17.54-17.06-17.60.490.60.710.20.250.2924.2339.1822.81.221.281.330.581.620.94391314852.717.618.910.874-7.4-6.46
.....(((((.((....)))))))..................................((.....)).......
...........((.....)).((((......(((........................))).....))))....
36033.3366.670.0036033.3366.670.00
91
545747611-May
Exclusion 1
93-1426.3301.457.7
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUCGAAAAAUAAAUAAAAAUAAAAUAAACGAGAAGGGACAAAAA
44.6839.841.121.7-0.110.531.10.791.410.610.550.450.30.270.22-17.04-16.92-17.460.610.860.790.310.430.3939.8444.6826.071.361.541.480.581.120.65439121058.112.216.213.574-5.7-4.96
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0036033.3366.670.00
92
5457478
Amethyst 9
Exclusion 1
93-1830301.161.1
AUAAAACAUGAGGAUCACCCAUGUGAGGAUAUGCGAAACAAACAAACAAACAAACAAAGCAGAAGGCACAAUAA
24.6222.571.091.21-0.090.190.80.870.880.450.310.390.160.110.14-17.61-17.52-17.670.30.430.430.110.150.1522.5724.6221.241.111.171.160.861.090.94391413852.718.917.610.874-7.4-6.46
.....(((((.((....)))))))..................................((.....)).......
...........((.....)).((((......(((........................))).....))))....
36033.3366.670.0036033.3366.670.00
93
5457480
Amethyst 10
Exclusion 1
93-12530303.163.1
AUAAAACAUGAGGAUCACCCAUGUGAGGAUAUAGGAAACAAACAAACAAACAAACAAACUAGAAGGCACAAUAA
16.6813.011.281.13-0.250.121.111.161.5211.191.520.762.240.30.15-18.16-17.91-17.980.470.380.430.090.080.0913.0116.6815.471.11.081.090.931.281.19401312954.117.616.212.274-8-4.56
.....(((((.((....))))))).........(....)...................................
...........((.....)).((((......(((........................))).....))))....
35037.5062.500.0045044.4455.560.00
94
545748312-May
Exclusion 1
93-1430305.965.9
GAAAAACAUGAGGAUCACCCAUGUCAGGAUAUCGAAAAAAAUAAAAAAGAAAAGAAAACGAGAAGGGACAAAAA
45.5828.191.621.23-0.480.210.751.180.841.480.50.410.740.250.21-17.38-16.9-17.350.230.350.290.120.170.1528.1945.5829.071.121.191.160.641.621.0343915758.112.220.39.574-5.7-4.96
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0036033.3366.670.00
95
5457525
Amethyst 15
Exclusion 1
93-173030262
GGAAAACAUGAGGAUCACCCAUGUCAGGAUAUACAAAGAAAGAAAGAAAAGAAAGAAAGUAGAAGGGACAAAAG
31.927.11.181.38-0.160.321.141.231.574.660.670.631.760.250.24-17.42-17.26-17.420.420.730.540.160.280.227.131.927.171.171.321.230.851.18140819754.110.825.79.574-5.7-4.06
.....(((((.((....)))))))..................................................
...........((.....)).((((......(((........................))).....))))....
34042.8657.140.0045044.4455.560.00
96
5457536
Amethyst 16
Exclusion 1
93-1330307.667.6
GGAAAACAUGAGGAUCACCCAUGUCAGGAUAUACAAAGAAAGAAAGAAAAGAAAGAAAGUAGAAGGGACUAAAG
37.9220.421.861.49-0.620.40.9610.940.860.460.580.50.260.33-17.71-17.09-17.90.310.620.130.180.360.0820.4237.9216.911.191.431.080.451.860.8339819852.710.825.710.874-5.7-3.06
.....(((((.((....)))))))..................................................
.......(((.((....)))))(((......(((........................))).....))).....
34042.8657.140.0056045.4554.550.00
97
5457551
Amethyst 18
Exclusion 1
93-1129.12215.366.4
GGAAAACAUGAGGAUCACCCAUGUAAGGAUAUGCUAAAAAAAAAAAAAAAAAAAAAAUGCAGAAGGUACUAAAG
118.18343.48-1.250.590.690.41-17.2-15.95-16.9434118.1844.080.373.481.3428141056.810.818.913.574-6.96-3.76
.....(((((.((....))))))).......(((........................))).............
.......(((.((....)))))(((......(((........................))).....))).....
46040.0060.000.0056045.4554.550.00
98
5457635
Amethyst 28
Exclusion 1
93-1218.730048.7
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUCGAAAGAAAAAAAAAGAAAAAAAAAACGAGAAGGGACAAAAA
30.2856.080.541.490.620.42.850.550.793.290.590.52.330.420.36-16.7-17.31-17.050.550.100.390.07056.0830.2839.461.481.0711.30.540.745914660.812.218.98.174-8.3-4.96
.....(((((.((....))))))).......((....))...................................
...........((.....)).((((......(((........................))).....))))....
45044.4455.560.0036033.3366.670.00
99
5457640
Amethyst 29
Exclusion 1
93-123015.76.151.8
AAAAAACAUGAGGAUCACCCAUGUCAGGAUAUCGAAAGAAAAAAAAAGAAAGAAAAAACGAGAAGGGACAAAAA
33.120.141.641.12-0.50.110.510.710.560.180.050.120.130.030.08-17.72-17.22-17.680.090.130.070.060.090.0520.1433.121.021.061.11.050.641.641.0444915659.512.220.38.174-8.3-4.96
.....(((((.((....))))))).......((....))...................................
...........((.....)).((((......(((........................))).....))))....
45044.4455.560.0036033.3366.670.00
100
5457644
Amethyst 30
Exclusion 1
93-1324.930054.9
AAAAAACAUGAGGAUCACCCAUGUGAGGAUAUGGAAAGAAAAAAAAAGAAAGAAAAAACCAGAAGGCACAAAAA
23.7642.810.551.270.590.241.220.911.360.620.220.260.360.130.15-16.97-17.56-17.220.380.150.250.220.090.1442.8123.7633.21.251.091.151.40.550.7844915659.512.220.38.174-6.4-5.26
.....(((((.((....)))))))..................................((....))........
...........((.....)).((((......(((........................))).....))))....
36033.3366.670.0036033.3366.670.00
Loading...
Main menu