All Rounds to 95
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQR
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
Round
Length
RepARepU
RepG
RepC
2
1Slalom Take 2Project : Thicker Zigzag769718-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGCUCGCAGGAGUACGAAAAGUACCCAUGGAGCAAAAAAAAAGGACGUUCGCGUCCUUAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.437
medium
86.70.0550.6060.33R00.010721223
3
2d+m plots weaker againProject : Thicker Zigzag769337-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUGCAUCAUACGAUAAAAGGUUGAUAGAGUAUAAAAAAACUGUGUCUUCGGACACAGAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
3.227
medium
68-0.0050.8150.405R00.010721221
4
3d+m plots weakerProject : Thicker Zigzag769330-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUGCAUGCUACGACAAAAAGUUGAGACAGUACAAAAAAAAUAGGUCUUCGGACCUAUAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
2.59
medium
70.70.0420.8060.424R00.010721222
5
4d+m plots Project : Thicker Zigzag769323-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUCCAGGCGACCACAAAAAGUGGCGACCGGACAAAAAAAAUCGAACUUCGGUUCGAUAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.012
medium
73.300.6850.343R00.010721222
6
5Fiskers thick zigzag 3Project : Thicker Zigzag767147-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUUGACCCGACAUGGAAAACAUGCGAGGCAACAAAAAAAUGUCUACUUCGGUAGACAAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
2.13
medium
89.30.030.6550.343R00.010721223
7
6Fiskers thick zigzag 2Project : Thicker Zigzag767144-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUCGACCCGACGAGGAAAACUCGCGAGGCGACAAAAAAAGAUCGCGUUCGCGCGAUCAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.491
medium
81.30.0530.6810.367R00.010721223
8
7Fiskers thick zigzagProject : Thicker Zigzag767138-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUUGACCCGACGAGGAAAACUCGCGAGGCAACAAAAAAAGAUCUUCUUCGGAAGAUCAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
0.872weak8400.6920.346R00.010721223
9
8Slalom take 1Project : Thicker Zigzag766907-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGCUCGCAGUAGUACGAAAAGUACACAUGGAGCAAAAAAAUACCUACUUCGGUAGGUAAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
2.729
medium
840.0570.6960.377R00.010721222
10
9ZIG 1Project : Thicker Zigzag766797-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAACGUGCGGCGACUAGGAAAACUAGCGACCCACGAAAAAAAGCCACAGUUCGCUGUGGCAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
2.295
medium
86.70.0550.6910.373R00.010721223
11
10-9.3 kcalProject : Thicker Zigzag766206-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAUAUCGCCCGACUAUGAAAGAUAGCGAGGGAUAAAAAAAAGUGCUGCUUCGGCAGCACAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.824
medium
77.30.0670.740.404R00.010721233
12
11-9.3 kcalProject : Thicker Zigzag766205-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAUAUCGCCCGAGUAUGAAAGAUACCGAGGGAUAAAAAAAACGCUUGCUUCGGCAAGCGAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
2.934
medium
760.070.7650.417R00.010721233
13
12Nuttier than a Snickers BarProject : Thicker Zigzag766144-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAACACUACGGGAUGAGAAAAACUCGCCACGAGUGAAAAAAAGGAUUGCUUCGGCAAUCCAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.741
medium
77.30.0610.6730.367R00.010721232
14
13Attempt 1Project : Thicker Zigzag766141-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUAGAGCCGAGUACAAAAAGUACCGAGCCUACAAAAAAAGUCACAGUUCGCUGUGACAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
2.058
medium
82.70.0580.7320.395R00.010721222
15
14RepeatProject : Thicker Zigzag766138-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAACAUGAGGCCACUAGAAAAACUAGGGACCCAUGAAAAAAAUCUACACUUCGGUGUAGAAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
2.18
medium
86.70.0610.6720.367R00.010721233
16
15Steve s thicker zigzagProject : Thicker Zigzag766016-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAACAUGACGGCAGCACGAAAAGUGCGCGCGCAUGAAAAAAAGGCUAACUUCGGUUAGCCAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.484
medium
840.0530.6410.347R00.010721222
17
16Starry s New Zigzag IIIProject : Thicker Zigzag765800-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGAUCAUCUGACUCGGAAAACGAGCAUGAGAUCAAAAAAACUAAAGGUUCGCCUUUAGAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
2.099
medium
77.30.0690.7610.415R00.010721322
18
17Starry s New Zigzag IIProject : Thicker Zigzag765795-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGAUCAUCAGACUCGGAAAACGAGCUAGAGAUCAAAAAAAAGUAAGGUUCGCCUUACUAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.444
medium
86.70.0750.8350.455R00.010721222
19
18B - TZ - 3Project : Thicker Zigzag765787-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUGUACCGGAUCUCAAAAAGAGGCCAGGACACAAAAAAAGUAAGGCUUCGGCCUUACAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
0.931weak78.700.70.35R00.010721222
20
19Starry s New Zigzag IProject : Thicker Zigzag765786-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGAUCAGCCGACUAGGAAAACUAGCGAGCGAUCAAAAAAAUGGAAAGUUCGCUUUCCAAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.813
medium
800.0780.8550.466R00.010721322
21
20B - TZ - 2Project : Thicker Zigzag765779-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUACAGCGCAGAUCAAAAAGAUCGCAGCGUACAAAAAAAGUUGUAGUUCGCUACAACAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.728
medium
86.70.070.8010.435R00.010721221
22
21B - TZ - 1Project : Thicker Zigzag765776-1
GGAAAAAAAAAAAAAAAAAAAAACAAAAAGUACACGGCACAUGAAAAACAUGGCACGGUACAAAAAAACUUGAAGUUCGCUUCAAGAAAAGAAACAACAACAACAAC
.............................((((.((((.((((.....)))))).)))))).......(((((((....))))))).....................
1.874
medium
880.0420.620.331R00.010721221
23
22bad solutionProject : Test of RNAfold (5)
WTF762872-1
GGAAAAUCUGUAACAGAAAAAUAGGAGAGCUGUUCUGAAUUGAUUGAAAACGAGAGCAAAAAUAGUAAAUGAGAGUUCGCUCUCAUAAAAGAAACAACAACAACAAC
........(((..((((...((((.....))))))))..(((.(((....(....)............(((((((....)))))))........))))))..)))..
1.532
medium
81.30.0961.0590.577R00.01075221
24
23test 12Project : Test of RNAfold (5)
WTF761078-1
GGAAAAAACACAAGUUCAAACGGGAAAAACCCGGAACAAGGCAGAGAAAACUCAAAGCCAAGUGUAAACUCGUCGUUCGCGACGAGAAAAGAAACAACAACAACAAC
.......((((..((((...((((.....))))))))..(((.(((....)))...)))..))))...(((((((....))))))).....................
2.728
medium
920.0830.9150.499R00.01076233
25
24RNA 1Project : Test of RNAfold (5)
WTF760226-1
GGAAAAAGUCGAAUCAGAAAGUGCGAAAAGCACCUGGAAGGGAUGGGAAACCAGAGCCUAAUGACAAACACACCGUUCGCGGUGUGAAAAGAAACAACAACAACAAC
.......((((..((((...((((.....))))))))..(((.(((....)))...)))..))))...(((((((....))))))).....................
2.613
medium
85.30.0730.8060.44R00.01075232
26
25 Bad in RNAfoldProject : Test of RNAfold (5)
WTF760068-1
GGAAAAACUGUAACUACAAAGUGUAAAAAGCACGUAGAAGCCAUGUGAGAGCAAAAGGCAAGCAGAAAUGGUCAGUUCGCUGACCAAAAAGAAACAACAACAACAAC
.......((((..((((...((((.....))))))))..(((.(((....)))...)))..))))...(((((((....))))))).....................
3.75
medium
93.30.0790.870.474R00.01075222
27
26Not sure what the MFE isProject : Test of RNAfold (5)
WTF760018-1
GGAAAAAGUGCAAGUACAAAGCACAAAAAGUGCGUACAAGUCGCACGAAAGUGAAAGACAAGCACAAACAUCUCGUUCGCGAGAUGAAAAGAAACAACAACAACAAC
.......((((..((((...((((.....))))))))..(((.(((....)))...)))..))))...(((((((....))))))).....................
3.633
medium
880.0710.7860.429R00.01075221
28
27 Good in RNAfoldProject : Test of RNAfold (5)
WTF759736-1
GGAAAAAGAUCAAGCUGAAAGUACGAAAAGUACCAGCAAGGGAGUGGAAACACGAGCCCAAGAUCAAAUCACUUCUUCGGAAGUGAAAAAGAAACAACAACAACAAC
.......((((..((((...((((.....))))))))..(((.(((....)))...)))..))))...(((((((....))))))).....................
2.082
medium
98.70.0790.8740.477R00.01075233
29
28Still can t access RNA foldProject : Test of RNAfold (4)
WTF766176-1
GGAAAAACACGAACACGAAAGUGAAGCAGAAAAGACGCUGCAAAGCAGAAGUCGGCUGCAACGUGAAAUGUCAGGUUCGCCUGACAAAAAGAAACAACAACAACAAC
.......((((..(((....)))..((((....(((.((((...))))..)))..))))..))))...(((((((....))))))).....................
4.184
medium
89.30.0660.7230.395R00.01075222
30
29RNA 1Project : Test of RNAfold (4)
WTF760240-1
GGAAAAACAUCAACAGGAAACUGAAGUCCAAAGGUGAGCAUUUCAUGCGGCACAAGGACAAGAUGCAACUACGUCUUCGGACGUAGAAAAGAAACAACAACAACAAC
.......((((..(((....)))..((((....(((.((((...))))..)))..))))..))))...(((((((....))))))).....................
3.546
medium
89.30.0670.7350.401R00.01075322
31
30 Good in RNAfoldProject : Test of RNAfold (4)
WTF759716-1
GGAAAAAGUACAAGUCGAAAGACAAGCUCGAAAGGGAGUGCAAAGCACGGCCCGAGAGCAAGUACAAAAGCUUGCUUCGGCAAGCUAAAAGAAACAACAACAACAAC
.......((((..(((....)))..((((....(((.((((...))))..)))..))))..))))...(((((((....))))))).....................
1.195
medium
840.070.7740.422R00.01075233
32
31 Bad in RNAfold (1)Project : Test of RNAfold (4)
WTF759713-1
GGAAAAACAUCAACACGAAAGUGAAGUCCAAAAGCGAGCAUUUUAUGCGGCGCAAGGACAAGAUGAAAGUAGGACUUCGGUCCUACAAAAGAAACAACAACAACAAC
.......((((..(((....)))..((((....(((.((((...))))..)))..))))..))))...(((((((....))))))).....................
3.045
medium
85.30.0650.7150.39R00.01075422
33
32 Bad in RNAfold (1)Project : Test of RNAfold (4)
WTF759711-1
GGAAAAACAUCAACACGAAAGUGAAGUACGAAAGUGAGACGAAACGUCGGCACGAGUACAAGAUGAAAAGCCACGUUCGCGUGGCUAAAAGAAACAACAACAACAAC
.......((((..(((....)))..((((....(((.((((...))))..)))..))))..))))...(((((((....))))))).....................
1.884
medium
90.70.0850.9340.509R00.01075222
34
33RNA 1Project : Test of RNAfold (3)
WTF760257-1
GGAAAAACAUGAACAGGAAACUGAAACUAUGAAGAUACCAGAAAAACUGCGUAUAAAAUAGCAUGCAAGGAUACGUUCGCGUAUCCAAAAGAAACAACAACAACAAC
.......((((..(((....)))...((((....(((((((.....))).))))...))))))))...(((((((....))))))).....................
4.177
medium
94.70.0740.8140.444R00.01075222
35
34 Bad in RNAfold - (3)Project : Test of RNAfold (3)
WTF759722-1
GGAAAAACAUGAACGUGAGAGCGAAACUGUAAAAGCUCGGUAAAAAGCCAGAGUAAAGCAGCAUGAAAAGUCUGCUUCGGCAGACUAAAAGAAACAACAACAACAAC
.......((((..(((....)))...((((....(((((((.....))).))))...))))))))...(((((((....))))))).....................
2.343
medium
89.30.0780.8570.468R00.01075222
36
35 Bad in RNAfold - (3)Project : Test of RNAfold (3)
WTF759720-1
GGAAAAACAUGAACGUGAGAGCGAAACUAGAAAACAUGGGUGAGAAGCCACAUGAAACUAGCAUGAAAGAUGAUCUUCGGAUCAUCAAAAGAAACAACAACAACAAC
.......((((..(((....)))...((((....(((((((.....))).))))...))))))))...(((((((....))))))).....................
2.082
medium
85.30.0720.7920.432R00.01075232
37
36 Good in RNAfold - (3)Project : Test of RNAfold (3)
WTF759719-1
GGAAAAAGUACAAGUCGAAAGACAAAGGAGAAAAGAUGGCCGAAAAGGCACAUCGAGCUCCGUACAAAUGUUGUCUUCGGACAACAAAAAGAAACAACAACAACAAC
.......((((..(((....)))...((((....(((((((.....))).))))...))))))))...(((((((....))))))).....................
2.863
medium
880.0790.8650.472R00.01075222
38
37DarkRNAFold20001Project : Test of RNAfold (2)
WTF765460-1
GGAAAAAGUAUCAAAAGAUACAAAAAAAAAGUAUCGUACAAAAGUACAAAAAGAUACAAAAAAAAAAAGGUUUCGUUCGCGAAACCAAAAGAAACAACAACAACAAC
.......(((((....(((((.........)))))((((....)))).....)))))...........(((((((....))))))).....................
3.119
medium
960.0870.9580.522R00.010711322
39
38RNA 1Project : Test of RNAfold (2)
WTF760270-1
GGAAAAACAUAGAAAACUUUGAAAAAAAACCAGAGCAGGGAAACUUGAAAAACUGUGAAAAAAAAAAACAUCGGCUUCGGCCGAUGAAAAGAAACAACAACAACAAC
.......(((((....(((((.........)))))((((....)))).....)))))...........(((((((....))))))).....................
3.137
medium
82.70.0560.9160.486R00.010711332
40
39 Bad in RNAfold (2)Project : Test of RNAfold (2)
WTF759728-1
GGAAAAACAGAUAAAAGUAGUAAAAAAAAAGCUACGACUAAAAAGUCAAAAAGUCUGAAAAAAAAAAACUUCUCGUUCGCGAGAAGAAAAGAAACAACAACAACAAC
.......(((((....(((((.........)))))((((....)))).....)))))...........(((((((....))))))).....................
4.899
medium
94.70.0931.0260.56R00.010711221
41
40 Bad in RNAfold (2)Project : Test of RNAfold (2)
WTF759726-1
GGAAAAACAGAUAAAACUAGUAAAAAAAAAGCUAGCUAUGAGAGUAGAAAAAGUCUGAAAAAAAAAAACGGUACGUUCGCGUACCGAAAAGAAACAACAACAACAAC
.......(((((....(((((.........)))))((((....)))).....)))))...........(((((((....))))))).....................
4.339
medium
93.30.080.8840.482R00.010711222
42
41 Good in RNAfold (2)Project : Test of RNAfold (2)
WTF759724-1
GGAAAAAGUGACAAAAGCUACGAAAAAAAAGUAGCGAUCGAAAGAUCAAAAAGUCACAAAAAAAAAAAUGUCGUCUUCGGACGACAAAAAGAAACAACAACAACAAC
.......(((((....(((((.........)))))((((....)))).....)))))...........(((((((....))))))).....................
3.792
medium
97.30.0780.8580.468R00.010711221
43
42DarkRNAFold0001Project : Test of RNAfold (1)
WTF765457-1
GGAAAAAGUCGACAAAAGUCAGCAAAAAGCAAGACGUACAAAAGUACAAAAAGUCAGACAAAAAAAAACUGCAGCUUCGGCUGCAGAAAAGAAACAACAACAACAAC
.......((((((....(((.((.....))..)))((((....)))).....))).))).........(((((((....))))))).....................
4.245
medium
93.30.0971.0670.582R00.01079221
44
43RNA 1Project : Test of RNAfold (1)
WTF760275-1
GGAAAAACUCCACAAAAGUCGGCAAAAAGCAAGACGUACGAAAGUACAAAAAGUGCGAGAAAAAAAAAUGCUCAGUUCGCUGAGCAAAAAGAAACAACAACAACAAC
.......((((((....(((.((.....))..)))((((....)))).....))).))).........(((((((....))))))).....................
5.41good94.70.0840.920.502R00.01079222
45
44B - ToRNAf - 3 V2 (Boostless)Project : Test of RNAfold (1)
WTF759729-1
GGAAAAAGGCCACAAAAGUCAGCAAAAAGCGAGACGUACAAAAGUACAAAAAGUGAGCCAAAAAAAAACAGAACGUUCGCGUUCUGAAAAGAAACAACAACAACAAC
.......((((((....(((.((.....))..)))((((....)))).....))).))).........(((((((....))))))).....................
4.87
medium
960.0951.0490.572R00.01079222
46
45B - ToRNAf - 3 (Even Better)Project : Test of RNAfold (1)
WTF759727-1
GGAAAAAGGCCACAAAAGUCAGCUAAAUGCGAGACGUACGAAAGUACAAAAAGUGAGCCAAAAAAAAAUAUCCACUUCGGUGGAUAAAAAGAAACAACAACAACAAC
.......((((((....(((.((.....))..)))((((....)))).....))).))).........(((((((....))))))).....................
5.123good94.70.080.8750.477R00.01079222
47
46B - ToRNAf - 2 (Good)Project : Test of RNAfold (1)
WTF759721-1
GGAAAAAGUGCUCAAAAGUCAGCGAAAAGCGAGACGUACGAAAGUACAAAAAGAGACACAAAAAAAAAUGAACGGUUCGCCGUUCAAAAAGAAACAACAACAACAAC
.......((((((....(((.((.....))..)))((((....)))).....))).))).........(((((((....))))))).....................
6.179good94.70.0760.8380.457R00.01079222
48
47 Bad in RNAfoldProject : Test of RNAfold (1)
WTF759708-1
GGAAAAAGUGCACAAAAGGGAGUGAAAAGCGGCCCGACUGAGAGGUCAAAAAGUGACACAAAAAAAAACCUUUCGUUCGCGAAAGGAAAAGAAACAACAACAACAAC
.......((((((....(((.((.....))..)))((((....)))).....))).))).........(((((((....))))))).....................
6.575good90.70.0820.8970.489R00.01079333
49
48 Good in RNAfold 2Project : Test of RNAfold (1)
WTF759704-1
GGAAAAAGUGCACAAAAGGCAGCGAGAAGCAAGCCGACUGAGAGGUCAAAAAGUGACACAAAAAAAAAGUGGUGCUUCGGCACCACAAAAGAAACAACAACAACAAC
.......((((((....(((.((.....))..)))((((....)))).....))).))).........(((((((....))))))).....................
2.95
medium
89.30.0690.7620.416R00.01079222
50
49 Good in RNAfoldProject : Test of RNAfold (1)
WTF759702-1
GGAAAAAGUGCCCAAAAGCCAGCGAAAAGCGAGGCCAUCGAAAGAUGAAAAAGGGACACAAAAAAAAAGACUAACUUCGGUUAGUCAAAAGAAACAACAACAACAAC
.......((((((....(((.((.....))..)))((((....)))).....))).))).........(((((((....))))))).....................
3.885
medium
93.30.070.7730.421R00.01079233
51
50Clean dotplot + melt + 1GUProject : Multiloop: Two Pairs of Adjacent Stacks
WTF766435-1
GGAAAAAGUUGCAAAAAAGCAUGAAAGUGCGCUGGAAACAGCAAAAAAGAGCGAAAGCUCGCAACAAAAUCUUCGUUCGCGAAGAUAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
2.159
medium
93.30.0650.7180.391R00.01076221
52
51Clean dotplot + meltProject : Multiloop: Two Pairs of Adjacent Stacks
WTF766434-1
GGAAAAAGUUGCAAAAAAGCAUGAAAAUGCGCUGGAAACAGCAAAAAAGAGCGAAAGCUCGCAACAAACGAGCAGUUCGCUGCUCGAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
3.022
medium
94.70.0680.7460.407R00.01076221
53
52WeaknessProject : Multiloop: Two Pairs of Adjacent Stacks
WTF766395-1
GGAAAAAGUUGUAAAAAAUUAUGAAAGUGAAUUCGAAAGAGUAAAAAAACGAGAAAUUGUAUAACAAAUGACGAGUUCGCUCGUCAAAAAGAAACAACAACAACAAC
.......(((((..............((..((((....))))......((((....))))...))...(((((((....))))))).......))))).........
2.921
medium
82.70.021.0010.51R00.01077221
54
53Fiskers 2 go at Multiloop: Two pairs of adjacent stacksProject : Multiloop: Two Pairs of Adjacent Stacks
WTF765781-1
GGAAAAACAUACAAAAAAGUACGAAAGUACGAUCGAAAGAUCAAAAAAGAUCGAAAGAUCGUAUGAAAUAAGUCGUUCGCGACUUAAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
2.499
medium
90.70.0710.7760.423R00.01076221
55
54Fiskers go at Multiloop: Two pairs of adjacent stacksProject : Multiloop: Two Pairs of Adjacent Stacks
WTF765780-1
GGAAAAACAUACAAAAAACUACGAAAGUAGGAUCGAAAGAUCAAAAAACAUCGAAAGAUGGUAUGAAAGAUCAAGUUCGCUUGAUCAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
1.693
medium
86.70.0750.8250.45R00.01076221
56
55That Nothing HappensProject : Multiloop: Two Pairs of Adjacent Stacks
WTF763243-1
GGAAAAACUGUCAAAAAAGCUGGAAACAGCGAGGGAAACCUCAAAAAAGAGCGAAAGCUCGACAGAAAUCGUUAGUUCGCUAACGAAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
2.132
medium
920.0660.7290.398R00.01076232
57
56MULTI 1Project : Multiloop: Two Pairs of Adjacent Stacks
WTF760213-1
GGAAAAAGACUCAAAAAACUGGGAAACCAGGUCCGAAAGGACAAAAAACCAGGAAACUGGGAGUCAAACAUGGCGUUCGCGCCAUGAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
1.79
medium
920.0610.6670.364R00.01076232
58
57Steve s adjacent stacksProject : Multiloop: Two Pairs of Adjacent Stacks
WTF760007-1
GGAAAAAGCAUGAAAAAACAGCGAAAGCUGGUGCGAAAGCACAAAAAAGCACGAAAGUGCCAUGCAAAUAACGGCUUCGGCCGUUAAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
2.29
medium
920.0650.7170.391R00.01076222
59
58Multiloop 3Project : Multiloop: Two Pairs of Adjacent Stacks
WTF759587-1
GGAAAAAGACUCAAAAAAGUGUGAGAGCACGUCUGAGAGGACAAAAAAGCAUGAGAGUGCGAGUCAAACAAAAGGUUCGCCUUUUGAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
2.689
medium
93.30.0870.9580.523R00.01076422
60
59Multiloop 2Project : Multiloop: Two Pairs of Adjacent Stacks
WTF759586-1
GGAAAAAGACUCAAAAAACUGUGAGAGCAGGUCUGAGAGGACAAAAAAGCAUGAGAGUGCGAGUCAAAUCACCGCUUCGGCGGUGAAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
1.879
medium
920.0680.7530.411R00.01076222
61
60Multiloop 1Project : Multiloop: Two Pairs of Adjacent Stacks
WTF759585-1
GGAAAAAGACUCAAAAAACAGUGAGAGCUGGUCUGAGAGGACAAAAAAGCACAAAAGUGCGAGUCAAAGUCGUACUUCGGUACGACAAAAGAAACAACAACAACAAC
.......(((((......((((....))))((((....))))......((((....)))))))))...(((((((....))))))).....................
2.266
medium
89.30.0780.8620.47R00.01076221
62
61Fisker testing various loop designs 3Project : Testing various loop designs767277-1
GGAAAAAAACAAAAAAAAGUACGACGAAAGUCAAAGUACAAAGCAAAGUCAAAGACGCAAAAAAAAAAGGAAAGGUUCGCCUUUCCAAAAGAAACAACAACAACAAC
..................(((((((....)))...))))...((...(((...)))))..........(((((((....))))))).....................
2.025
medium
90.70.0821.1860.634R00.010710322
63
62Fisker testing various loop designs 2Project : Testing various loop designs767268-1
GGAAAAAAACAAAAAAAAGAUCGACGAAAGUCAAAGAUCAAAGCAAAGUCAAAGACGCAAAAAAAAAAAUCGUGCUUCGGCACGAUAAAAGAAACAACAACAACAAC
..................(((((((....)))...))))...((...(((...)))))..........(((((((....))))))).....................
3.883
medium
880.0661.1310.598R00.010711221
64
63Fisker testing various loop designs Project : Testing various loop designs767267-1
GGAAAAAAACAAAAAAAAGAUCGACAAAAGUCAAAGAUCAAAGCAAAGUCAAAGACGCAAAAAAAAAAUCUGCCGUUCGCGGCAGAAAAAGAAACAACAACAACAAC
..................(((((((....)))...))))...((...(((...)))))..........(((((((....))))))).....................
4.291
medium
86.70.0511.2330.642R00.010710222
65
64Loop Design 3Project : Testing various loop designs759568-1
GGAAAAAAAAUUUUUUUUGUACCACUUCGGUGUUUGUACUUUGGUUUGCGUUUCGCCCUUUUUUUUAAUGAAUCGUUCGCGAUUCAAAAAGAAACAACAACAACAAC
.((((..(((((......(((((((....)))...))))...)))))...))))....((((((((..(((((((....))))))))))))))).............
1.229
medium
73.30.060.6550.357R00.01078823
66
65Loop Design 2Project : Testing various loop designs759562-1
GGAAAAAAACAAAAAAAAGAUGGUCGAGAGACAAACAUCAAAGCAAACCGAAACGGGCAAAAAAAAAAUCUCCAGUUCGCUGGAGAAAAAGAAACAACAACAACAAC
..................(((((((....)))...))))...((...(((...)))))..........(((((((....))))))).....................
4.129
medium
920.0691.0750.572R00.010710232
67
66Loop Design 1Project : Testing various loop designs759561-1
GGAAAAAAACAAAAAAAAGAUGGCUGAGAGGCAAACAUCAAAGGAAAGCCAAAGGCCCAAAAAAAAAAAGUGAGCUUCGGCUCACUAAAAGAAACAACAACAACAAC
..................(((((((....)))...))))...((...(((...)))))..........(((((((....))))))).....................
2.239
medium
920.0461.0840.565R00.010711223
68
67Default titleProject : Testing various loop designs759273-1
GGAAAAAAACAAAAAAAAUGUACUGAAAACAGAAAUACAAACGCAAACAGAAACUGGCAGAAAAAAAAUAUACCGUUCGCGGUAUAAAAAGAAACAACAACAACAAC
..................(((.(((....(((.....................))).)))........(((((((....))))))).......)))...........6.028good90.7-0.0390.9740.467R00.01078222
69
68LD 1Project : Testing various loop designs758779-1
GGAAAAAAACAAAAAAAAGAUCCAGGAAACUGAAAGAUCAAAGCAAAGCCAAAGGCGCAAAAAAAAAAACUCGAGUUCGCUCGAGUAAAAGAAACAACAACAACAAC
..................(((((((....)))...))))...((...(((...)))))..........(((((((....))))))).....................
2.904
medium
920.0210.980.5R00.010711222
70
69messy and wrongProject : Testing various loop designs758443-1
GGAAAAAAAACAAUGUAUGCGCCGCGUUAGUGUCAGUGCUAUGGUAUGCCUUAGGCCCUAUUCAAUAAUGCGUAGUUCGCUACGCAAAAAGAAACAACAACAACAAC
.(((..............(((((((....)))...))))...((...(((...)))))..))).....(((((((....))))))).....................
7.884good82.70.0550.6070.331R00.01078223
71
70blue not yellowProject : Testing various loop designs758435-1
GGAAAAAAAAUUUUUUUUGCGCCGCGUUUGUGUUUGUGCUUUGGUUUGCCUUUGGCCCUUUUUUUUAAAACAAGCUUCGGCUUGUUAAAAGAAACAACAACAACAAC
((..(((((....)))))...))....((((..(((((((..((....))...)))..(((((((((..((((((....)))))))))))))))..))))..)))).
1.086
medium
65.30.0730.8030.438R00.01078823
72
71Where am I?Project : Testing various loop designs758304-1
GGAAAAAAACAAAAAAAGGGACCUGGAAACAGAAAGUCCAAAGCAAAGUCAAAGACGCAAAAAAAAAACUCUUAGUUCGCUAAGAGAAAAGAAACAACAACAACAAC
..................(((((((....)))...))))...((...(((...)))))..........(((((((....))))))).....................
4.144
medium
90.70.0651.2050.635R00.010710232
73
72Fisker testing various loop designs 3Project : Testing various loop designs
WTF767304-1
GGAAAACAAAAAAAAGUCAAAAGAUGGAAACAUCGACAAAGGAAAACAGGAAACUGCCAAAAAAAAAAGCGUGAGUUCGCUCACGCAAAAGAAACAACAACAACAAC
((.............(((....((((....))))))).........(((....)))))..........(((((((....))))))).....................
3.842
medium
960.0580.9670.512R00.010710222
74
73Fisker testing various loop designs 2Project : Testing various loop designs
WTF767303-1
GGAAAACAAAAAAAAGUCAAAACAUGGAAACAUGGACAAAGGAAAAGAGGAAACUCCCAAAAAAAAAAAGUCAUCUUCGGAUGACUAAAAGAAACAACAACAACAAC
((.............(((....((((....))))))).........(((....)))))..........(((((((....))))))).....................
2.461
medium
89.30.0590.9240.491R00.010711223
75
74Fisker testing various loop designsProject : Testing various loop designs
WTF767284-1
GGAAAACAAAAAAAAGUCAAAAGUAGGAAACUACGACAAAGGAAAACAGGAAACUGCCAAAAAAAAAACGUCAACUUCGGUUGACGAAAAGAAACAACAACAACAAC
((.............(((....((((....))))))).........(((....)))))..........(((((((....))))))).....................
4.069
medium
960.0380.9260.482R00.010710222
76
75Atrocious 3Project : Testing various loop designs
WTF760081-1
GGAAAACAAAAAAAAGACAAAAGUACAAAAGUACGUCAAAGGAAAACGUGAGAGCGCCAAAAAAAAAAGGCAAGGUUCGCCUUGCCAAAAGAAACAACAACAACAAC
((.............(((....((((....))))))).........(((....)))))..........(((((((....))))))).....................
2.884
medium
920.0450.9270.486R00.010710222
77
76Atrocious 2Project : Testing various loop designs
WTF760080-1
GGAAAACAAAAAAAAGACAAAAGCUCAAAAGAGCGUCAAAGCAAAAACCGAAAGGUGCAAAAAAAAAACCGUAUCUUCGGAUACGGAAAAGAAACAACAACAACAAC
...............(((....((((....)))))))...((....(((....)))))..........(((((((....))))))).....................
4.311
medium
920.070.9770.523R00.010710222
78
77Atrocious 1Project : Testing various loop designs
WTF760079-1
GGAAAACAAAAAAAAGACAAAAGCUCAAAAGAGCGUCAAAGCAAAAGCCGAAAGGUGCAAAAAAAAAAAGUGCGCUUCGGCGCACUAAAAGAAACAACAACAACAAC
...............(((....((((....)))))))...((....(((....)))))..........(((((((....))))))).....................
2.689
medium
880.0641.0740.569R00.010711222
79
78LD 1Project : Testing various loop designs
WTF758783-1
GGAAAACAAAAAAAAGGCAAAACUAGGAAACUAGGCCAAAGGAAAACUGGAAACAGCCAAAAAAAAAAGAUGUGCUUCGGCACAUCAAAAGAAACAACAACAACAAC
((.............(((....((((....))))))).........(((....)))))..........(((((((....))))))).....................
3.026
medium
960.0720.9070.49R00.010710222
80
79Fisker testing various loop designs 2Project : Testing various loop designs767311-1
GGAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGUCUAAACAGCAAAGCUGGACAAAAAAAAAAAUUCAGGUUCGCCUGAAUAAAAGAAACAACAACAACAAC
.....................................(((....((((...)))))))..........(((((((....))))))).....................2.088
medium
7600.7350.367R00.010726222
81
80Fisker testing various loop designs 2Project : Testing various loop designs767310-1
GGAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGUCAAAACAGCAAAGCUGGACAAAAAAAAAAACAAACGUUCGCGUUUGUAAAAGAAACAACAACAACAAC
.....................................(((....((((...)))))))..........(((((((....))))))).....................2.476
medium
82.70.0010.870.435R00.010726321
82
81Fisker testing various loop designsProject : Testing various loop designs767309-1
GGAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAACUGAAAACAGCAAAGCUGCAGAAAAAAAAAAGCUGGUCUUCGGACCAGCAAAAGAAACAACAACAACAAC
.....................................(((....((((...)))))))..........(((((((....))))))).....................1.515
medium
89.3-0.0530.6530.3R00.010726222
83
82Right foot 3Project : Testing various loop designs760086-1
GGAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGUCUAAAGGACAAAGUCUGACAAAAAAAAAAUAAGGUCUUCGGACCUUAAAAAGAAACAACAACAACAAC
.....................................(((....((((...)))))))..........(((((((....))))))).....................2.224
medium
80-0.0790.7140.317R00.010726222
84
83Right foot 2Project : Testing various loop designs760085-1
GGAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGUCAAAAGUACAAAGUACGACAAAAAAAAAAGAUAGGCUUCGGCCUAUCAAAAGAAACAACAACAACAAC
.....................................(((....((((...)))))))..........(((((((....))))))).....................2.292
medium
81.3-0.0690.7390.335R00.010726222
85
84Right foot 1Project : Testing various loop designs760084-1
GGAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGCCAAAAGUACAAAGUACGGCAAAAAAAAAAGACCUACUUCGGUAGGUCAAAAGAAACAACAACAACAAC
.....................................(((....((((...)))))))..........(((((((....))))))).....................2.294
medium
90.7-0.0720.7410.335R00.010726222
86
85LD 1Project : Testing various loop designs758788-1
GGAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGACAAAACCAGAAACUGGGUCAAAAAAAAAAGUUAUCGUUCGCGAUAACAAAAGAAACAACAACAACAAC
.....................................(((....((((...)))))))..........(((((((....))))))).....................2.098
medium
85.3-0.0250.8320.404R00.010726232
87
86Fisker testing various loop designs 2Project : Testing various loop designs767590-1
GGAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGCGAAAACUAGGAAAACUAGCGCAAAAAAAAAAGAACAGGUUCGCCUGUUCAAAAGAAACAACAACAACAAC
...................................(((....((((.....)))))))..........(((((((....))))))).....................1.743
medium
93.3-0.0710.6380.283R00.010724222
88
87Fisker testing various loop designs 2Project : Testing various loop designs767587-1
GGAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGUGAAAACUAGGAAAACUAGCACAAAAAAAAAAGUACUACUUCGGUAGUACAAAAGAAACAACAACAACAAC
...................................(((....((((.....)))))))..........(((((((....))))))).....................2.388
medium
92-0.0340.8660.416R00.010724221
89
88Fisker testing various loop designsProject : Testing various loop designs767316-1
GGAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAACUGAAAAGUACGAAAAGUACCAGAAAAAAAAAAUGUUGAGUUCGCUCAACAAAAAGAAACAACAACAACAAC
...................................(((....((((.....)))))))..........(((((((....))))))).....................3.895
medium
86.7-0.0270.7350.354R00.010724222
90
89Right Foot 3Project : Testing various loop designs760090-1
GGAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGCCAAAAGUAUGAGAAGUACGGCAAAAAAAAAAGAUCGGCUUCGGCCGAUCAAAAGAAACAACAACAACAAC
...................................(((....((((.....)))))))..........(((((((....))))))).....................1.762
medium
880.030.7540.392R00.010724222
91
90Right Foot 2Project : Testing various loop designs760089-1
GGAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGCCAAAAGUACUAAAUGUACGGCAAAAAAAAAAUCCAUCGUUCGCGAUGGAAAAAGAAACAACAACAACAAC
...................................(((....((((.....)))))))..........(((((((....))))))).....................3.069
medium
89.3-0.0610.7320.336R00.010724222
92
91Right Foot 1Project : Testing various loop designs760088-1
GGAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGCCAAAAGUACAAAAAGUACGGCAAAAAAAAAAUUCCAAGUUCGCUUGGAAAAAAGAAACAACAACAACAAC
...................................(((....((((.....)))))))..........(((((((....))))))).....................2.092
medium
92-0.0190.7130.347R00.010724222
93
92LD 1Project : Testing various loop designs758792-1
GGAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGUCAAAAGCACGAAAAGUGCGACAAAAAAAAAAGUGGUUCUUCGGAACCACAAAAGAAACAACAACAACAAC
...................................(((....((((.....)))))))..........(((((((....))))))).....................1.663
medium
86.7-0.0560.7490.346R00.010724222
94
93GU / GAGAProject : Testing various loop designs760077-1
GGAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGCCAAAAGCAUGAGAGUGCGGCAAAAAAAAAAAGCCUUCUUCGGAAGGCUAAAAGAAACAACAACAACAAC
....................................(((....((((....)))))))..........(((((((....))))))).....................1.116
medium
82.7-0.010.650.32R00.010725222
95
94GAAGProject : Testing various loop designs760076-1
GGAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGCCAAAAGUACGAAGGUACGGCAAAAAAAAAACCGACUCUUCGGAGUCGGAAAAGAAACAACAACAACAAC
....................................(((....((((....)))))))..........(((((((....))))))).....................2.038
medium
92-0.0120.7230.355R00.010725222
96
95UUCGProject : Testing various loop designs760075-1
GGAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGCCAAAAGUACUUCGGUACGGCAAAAAAAAAACUGCCAGUUCGCUGGCAGAAAAGAAACAACAACAACAAC
....................................(((....((((....)))))))..........(((((((....))))))).....................2.266
medium
89.3-0.0080.670.331R00.010725222
97
96Loop Test - 1Project : Testing various loop designs759478-1
GGAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGAGAAAAGUGAGAAAUCACCUCGAAAAAAAAACGCUAUCUUCGGAUAGCGAAAAGAAACAACAACAACAAC
....................................(((....((((....)))))))..........(((((((....))))))).....................1.953
medium
86.7-0.0730.6530.29R00.010725222
98
97LD 1Project : Testing various loop designs758796-1
GGAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAGACAAAAGAGCGAAAGCUCGUCAAAAAAAAAAUAAGAGCUUCGGCUCUUAAAAAGAAACAACAACAACAAC
....................................(((....((((....)))))))..........(((((((....))))))).....................3.013
medium
86.7-0.0090.720.356R00.010725221
99
98B - HLF: KA - 3Project : Hard Lab Fragments: Kudzu Arm771926-1
GGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGUACAGGACCAAAGGCCAUGACAAAAACGCUCUUCGGAGCGUUAAAAGAAACAACAACAACAAC
...........................................((.((((.((...)))).))))...(((((((....))))))).....................1.732
medium
73.3-0.0060.540.267R00.010741222
100
99If I m Not Wrong This Is The Only Sensible Legal SolutionProject : Hard Lab Fragments: Kudzu Arm758510-1
GGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUGAUGGCAGCAAAGCGCACACAAAAAUCCUAGUUCGCUAGGAUAAAAGAAACAACAACAACAAC
...........................................((.((((.((...)))).))))...(((((((....))))))).....................1.508
medium
74.7-0.0220.4730.226R00.010741222
Loading...
Main menu