Structured comment name

Expected value

Preferred unit

submitted_to_insdc

Depending on the study (large-scale e.g. done with next generation sequencing technology, or small-scale) sequences have to be submitted to SRA (Sequence Read Archive), DRA (DDBJ Read Archive) or via the classical Webin/Sequin systems to Genbank, ENA and DDBJ. Although this field is mandatory, it is meant as a self-test field, therefore it is not necessary to include this field in contextual data submitted to databases

investigation_type

Nucleic Acid Sequence Report is the root element of all MIGS/MIMS compliant reports as standardized by Genomic Standards Consortium. This field is either eukaryote,bacteria,virus,plasmid,organelle, metagenome,mimarks-survey, mimarks-specimen, metatranscriptome, single amplified genome, metagenome-assembled genome, or uncultivated viral genome

eukaryote, bacteria_archaea, plasmid, virus, organelle, metagenome,mimarks-survey, mimarks-specimen, metatranscriptome, single amplified genome, metagenome-assembled genome, or uncultivated viral genomes

[eukaryote|bacteria_archaea|plasmid|virus|organelle|metagenome|metatranscriptome|mimarks-survey|mimarks-specimen|misag|mimag|miuvig]

Name of the project within which the sequencing was organized

Forest soil metagenome

experimental_factor

Experimental factors are essentially the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). For a browser of EFO (v 2.95) terms, please see http://purl.bioontology.org/ontology/EFO; for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI

text or EFO and/or OBI

{termLabel} {[termID]}|{text}

time series design [EFO:EFO_0001779]

geographic location (latitude and longitude)

The geographical origin of the sample as defined by latitude and longitude. The values should be reported in decimal degrees and in WGS84 system

decimal degrees

50.586825 6.408977

Please refer to the definitions of depth in the environmental packages

Altitude is a term used to identify heights of objects such as airplanes, space shuttles, rockets, atmospheric balloons and heights of places such as atmospheric layers and clouds. It is used to measure the height of an object which is above the earth’s surface. In this context, the altitude measurement is the vertical distance between the earth's surface above sea level and the sampled position in the air

measurement value

Elevation of the sampling site is its height above a fixed reference point, most commonly the mean sea level. Elevation is mainly used when referring to points on the earth's surface, while altitude is used for points above the surface, such as an aircraft in flight or a spacecraft in orbit

measurement value

geographic location (country and/or sea,region)

The geographical origin of the sample as defined by the country or sea name followed by specific region name. Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (v 1.512) (http://purl.bioontology.org/ontology/GAZ)

country or sea name (INSDC or GAZ);region(GAZ);specific location name

{term};{term};{text}

Germany;North Rhine-Westphalia;Eifel National Park

The time of sampling, either as an instance (single point in time) or interval. In case no exact time is available, the date/time can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant

2018-05-11T10:00:00+01:00

broad-scale environmental context

In this field, report which major environmental system your sample or specimen came from. The systems identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. were you in the desert or a rainforest?). We recommend using subclasses of ENVO’s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. Format (one term): termLabel [termID], Format (multiple terms): termLabel [termID]|termLabel [termID]|termLabel [termID]. Example: Annotating a water sample from the photic zone in middle of the Atlantic Ocean, consider: oceanic epipelagic zone biome [ENVO:01000033]. Example: Annotating a sample from the Amazon rainforest consider: tropical moist broadleaf forest biome [ENVO:01000228]. If needed, request new terms on the ENVO tracker, identified here: http://www.obofoundry.org/ontology/envo.html

Add terms that identify the major environment type(s) where your sample was collected. Recommend subclasses of biome [ENVO:00000428]. Multiple terms can be separated by one or more pipes e.g.: mangrove biome [ENVO:01000181]|estuarine biome [ENVO:01000020]

{termLabel} {[termID]}

forest biome [ENVO:01000174]

In this field, report the entity or entities which are in your sample or specimen’s local vicinity and which you believe have significant causal influences on your sample or specimen. Please use terms that are present in ENVO and which are of smaller spatial grain than your entry for env_broad_scale. Format (one term): termLabel [termID]; Format (multiple terms): termLabel [termID]|termLabel [termID]|termLabel [termID]. Example: Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]|herb and fern layer [ENVO:01000337]|litter layer [ENVO:01000338]|understory [01000335]|shrub layer [ENVO:01000336]. If needed, request new terms on the ENVO tracker, identified here: http://www.obofoundry.org/ontology/envo.html

Add terms that identify environmental entities having causal influences upon the entity at time of sampling, multiple terms can be separated by pipes, e.g.: shoreline [ENVO:00000486]|intertidal zone [ENVO:00000316]

{termLabel} {[termID]}

litter layer [ENVO:01000338]

In this field, report which environmental material or materials (pipe separated) immediately surrounded your sample or specimen prior to sampling, using one or more subclasses of ENVO’s environmental material class: http://purl.obolibrary.org/obo/ENVO_00010483. Format (one term): termLabel [termID]; Format (multiple terms): termLabel [termID]|termLabel [termID]|termLabel [termID]. Example: Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]|air ENVO_00002005. If needed, request new terms on the ENVO tracker, identified here: http://www.obofoundry.org/ontology/envo.html

Add terms that identify the material displaced by the entity at time of sampling. Recommend subclasses of environmental material [ENVO:00010483]. Multiple terms can be separated by pipes e.g.: estuarine water [ENVO:01000301]|estuarine mud [ENVO:00002160]

{termLabel} {[termID]}

soil [ENVO:00001998]

MIxS extension for reporting of measurements and observations obtained from one or more of the environments where the sample was obtained. All environmental packages listed here are further defined in separate subtables. By giving the name of the environmental package, a selection of fields can be made from the subtables and can be reported

[air|built environment|host-associated|human-associated|human-skin|human-oral|human-gut|human-vaginal|hydrocarbon resources-cores|hydrocarbon resources-fluids/swabs|microbial mat/biofilm|misc environment|plant-associated|sediment|soil|wastewater/sludge|water]

subspecf_gen_lin

This should provide further information about the genetic distinctness of the sequenced organism by recording additional information e.g. serovar, serotype, biotype, ecotype, or any relevant genetic typing schemes like Group I plasmid. It can also contain alternative taxonomic information. It should contain both the lineage name, and the lineage rank, i.e. biovar:abc123

genetic lineage below lowest rank of NCBI taxonomy, which is subspecies, e.g. serovar, biotype, ecotype

{rank name}:{text}

nucleic acid sequence source

The ploidy level of the genome (e.g. allopolyploid, haploid, diploid, triploid, tetraploid). It has implications for the downstream study of duplicated gene and regions of the genomes (and perhaps for difficulties in assembly). For terms, please select terms listed under class ploidy (PATO:001374) of Phenotypic Quality Ontology (PATO), and for a browser of PATO (v 2018-03-27) please refer to http://purl.bioontology.org/ontology/PATO

{termLabel} {[termID]}

allopolyploidy [PATO:0001379]

nucleic acid sequence source

Reports the number of replicons in a nuclear genome of eukaryotes, in the genome of a bacterium or archaea or the number of segments in a segmented virus. Always applied to the haploid chromosome count of a eukaryote

for eukaryotes and bacteria: chromosomes (haploid count); for viruses: segments

nucleic acid sequence source

extrachrom_elements

Do plasmids exist of significant phenotypic consequence (e.g. ones that determine virulence or antibiotic resistance). Megaplasmids? Other plasmids (borrelia has 15+ plasmids)

number of extrachromosmal elements

nucleic acid sequence source

The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period.

number of base pairs

nucleic acid sequence source

Primary publication if isolated before genome publication; otherwise, primary genome report

PMID, DOI or URL

{PMID}|{DOI}|{URL}

doi:10.1016/j.syapm.2018.01.009

nucleic acid sequence source

A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain 'UAM:Herps:14' , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2).

for cultures of microorganisms: identifiers for two culture collections; for other material a unique arbitrary identifer

nucleic acid sequence source

To what is the entity pathogenic

names of organisms that the entity is pathogenic to

human, animal, plant, fungi, bacteria

nucleic acid sequence source

biotic_relationship

Description of relationship(s) between the subject organism and other organism(s) it is associated with. E.g., parasite on species X; mutualist with species Y. The target organism is the subject of the relationship, and the other organism(s) is the object

[free living|parasitism|commensalism|symbiotic|mutualism]

nucleic acid sequence source

If there is a host involved, please provide its taxid (or environmental if not actually isolated from the dead or alive host - i.e. a pathogen could be isolated from a swipe of a bench etc) and report whether it is a laboratory or natural host)

host taxid, unknown, environmental

nucleic acid sequence source

host_spec_range

The NCBI taxonomy identifier of the specific host if it is known

nucleic acid sequence source

health_disease_stat

health or disease status of specific host at time of collection

Health or disease status of specific host at time of collection

[healthy|diseased|dead|disease-free|undetermined|recovering|resolving|pre-existing condition|pathological|life threatening|congenital]

nucleic acid sequence source

Trophic levels are the feeding position in a food chain. Microbes can be a range of producers (e.g. chemolithotroph)

[autotroph|carboxydotroph|chemoautotroph|chemoheterotroph|chemolithoautotroph|chemolithotroph|chemoorganoheterotroph|chemoorganotroph|chemosynthetic|chemotroph|copiotroph|diazotroph|facultative|autotroph|heterotroph|lithoautotroph|lithoheterotroph|lithotroph|methanotroph|methylotroph|mixotroph|obligate|chemoautolithotroph|oligotroph|organoheterotroph|organotroph|photoautotroph|photoheterotroph|photolithoautotroph|photolithotroph|photosynthetic|phototroph]

nucleic acid sequence source

This field is specific to different taxa. For phages: lytic/lysogenic, for plasmids: incompatibility group, for eukaryotes: sexual/asexual (Note: there is the strong opinion to name phage propagation obligately lytic or temperate, therefore we also give this choice

for virus: lytic, lysogenic, temperate, obligately lytic; for plasmid: incompatibility group; for eukaryote: asexual, sexual

nucleic acid sequence source

Should include key traits like antibiotic resistance or xenobiotic degradation phenotypes for plasmids, converting genes for phage

for plasmid: antibiotic resistance; for phage: converting genes

beta-lactamase class A

nucleic acid sequence source

Is this organism an aerobe, anaerobe? Please note that aerobic and anaerobic are valid descriptors for microbial environments

[aerobe|anaerobe|facultative|microaerophilic|microanaerobe|obligate aerobe|obligate anaerobe]

nucleic acid sequence source

isol_growth_condt

Publication reference in the form of pubmed ID (pmid), digital object identifier (doi) or url for isolation and growth condition specifications of the organism/material

{PMID}|{DOI}|{URL}

doi: 10.1016/j.syapm.2018.01.009

nucleic acid sequence source

samp_collect_device

sample collection device or method

The method or device employed for collecting the sample

biopsy, niskin bottle, push core

nucleic acid sequence source

samp_mat_process

Any processing applied to the sample during or after retrieving the sample from environment. This field accepts OBI, for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI

{text}|{termLabel} {[termID]}

filtering of seawater, storing samples in ethanol

nucleic acid sequence source

Filtering pore size used in sample preparation

filter size value range

{float}-{float} {unit}

0-0.22 micrometer

nucleic acid sequence source

amount or size of sample collected

Amount or size of sample (volume, mass or area) that was collected

measurement value

nucleic acid sequence source

millliter, gram, milligram, liter

Type of dataset from which the UViG was obtained

[metagenome (not viral targeted)|viral fraction metagenome (virome)|sequence-targeted metagenome|metatranscriptome (not viral targeted)|viral fraction RNA metagenome (RNA virome)|sequence-targeted RNA metagenome|microbial single amplified genome (SAG)|viral single amplified genome (vSAG)|isolate microbial genome|other]

viral fraction metagenome (virome)

nucleic acid sequence source

virus_enrich_appr

List of approaches used to enrich the sample for viruses, if any

[filtration|ultrafiltration|centrifugation|ultracentrifugation|PEG Precipitation|FeCl Precipitation|CsCl density gradient|DNAse|RNAse|targeted sequence capture|other|none]

filtration + FeCl Precipitation + ultracentrifugation + DNAse

nucleic acid sequence source

A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample

PMID, DOI or URL

{PMID}|{DOI}|{URL}

https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf

A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids

PMID, DOI or URL

{PMID}|{DOI}|{URL}

https://phylogenomics.me/protocols/16s-pcr-protocol/

Total number of clones in the library prepared for the project

number of clones

Total number of clones sequenced from the library

number of reads sequenced

Specify whether to expect single, paired, or other configuration of reads

[paired|single|vector|other]

Cloning vector type(s) used in construction of libraries

Bacteriophage P1

Specific enrichment or screening methods applied before and/or after creating libraries

screening strategy name

enriched, screened, normalized

Targeted gene or locus name for marker gene studies

16S rRNA, 18S rRNA, nif, amoA, rpo

target_subfragment

Name of subfragment of a gene or locus. Important to e.g. identify special regions on marker genes like V6 on 16S rRNA

gene fragment name

PCR primers that were used to amplify the sequence of the targeted gene, locus or subfragment. This field should contain all the primers used for a single PCR reaction if multiple forward or reverse primers are present in a single PCR reaction. The primer sequence should be reported in uppercase letters

FWD: forward primer sequence;REV:reverse primer sequence

FWD:{dna};REV:{dna}

FWD:GTGCCAGCMGCCGCGGTAA;REV:GGACTACHVGGGTWTCTAAT

Molecular barcodes, called Multiplex Identifiers (MIDs), that are used to specifically tag unique samples in a sequencing run. Sequence should be reported in uppercase letters

multiplex identifier sequence

Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters

adapter A and B sequence

AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT

Description of reaction conditions and components of PCR in the form of 'initial denaturation:94degC_1.5min; annealing=...'

initial denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final elongation:degrees_minutes;total cycles

initial denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final elongation:degrees_minutes;total cycles

initial denaturation:94_3;annealing:50_1;elongation:72_1.5;final elongation:72_10;35

Sequencing method used; e.g. Sanger, pyrosequencing, ABI-solid

[MinION|GridION|PromethION|454 GS|454 GS 20|454 GS FLX|454 GS FLX+|454 GS FLX Titanium|454 GS Junior|Illumina Genome Analyzer|Illumina Genome Analyzer II|Illumina Genome Analyzer IIx|Illumina HiSeq 4000|Illumina HiSeq 3000|Illumina HiSeq 2500|Illumina HiSeq 2000|Illumina HiSeq 1500|Illumina HiSeq 1000|Illumina HiScanSQ|Illumina MiSeq|Illumina HiSeq X Five|Illumina HiSeq X Ten|Illumina NextSeq 500|Illumina NextSeq 550|AB SOLiD System|AB SOLiD System 2.0|AB SOLiD System 3.0|AB SOLiD 3 Plus System|AB SOLiD 4 System|AB SOLiD 4hq System|AB SOLiD PI System|AB 5500 Genetic Analyzer|AB 5500xl Genetic Analyzer|AB 5500xl-W Genetic Analysis System|Ion Torrent PGM|Ion Torrent Proton|Ion Torrent S5|Ion Torrent S5 XL|PacBio RS|PacBio RS II|Sequel|AB 3730xL Genetic Analyzer|AB 3730 Genetic Analyzer|AB 3500xL Genetic Analyzer|AB 3500 Genetic Analyzer|AB 3130xL Genetic Analyzer|AB 3130 Genetic Analyzer|AB 310 Genetic Analyzer|BGISEQ-500]

Illumina HiSeq 1500

seq_quality_check

Indicate if the sequence has been called by automatic systems (none) or undergone a manual editing procedure (e.g. by inspecting the raw data or chromatograms). Applied only for sequences that are not submitted to SRA,ENA or DRA

none or manually edited

[none|manually edited]

A chimeric sequence, or chimera for short, is a sequence comprised of two or more phylogenetically distinct parent sequences. Chimeras are usually PCR artifacts thought to occur when a prematurely terminated amplicon reanneals to a foreign DNA strand and is copied to completion in the following PCR cycles. The point at which the chimeric sequence changes from one parent to the next is called the breakpoint or conversion point

name and version of software, parameters used

{software};{version};{parameters}

uchime;v4.1;default parameters

The phylogenetic marker(s) used to assign an organism name to the SAG or MAG

[16S rRNA gene|multi-marker approach|other]

The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated

[Finished genome|High-quality draft genome|Medium-quality draft genome|Low-quality draft genome|Genome fragment(s)]

High-quality draft genome

Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community

name and version of assembly

HuRef, JCVI_ISG_i3_1.0

assembly_software

Tool(s) used for assembly, including version number and parameters

name and version of software, parameters used

{software};{version};{parameters}

metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise

Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter

name of tool or pipeline used, or annotation source description

Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG

Method used to predict UViGs features such as ORFs, integration site, etc.

names and versions of software(s), parameters used

{software};{version};{parameters}

Prodigal;2.6.3;default parameters

List of database(s) used for ORF annotation, along with version number and reference to website or publication

names, versions, and references of databases

{database};{version};{reference}

pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975

sim_search_meth

Tool used to compare ORFs with database, along with version and cutoffs used

names and versions of software(s), parameters used

{software};{version};{parameters}

HMMER3;3.1b2;hmmsearch, cutoff of 50 on score

Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes

classification method, database name, and other parameters

vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters)

Can a 16S gene be recovered from the submitted SAG or MAG?

16s_recover_software

Tools used for 16S rRNA gene extraction

names and versions of software(s), parameters used

{software};{version};{parameters}

rambl;v2;default parameters

number of standard tRNAs extracted

The total number of tRNAs identified from the SAG or MAG

trna_ext_software

Tools used for tRNA identification

names and versions of software(s), parameters used

{software};{version};{parameters}

infernal;v2;default parameters

Completeness score is typically based on either the fraction of markers found as compared to a database or the percent of a genome found as compared to a closely related reference genome. High Quality Draft: >90%, Medium Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated completeness scores

quality;percent completeness

[high|med|low];{percentage}

Tools used for completion estimate, i.e. checkm, anvi'o, busco

names and versions of software(s) used

{software};{version}

The approach used to determine the completeness of a given SAG or MAG, which would typically make use of a set of conserved marker genes or a closely related reference genome. For UViG completeness, include reference genome or group used, and contig feature suggesting a complete genome

[marker gene|reference based|other]

other: UViG length compared to the average length of reference genomes from the P22virus genus (NCBI RefSeq v83)

The contamination score is based on the fraction of single-copy genes that are observed more than once in a query genome. The following scores are acceptable for; High Quality Draft: < 5%, Medium Quality Draft: < 10%, Low Quality Draft: < 10%. Contamination must be below 5% for a SAG or MAG to be deposited into any of the public databases

{float} percentage

contam_screen_input

The type of sequence data used as input

contam_screen_param

contamination screening parameters

Specific parameters used in the decontamination sofware, such as reference database, coverage, and kmers. Combinations of these parameters may also be used, i.e. kmer and coverage, or reference database and kmer

enumeration;value or name

[ref db|kmer|coverage|combination];{text|integer}

decontam_software

Tool(s) used in contamination screening

[checkm/refinem|anvi'o|prodege|bbtools:decontaminate.sh|acdc|combination]

Method used to sort/isolate cells or particles of interest

[flow cytometric cell sorting|microfluidics|lazer-tweezing|optical manipulation|micromanipulation|other]

optical manipulation

single_cell_lysis_appr

single cell or viral particle lysis approach

Method used to free DNA from interior of the cell(s) or particle(s)

[chemical|enzymatic|physical|combination]

single_cell_lysis_prot

single cell or viral particle lysis kit protocol

Name of the kit or standard protocol used for cell(s) or particle(s) lysis

kit, protocol name

ambion single cell lysis kit

Method used to amplify genomic DNA in preparation for sequencing

[pcr based|mda based]

Kit used to amplify genomic DNA in preparation for sequencing

The parameters that have been applied during the extraction of genomes from metagenomic datasets

[homology search|kmer|coverage|codon usage|combination]

coverage and kmer

Tool(s) used for the extraction of genomes from metagenomic datasets

[metabat|maxbin|concoct|groupm|esom|metawatt|combination|other]

concoct and maxbin

Has an assembly been performed on a genome bin extracted from a metagenomic assembly?

mag_cov_software

Tool(s) used to determine the genome coverage if coverage is used as a binning parameter in the extraction of genomes from metagenomic datasets

[bwa|bbmap|bowtie|other]

vir_ident_software

Tool(s) used for the identification of UViG as a viral genome, software or protocol name including version number, parameters, and cutoffs used

software name, version and relevant parameters

{software};{version};{parameters}

VirSorter; 1.0.4; Virome database, category 2

pred_genome_type

Type of genome predicted for the UViG

[DNA|dsDNA|ssDNA|RNA|dsRNA|ssRNA|ssRNA (+)|ssRNA (-)|mixed|uncharacterized]

pred_genome_struc

Expected structure of the viral genome

[segmented|non-segmented|undetermined]

Type of UViG detection

[independent sequence (UViG)|provirus (UpViG)]

independent sequence (UViG)

Cutoffs and approach used when clustering new UViGs in “species-level” vOTUs. Note that results from standard 95% ANI / 85% AF clustering should be provided alongside vOTUS defined from another set of thresholds, even if the latter are the ones primarily used during the analysis

cutoffs and method used

{ANI cutoff};{AF cutoff};{clustering method}

95% ANI;85% AF; greedy incremental clustering

votu_seq_comp_appr

vOTU sequence comparison approach

Tool and thresholds used to compare sequences when computing "species-level" vOTUs

software name, version and relevant parameters

{software};{version};{parameters}

blastn;2.6.0+;e-value cutoff: 0.001

Reference database (i.e. sequences not generated as part of the current study) used to cluster new genomes in "species-level" vOTUs, if any

database and version

{database};{version}

NCBI Viral RefSeq;83

Tool or approach used for host prediction

[provirus|host sequence similarity|CRISPR spacer match|kmer similarity|co-occurrence|combination|other]

CRISPR spacer match

host_pred_est_acc

host prediction estimated accuracy

For each tool or approach used for host prediction, estimated false discovery rates should be included, either computed de novo or from the literature

false discovery rate

CRISPR spacer match: 0 or 1 mismatches, estimated 8% FDR at the host genus rank (Edwards et al. 2016 doi:10.1093/femsre/fuv048)

http://www.earthmicrobiome.org/

relevant standard operating procedures

Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences

reference to SOP

{PMID}|{DOI}|{URL}

http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/