| A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | INPUT SECTION | the 3 cells in yellow are for your input | ||||||||||||||||||||||||
2 | Paste any RNA Sequence into cell B2 here----------> | CGAAUUCCGGAUUAGGGCCCCAAAAUUUUUAAAUUUUUGCGCGCGCGCGC | ||||||||||||||||||||||||
3 | Sequence Length (For Your Info, not an input cell) | 50 | ||||||||||||||||||||||||
4 | Specify the starting (first) base number you want | 5 | ||||||||||||||||||||||||
5 | What is the last base number you want | 42 | ||||||||||||||||||||||||
6 | OUTPUT SECTION | |||||||||||||||||||||||||
7 | substring per your specification | UUCCGGAUUAGGGCCCCAAAAUUUUUAAAUUUUUGCGC | ||||||||||||||||||||||||
8 | Substring Sequence Length | 38 | ||||||||||||||||||||||||
9 | ||||||||||||||||||||||||||
10 | ||||||||||||||||||||||||||
11 | Next Steps: | |||||||||||||||||||||||||
12 | Copy your substring in cell B7 onto the clipboard | |||||||||||||||||||||||||
13 | Then: | |||||||||||||||||||||||||
14 | You can the paste your substring from the clipboard into an eterna puzzle (from base number 1 of the puzzle) | |||||||||||||||||||||||||
15 | OR | |||||||||||||||||||||||||
16 | You can also paste your substring from the clipboard into a specific base in an eterna puzzle (using the sequence stamper) | |||||||||||||||||||||||||
17 | ||||||||||||||||||||||||||
18 | ||||||||||||||||||||||||||
19 | --Leonard Oppenheimer (LROPPY) | |||||||||||||||||||||||||
20 | ||||||||||||||||||||||||||
21 | ||||||||||||||||||||||||||
22 | ||||||||||||||||||||||||||
23 | ||||||||||||||||||||||||||
24 | ||||||||||||||||||||||||||
25 | ||||||||||||||||||||||||||
26 | ||||||||||||||||||||||||||
27 | ||||||||||||||||||||||||||
28 | ||||||||||||||||||||||||||
29 | ||||||||||||||||||||||||||
30 | ||||||||||||||||||||||||||
31 | ||||||||||||||||||||||||||
32 | ||||||||||||||||||||||||||
33 | ||||||||||||||||||||||||||
34 | ||||||||||||||||||||||||||
35 | ||||||||||||||||||||||||||
36 | ||||||||||||||||||||||||||
37 | ||||||||||||||||||||||||||
38 | ||||||||||||||||||||||||||
39 | ||||||||||||||||||||||||||
40 | ||||||||||||||||||||||||||
41 | ||||||||||||||||||||||||||
42 | ||||||||||||||||||||||||||
43 | ||||||||||||||||||||||||||
44 | ||||||||||||||||||||||||||
45 | ||||||||||||||||||||||||||
46 | ||||||||||||||||||||||||||
47 | ||||||||||||||||||||||||||
48 | ||||||||||||||||||||||||||
49 | ||||||||||||||||||||||||||
50 | ||||||||||||||||||||||||||
51 | ||||||||||||||||||||||||||
52 | ||||||||||||||||||||||||||
53 | ||||||||||||||||||||||||||
54 | ||||||||||||||||||||||||||
55 | ||||||||||||||||||||||||||
56 | ||||||||||||||||||||||||||
57 | ||||||||||||||||||||||||||
58 | ||||||||||||||||||||||||||
59 | ||||||||||||||||||||||||||
60 | ||||||||||||||||||||||||||
61 | ||||||||||||||||||||||||||
62 | ||||||||||||||||||||||||||
63 | ||||||||||||||||||||||||||
64 | ||||||||||||||||||||||||||
65 | ||||||||||||||||||||||||||
66 | ||||||||||||||||||||||||||
67 | ||||||||||||||||||||||||||
68 | ||||||||||||||||||||||||||
69 | ||||||||||||||||||||||||||
70 | ||||||||||||||||||||||||||
71 | ||||||||||||||||||||||||||
72 | ||||||||||||||||||||||||||
73 | ||||||||||||||||||||||||||
74 | ||||||||||||||||||||||||||
75 | ||||||||||||||||||||||||||
76 | ||||||||||||||||||||||||||
77 | ||||||||||||||||||||||||||
78 | ||||||||||||||||||||||||||
79 | ||||||||||||||||||||||||||
80 | ||||||||||||||||||||||||||
81 | ||||||||||||||||||||||||||
82 | ||||||||||||||||||||||||||
83 | ||||||||||||||||||||||||||
84 | ||||||||||||||||||||||||||
85 | ||||||||||||||||||||||||||
86 | ||||||||||||||||||||||||||
87 | ||||||||||||||||||||||||||
88 | ||||||||||||||||||||||||||
89 | ||||||||||||||||||||||||||
90 | ||||||||||||||||||||||||||
91 | ||||||||||||||||||||||||||
92 | ||||||||||||||||||||||||||
93 | ||||||||||||||||||||||||||
94 | ||||||||||||||||||||||||||
95 | ||||||||||||||||||||||||||
96 | ||||||||||||||||||||||||||
97 | ||||||||||||||||||||||||||
98 | ||||||||||||||||||||||||||
99 | ||||||||||||||||||||||||||
100 |