Friedman Lab Primers
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
ABCDEFGHIJKLMNOPQRSTUVWXY
1
Unique Primer ID (UPID)Primer NamePrimer SequenceOrganismGenePair With Primer NumberDesigned ByDate OrderedOrdered By# BPGC%Melt TempProduct SizeGene Accession #Full SequenceLocation on ReferenceOther NotesIDT #
2
3
4
5
98
6
97
7
96
8
95
9
94
10
93
11
92
12
91
13
90
14
89
15
88Univ16s-27FAGAGTTTGATCCTGGCTCAGuniversal bacteria16s87elene2/19/2015SJW130350239
16
87Univ16s-1492RGGTTACCTTGTTACGACTTuniversal bacteria16s88elene2/19/2015SJW130350240
17
86EubA-1518RAAGGAGGTGATCCANCCRCAuniversal eubacteria16s85http://www.int-res.com/articles/dao/26/d026p189.pdf2/19/2015SJW130350241
18
85EubB-27FAGAGTTTGATCMTGGCTCAGuniversal eubacteria16s86http://www.int-res.com/articles/dao/26/d026p189.pdf2/19/2015SJW130350242
19
84PodoFCCA AAY CTY GCM CAR GTpodophages83, 82Jérôme Payet3/3/2014SJWSent as email attachment to Carolyn on 3/3/2014.119542359
20
83PodoR1CT CGT CRT GSA CRA ASG Cpodophages84Jérôme Payet3/3/2014SJWSent as email attachment to Carolyn on 3/3/2014.119542360
21
82PodoR2CT CGT CRT GDA TRA ASG Cpodophages84Jérôme Payet3/3/2014SJWSent as email attachment to Carolyn on 3/3/2014.119542361
22
81g232CGCGGTTGATTTCCAGCATGATTTCT4-like phages80Jérôme Payet3/3/2014SJWSent as email attachment to Carolyn on 3/3/2014.119542362
23
80g231GATATTTGIGGIGTTCAGCCIATGAT4-like phages81Jérôme Payet3/3/2014SJWSent as email attachment to Carolyn on 3/3/2014.119542363
24
79RA 5-1GTTGAACGTGCCTTCAGTTTACAbalone RLO16s78Nate5/8/2013SJW22158AF133090AGAGTTTGATCCTGGCTCAGAATGAACGCTAGCGGTAGGCTTAATACATGCAAGTTGAACGTGCCTTCAGTTTACTGAAGGCAAGTAGCAGACGGGTGAGTAATGCTTGGAAATCTACTCAGAAGACATGAATAACTATCAGAAATGGTAGCTAATACAAGATAATACCCTGAGGGGGAAAGGTTTATTCCGCTTTTGAATGAGTCCAAGTTAGATTAGTTAGTTGGTGGGGTAAATGCCTACCAAGACGATGATCTATAGCTGGNTTGAGAGAATGATCAGNCACACTGGAACTTGAGACACGGTCCAGACTTCTACGGAAGGCAGCAGTAGGGAATCATGGACAATGGGCGCAAGCCTGATCCTGCATACCGNATGAGTGAAGAAGGCCTTAGGGTTGTAAAGCTCTTTTAGTGGGGAAGATAATTGACGGTACCCACAGAAAAAGTCCCGGCTAACTTTGTGCCAGCAGCCGCGGTAATACAAAGGGGGCAAGCGTTATTCGGAATTACTGGGTGTAAAGGGTGTGTAGGTGGTTTAGTAAGTTGAAAGTGAAATTCCAGAGCTTAACTTTGGCATTGCTTTCAAAACTACTATAACTAGAGTTAGATAGAGGGTAACAGAATTCCTAGTGTAAAGGTGGAATTTGTAGATATTAGGAGGAATACCAGAGGTGAAGACGGTTGCCTGGGGTCTATACTGACACTGAGACACGAAGGCATGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCATGCTGTAAACGATGAGTGCTAAATGTCAGGGTTTTTACCTTGGTATTGTAGCTAACGCATTAAGCACTCCACCTGGGGATTACGGTCGCAAGACTAAAACTCAAAGGAATTGACGGGGACCTGCACAAGCGGTGGAGTATGTTGCTTAATTCGATGCAACGCGCATAACCTTACCCTTTCTTGACATGAAGAACTAAATCCATTTTAACAGATGGCCTCAGTTTGGCTGGGTTCTTCACAGGTGTTGCATGACTGTCGTCAGCTCGGTGTCGTGAGATGTTGGGTTAAGTCCCATAACGAGCGCAACCCCTATCTTTAGTTGCCAGCGAGTAATGTCGGGAACTTTTAAAGAAACTGCCAGCGATAAGTTTGGAGGAAGGTGGGGATGACGTCAAGTCATCATGGCCCTTATGAGGGGGGCTGCAAACGTACTACAATGGCAACTACAATGAGAAGCAATATTGTGAGATAAAGCAAATCTCTTAAAAGTTGTCTCAGTTCAGATTGTTCTCTGCAACTCGGGAACATGAAGTAGGAATCGCTAGTAATCGTGGATCACCATGTCACGGTGAATACGTTCTCAGGTCTTGTACACACTGCCCGTCACGCCATGGGAGCCGTCCATACTTTAAAGTGGCAATTCAACCTGTTTTTCAGGAGATAACCACTCACAGTGGGGGCGACAACTGGGGTGAAGTCGTAACAAGGTAACAGTAGGTGAACCTGCGGCTGGATCACCTCCTT54-7593952212
25
78RA 3-6ACTTGGACTCATTCAAAAGCGGAAbalone RLO16s79Nate5/8/2013SJW23158AF133090AGAGTTTGATCCTGGCTCAGAATGAACGCTAGCGGTAGGCTTAATACATGCAAGTTGAACGTGCCTTCAGTTTACTGAAGGCAAGTAGCAGACGGGTGAGTAATGCTTGGAAATCTACTCAGAAGACATGAATAACTATCAGAAATGGTAGCTAATACAAGATAATACCCTGAGGGGGAAAGGTTTATTCCGCTTTTGAATGAGTCCAAGTTAGATTAGTTAGTTGGTGGGGTAAATGCCTACCAAGACGATGATCTATAGCTGGNTTGAGAGAATGATCAGNCACACTGGAACTTGAGACACGGTCCAGACTTCTACGGAAGGCAGCAGTAGGGAATCATGGACAATGGGCGCAAGCCTGATCCTGCATACCGNATGAGTGAAGAAGGCCTTAGGGTTGTAAAGCTCTTTTAGTGGGGAAGATAATTGACGGTACCCACAGAAAAAGTCCCGGCTAACTTTGTGCCAGCAGCCGCGGTAATACAAAGGGGGCAAGCGTTATTCGGAATTACTGGGTGTAAAGGGTGTGTAGGTGGTTTAGTAAGTTGAAAGTGAAATTCCAGAGCTTAACTTTGGCATTGCTTTCAAAACTACTATAACTAGAGTTAGATAGAGGGTAACAGAATTCCTAGTGTAAAGGTGGAATTTGTAGATATTAGGAGGAATACCAGAGGTGAAGACGGTTGCCTGGGGTCTATACTGACACTGAGACACGAAGGCATGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCATGCTGTAAACGATGAGTGCTAAATGTCAGGGTTTTTACCTTGGTATTGTAGCTAACGCATTAAGCACTCCACCTGGGGATTACGGTCGCAAGACTAAAACTCAAAGGAATTGACGGGGACCTGCACAAGCGGTGGAGTATGTTGCTTAATTCGATGCAACGCGCATAACCTTACCCTTTCTTGACATGAAGAACTAAATCCATTTTAACAGATGGCCTCAGTTTGGCTGGGTTCTTCACAGGTGTTGCATGACTGTCGTCAGCTCGGTGTCGTGAGATGTTGGGTTAAGTCCCATAACGAGCGCAACCCCTATCTTTAGTTGCCAGCGAGTAATGTCGGGAACTTTTAAAGAAACTGCCAGCGATAAGTTTGGAGGAAGGTGGGGATGACGTCAAGTCATCATGGCCCTTATGAGGGGGGCTGCAAACGTACTACAATGGCAACTACAATGAGAAGCAATATTGTGAGATAAAGCAAATCTCTTAAAAGTTGTCTCAGTTCAGATTGTTCTCTGCAACTCGGGAACATGAAGTAGGAATCGCTAGTAATCGTGGATCACCATGTCACGGTGAATACGTTCTCAGGTCTTGTACACACTGCCCGTCACGCCATGGGAGCCGTCCATACTTTAAAGTGGCAATTCAACCTGTTTTTCAGGAGATAACCACTCACAGTGGGGGCGACAACTGGGGTGAAGTCGTAACAAGGTAACAGTAGGTGAACCTGCGGCTGGATCACCTCCTT215-19293952211
26
77PerkITS-85CCG CTT TGT TTG GAT CCCP.marinusITS76http://www.oie.int/fileadmin/Home/eng/Health_standards/aahm/2010/2.4.05_P_MARINUS.pdf4/29/2013SJW93704262
27
76PerkITS-750ACA TCA GGC CTT CTA ATG ATGP.marinusITS77http://www.oie.int/fileadmin/Home/eng/Health_standards/aahm/2010/2.4.05_P_MARINUS.pdf4/29/2013SJW93704263
28
75WSN1FagtttactgaaggcaagtagcAbalone RLO16s7411/16/2012SJW21
29
74WSN1RtctaacttggactcattcaaaaAbalone RLO16s7511/16/2012SJW22
30
73Univ_18S_rDNA_1134RTTTAAGTTTCAGCCTTGCGUniversal18S rDNA72Bower et al. 20042004544Annealing temp 60.6C
31
72Univ_18S_rDNA_581FGTGCCAGCAGCCGCGUniversal18S rDNA73http://www.ncbi.nlm.nih.gov/pubmed/152187022004544
32
71M60313 - P1agagtttgatcctggctcagAnaplasma 16S70Noaman & Shayan 201010/8/2012elene781
33
70M60313 - P2agcactcatcgtttacagcgAnaplasma16S71http://www.sid.ir/en/VEWSSID/J_pdf/128920100205.pdf10/8/2012elene781
34
69ESP-FagtccacgctgtaaacgatgagEhrlichia and Anaplasma16S68http://online.liebertpub.com/doi/pdfplus/10.1089/15303660376562742410/8/2012elene116
35
68ESP-RttcctttgagttttagtcttgcgacEhrlichia and Anaplasma16S69Kim et al.10/8/2012elene116
36
6799FTTG TAG CCT GCT ATG GTA TAA CTWolbachia 16S66Zimmermann et al. 201210/8/2012elene50.6900
37
66 994RGAA TAG GTA TGA TTT TCA TGTWolbachia 16S67Zimmermann et al. 201210/8/2012elene50.6900
38
65Rp877pGGGGACCTGCTCACGGCGGRickettsialesgltA64http://ijsb.sgmjournals.org/content/47/2/252.full.pdf10/8/2012elene396
39
64Rp1258nATTGCAAAAAGTACAGTGAACARickettsialesgltA65http://ijsb.sgmjournals.org/content/47/2/252.full.pdf10/8/2012elene396
40
63EHR16SDggtaccyacagaagaagtccerlichiae including E. canis, E. chaVeensis, E. muris,
E. ruminantium, Anaplasma phagocytophilum, A. platys,
A. marginale, A. centrale, Wolbachia pipientis, Neorickettsia sennetsu, N. risticii, and N. helminthoeca
16s62http://ac.els-cdn.com/S0035920300902438/1-s2.0-S0035920300902438-main.pdf?_tid=656d4870-1175-11e2-ab04-00000aab0f27&acdnat=1349720848_ddbe459e4ebc2ec19b6ee47913f0b79b10/8/2012elene345
41
62EHR16SRtagcactcatcgtttacagc"16s63Parloa et al. 200010/8/2012elene345
42
61ALF684RTACGAATTTYACCTCTACAalphaproteobacteria16S rRNA
43
60ALF28FARCGAACGCTGGCGGCAalphaproteobacteria16S rRNA
44
59ADF681FAGTGTAGAGGTGAAATTalphaproteobacteria 16S rRNA
45
58ADF1392Racgggcggtgtgtacaalphaproteobacteria16S rRNA
46
57447R2 (Rick-R)GTGGAGAAGATAATGACGGTATcoral-associated Rickettsiales 1 (CARI)Casas et al. 2004
47
5687F2 (Rick-F)AAATAAAGTTAGTGGCAAACGGGTGcoral-associated Rickettsiales 1 (CARI)Casas et al. 2004
48
55CAR1C_RTCCCCCACGCTTTCGTGCAAAcropora cervicornisRickettsiales 1 (CAR1)52Sammi8/17/2012Sammi2060.00%59.2687DQ007350.1701-682
49
54CAR1B_R CGCCTACGCACGCTTTACGCAcropora cervicornisRickettsiales 1 (CAR1)52Sammi8/17/2012Sammi2065.00%59.39496DQ007350.1510-491
50
53CAR1A_RCCTGTTTGCTCCCCCACGCTAcropora cervicornisRickettsiales 1 (CAR1)52Sammi8/17/2012Sammi2065.00%59.27696DQ007350.1710-691
51
52CAR1_F ACACATGCAAGTCGAACGGACGAcropora cervicornisRickettsiales 1 (CAR1)53, 54, 55Sammi8/17/2012Sammi2254.55%58.14DQ007350.115-36
52
51Univer_microspRTTATGATCCTGCTAATGGTTCTCCmicrosporidianSSU rRNA50David et al 19968/13/2012elene1300
53
50Univer_microspFCACCAGGTTGATTCTGCCTGACGmicrosporidianSSU rRNA51Fournier et al_20008/13/2012elene1300
54
49AbSV_3F3TGCCTAAAATTCACACAAACTabalone shriveling syndrome-associated virusORF248Jiang et al, 20128/10/2012Sam21191EU350361469-489
55
48AbSV_3B3ACAGACAAAATGTTTTTCATCGabalone shriveling syndrome-associated virusORF249Jiang et al, 20128/10/2012Sam22191EU350361660-639
56
471389RACG GGC GGT GTG TAC AAGProkaryoteUniversal 16SrDNA44Marchesi et al. 19987/30/2012elene541380
57
46907RCCG TCA ATT CCT TTR AGT TTProkaryoteUniversal V1-V543Lane et al. 19857/30/2012elene54884
58
45519RGWA TTA CCG CGG CKG CTG ProkaryoteUniversal V2-V342Turner et al. 19997/30/2012elene59456
59
449FGAG TTT GAT CCT GGC TCA GProkaryoteUniversal 16SrDNA47Yoon et al. 19987/30/2012elene541380
60
4323FTGC AGA YCT GGT YGA TYC TGC CProkaryoteUniversal V1-V546Burggraf et al. 19917/30/2012elene54884
61
4263FCAG GCC TAA CAC ATG CAA GTCProkaryoteUniversal V2-V345Marchesi et al. 19987/30/2012elene59456
62
41Oly_Hemicentin_FTGCAGTCTTGGAAGTCAGCAGACGAO.luridaDM7/30/2012Sam87131848
63
40Oly_Isoleucyl_tRNA_FAAGGCCCGGAGGATGTGGAGAAAATO.luridaIsoleucyl-tRNA synthetaseDM7/25/2012SamOstrea_lur_contig29283Ostrea_lur contig #s from Stevens .fasta file found here.. https://www.evernote.com/shard/s10/sh/97c8da2f-1262-4d58-b3be-4a0de2122f9e/97d072a0f80ad80039089a11cadb6dca87029850
64
39Oly_Isoleucyl_tRNA_RTCGACCAAGGCGTGTCACAATCTCTO.luridaIsoleucyl-tRNA synthetaseDM7/25/2012SamOstrea_lur_contig2928387029851
65
38Oly_Hemicentin_FACATGGACGTCTTGGGGAGCTTGTTO.luridaHemicentin-1DM7/25/2012SamOstrea_lur_contig35387029852
66
37Oly_Hemicentin_RACATGGACGTCTTGGGGAGCTTGTTO.luridaHemicentin-1DM7/25/2012SamOstrea_lur_contig35387029853
67
36Oly_GPx3_FTTGCCGCGATACTCCGACAAACTTO.luridaGlutathione peroxidase 3DM7/25/2012SamOstrea_lur_contig205287029854
68
35Oly_GPx3_RTCTCTCGCCGCAATGGCGTTTTTAO.luridaGlutathione peroxidase 3DM7/25/2012SamOstrea_lur_contig205287029855
69
34Oly_Calmodulin_FAGGCAGATATAGATGGCGACGGTCAO.luridaCalmodulinDM7/25/2012SamOstrea_lur_contig250987029856
70
33Oly_Calmodulin_RGCCTCGGCATTCTACTTGTTCGTCAO.luridaCalmodulinDM7/25/2012SamOstrea_lur_contig250987029857
71
32Oly_Arylsulfatase_FACGTCGGTGCGTTCGGAAATAACAO.luridaArylsulfataseDM7/25/2012SamOstrea_lur_contig59187029858
72
31Oly_Arylsulfatase_RGGTGCGTCAGTTTAATCCCGTCGTTO.luridaArylsulfataseDM7/25/2012SamOstrea_lur_contig59187029859
73
30Oly_HydroxySter_FACTCAAACAGGTGCACGATGGTGTTTO.lurida3-beta-hydroxysteroid sulfotransferaseDM7/25/2012SamOstrea_lur_contig1174187029860
74
29Oly_HydroxySter_RCCTGGCCATGAAATCTTTGGGCATGTO.lurida3-beta-hydroxysteroid sulfotransferaseDM7/25/2012SamOstrea_lur_contig1174187029861
75
28Vibrio tubiashiirseASR elene
76
27Vibrio tubiashiirseASR elene
77
26EB450ACTCAGGTGTTATAC TCACCTGMicrosporidia spp.SSU rRNA gene of E. bieneusi23 - V1Muller et al. 19996/28/2012elene353
78
25SI500CTCGCTCCTTTACACTCGMicrosporidia spp. SSU rRNA gene of E. bieneusi23 - V1Muller et al. 19996/28/2012elene375
79
24PMP2CCTCTCCGGAACCAAACCCTGMicrosporidia spp.SSU rRNA gene of E. bieneusi23 - V1Muller et al. 19996/28/2012elene250
80
23V1CACCAGGTTGATTCTGCCTGACMicrosporidia spp.SSU rRNA gene of E. bieneusi24, 25, 26Muller et al. 19996/28/2012elene250
81
2216S/23S ReverseCCT TTC CCT CAC GGT ACT GVibrio16S/23S21Published in Lee et al. 20021/12/2010elene~500
82
2116S/23S ForwardTTG TAC ACA CCG CCC GTCVibrio16S/23S22Published in Lee et al. 20021/12/2010elene~500
83
20VptA ForwardcaaatgctttggctgattgctVibrioVtpA19Published in Gharaibeh et al. 20091/26/2012elene
84
19VptA ReverseccatctctgcggctgtaactgVibrioVtpA20Published in Gharaibeh et al. 20091/26/2012elene
85
18VtpR ForwardcagcatgaccaccgcgaccaVibrio tubiashiiVtpR17Hasegawa et al. 20097/28/2012elene50.00%98
86
17VtpR ReversegcgtacgcgtctttcaccacaVibrio tubiashiiVtpR18Hasegawa et al. 20097/28/2012elene50.00%98
87
16Vt chiA RCGTACCTGTGCCTGTCATTGVibrio tubiashiichiA158/9/2010elene50.00%146
88
15Vt chiA FCGGACAACGGTATTCAGCTTVibrio tubiashiichiA168/9/2010elene55.00%146
89
14Vt 16S FCAGCCACACTGGAACTGAGAVibrio tubiashii16S13Developed by robert's lab4/7/2011elene55.00%203
90
13Vt 16S RGTTAGCCGGTGCTTCTTCTGVibrio tubiashii16S14Developed by robert's lab4/7/2011elene55.00%203
91
12Universal 16S - 27FAGA GTT TGA TCC TGG CTC AGUniv16S114/7/2011elene
92
11Universal 16S - 1492RGGT TAC CTT GTT ACG ACT TUniv16S124/7/2011elene
93
10M13 - Forward (-20)GTAAAACGACGGCCAGE. coliM139Topo4/11/2011elene201 + product
94
9M13 - ReverseCAGGAAACAGCTATGACE. coliM1310Topo4/12/2011elene201 + product
95
8Geoduck 18S RTCGGCACGCCAGAGAGCAGAPanopea spp.18S7Becker et al. 20126/21/2012elene65.00%271
96
7Geoduck 18S FCCGCACACGCGCTACACTGAPanopea spp.18S8Becker et al. 20126/21/2012elene65.00%271
97
6Microsporidia 580RGGT CCG TGT TTC AAG ACG GMicrosporidia spp.non-specificMicrosporidia 530FValencakova et al. 20116/19/2012elene
98
5Microsporidia 530FGTG CCA GCA GCC GCG GMicrosporidia spp.non-specificMicrosporidia 580RValencakova et al. 20116/19/2012elene
99
4Ricket386RGGCGAAAGCCTGATCCAGCGACGTCAAcropora cervicornisRickettsiales 1 (CAR1)Ricket207FCasas et al 20044/20/2012Sammi2661.50%66.4
100
3Ricket207FGCAAGATAAGCCCATGCAAGAcropora cervicornisRickettsiales 1 (CAR1)Ricket386RCasas et al 20044/20/2012Sammi2050.00%54.5
Loading...