iGEM Primers and Plasmids
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
|
 
Still loading...
ABCDEFGHIJKLMNOPQRSTUV
1
Team PartsBBa_K382000 to BBa_K382999
2
3
Registry NameiGarden TeamTeam LabelSizeSequenceDescriptionDigested (E/P)In pSB1C3
4
5
BBa_K382000VectorV77208gatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatccctagggaagttcctattccgaagttcctattctctgaaaagtataggaacttctttgcgtattgggcgctcttggcctttttggccaccggtcgtacggttaaaaccaccccagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccactagacgctcaccgggctggttgccctcgccgctgggctggcggccgtctatggccctgcaaacgcgccagaaacgccgtcgaagccgtgtgcgagacaccgcagccgccggcgttgtggatacctcgcggaaaacttggccctcactgacagatgaggggcggacgttgacacttgaggggccgactcacccggcgcggcgttgacagatgaggggcaggctcgatttcggccggcgacgtggagctggccagcctcgcaaatcggcgaaaacgcctgattttacgcgagtttcccacagatgatgtggacaagcctggggataagtgccctgcggtattgacacttgaggggcgcgactactgacagatgaggggcgcgatccttgacacttgaggggcagagtgctgacagatgaggggcgcacctattgacatttgaggggctgtccacaggcagaaaatccagcatttgcaagggtttccgcccgtttttcggccaccgctaacctgtcttttaacctgcttttaaaccaatatttataaaccttgtttttaaccagggctgcgccctgtgcgcgtgaccgcgcacgccgaaggggggtgcccccccttctcgaaccctcccggcccgctctcgcgttggcagcatcacccataattgtggtttcaaaatcggctccgtcgatactatgttatacgccaactttgaaaacaactttgaaaaagctgttttctggtatttaaggttttagaatgcaaggaacagtgaattggagttcgtcttgttataattagcttcttggggtatctttaaatactgtagaaaagaggaaggaaataataaatggctaaaatgagaatatcaccggaattgaaaaaactgatcgaaaaataccgctgcgtaaaagatacggaaggaatgtctcctgctaaggtatataagctggtgggagaaaatgaaaacctatatttaaaaatgacggacagccggtataaagggaccacctatgatgtggaacgggaaaaggacatgatgctatggctggaaggaaagctgcctgttccaaaggtcctgcactttgaacggcatgatggctggagcaatctgctcatgagtgaggccgatggcgtcctttgctcggaagagtatgaagatgaacaaagccctgaaaagattatcgagctgtatgcggagtgcatcaggctctttcactccatcgacatatcggattgtccctatacgaatagcttagacagccgcttagccgaattggattacttactgaataacgatctggccgatgtggattgcgaaaactgggaagaagacactccatttaaagatccgcgcgagctgtatgattttttaaagacggaaaagcccgaagaggaacttgtcttttcccacggcgacctgggagacagcaacatctttgtgaaagatggcaaagtaagtggctttattgatcttgggagaagcggcagggcggacaagtggtatgacattgccttctgcgtccggtcgatcagggaggatattggggaagaacagtatgtcgagctattttttgacttactggggatcaagcctgattgggagaaaataaaatattatattttactggatgaattgttttagtacctagatgtggcgcaacgatgccggcgacaagcaggagcgcaccgacttcttccgcatcaagtgttttggctctcaggccgaggcccacggcaagtatttgggcaaggggtcgctggtattcgtgcagggcaagattcggaataccaagtacgagaaggacggccagacggtctacgggaccgacttcattgccgataaggtggattatctggacaccaaggcaccaggcgggtcaaatcaggaataagggcacattgccccggcgtgagtcggggcaatcccgcaaggagggtgaatgaatcggacgtttgaccggaaggcatacaggcaagaactgatcgacgcggggttttccgccgaggatgccgaaaccatcgcaagccgcaccgtcatgcgtgcgccccgcgaaaccttccagtccgtcggctcgatggtccagcaagctacggccaagatcgagcgcgacagcgtgcaactggctccccctgccctgcccgcgccatcggccgccgtggagcgttcgcgtcgtctcgaacaggaggcggcaggtttggcgaagtcgatgaccatcgacacgcgaggaactatgacgaccaagaagcgaaaaaccgccggcgaggacctggcaaaacaggtcagcgaggccaagcaagccgcgttgctgaaacacacgaagcagcagatcaaggaaatgcagctttccttgttcgatattgcgccgtggccggacacgatgcgagcgatgccaaacgacacggcccgctctgccctgttcaccacgcgcaacaagaaaatcccgcgcgaggcgctgcaaaacaaggtcattttccacgtcaacaaggacgtgaagatcacctacaccggcgtcgagctgcgggccgacgatgacgaactggtgtggcagcaggtgttggagtacgcgaagcgcacccctatcggcgagccgatcaccttcacgttctacgagctttgccaggacctgggctggtcgatcaatggccggtattacacgaaggccgaggaatgcctgtcgcgcctacaggcgacggcgatgggcttcacgtccgaccgcgttgggcacctggaatcggtgtcgctgctgcaccgcttccgcgtcctggaccgtggcaagaaaacgtcccgttgccaggtcctgatcgacgaggaaatcgtcgtgctgtttgctggcgaccactacacgaaattcatatgggagaagtaccgcaagctgtcgccgacggcccgacggatgttcgactatttcagctcgcaccgggagccgtacccgctcaagctggaaaccttccgcctcatgtgcggatcggattccacccgcgtgaagaagtggcgcgagcaggtcggcgaagcctgcgaagagttgcgaggcagcggcctggtggaacacgcctgggtcaatgatgacctggtgcattgcaaacgctagggccttgtggggtcagttccggctgggggttcagcagccagcgctttactgagatcctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggatctcctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgctagtggatctcccagtcacgacgttgtaaaacgggcgccccgcGGGAATTCGCGGCCGCTTCTAGAACTAGTAGCGGCCGCTGCAGGctagtgatatccctgtgtgaaattgttatccgctacgcgtgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcccatgggaagttcctattccgaagttcctattctctgaaaagtataggaacttcagcgatcgcagacgtcaacgtggatacttggcagtggttacttggcttttcctttattttcttttggacggaagcggtggttactttgtcacacatttaaaaaaacacgtgtttctcacttttttctattcccgtcacaaacaattttaagaaagatccatctatcgtgatctttctatcaaacaaaagaaaaaaggtcttcatagtaacgctacaacatcaaatatgtggttgctctgacatcagtcgggaaaataaggatatggcggcattggccacatctattggggtcccaacttcctttcacaaaaaaattaaattgggtgtcccaacttttatctttgatatagtgacatgagtatcgggagcattggacaatggataaaatgagaactaaaaaaattctggttaatttttgatcattgttatttaaaaggttattttatctataatctacccatattgatcagttttatttaaatttgtttagctaccgctccacgagagagatcctcatcttaaaaatggaatatggaaattacacacgaccccaaaagtatattttttctctggagaatgctatttagagctttgactatatggtctgaattagaaagacgggaaataaaatctgctaagtgatataagctctaagtaggcgatgtgtgatggagaacaccttttctttaacagtcttcatgttttacagattcgcgaacttcgaatatccctatacggtctgtctaaccctcgtgtgtcttttgagtccaagataaaggccattattgagtaacatagacatgctggaatccaaccattgaagtcacaactgtccatgtagattctttggagaatctgaaaagtcttaataaaggtggtgtttcaaagaaaacaaaacaaatgagttaagaaaaaaaaatatcatgtagtggtcgagtattatgttatttattgtgtagctaccaatctttattctttaaatctgacataaaatgctacaaactttttacctcgtctatagccccaaaaaacctaaccacggttctaaaaccacacacagtgattttggttgacgacaatgcctctccttcctcaaaacgatttatttacattttttaaatcaaatgttacattttataccataattaagtctttttacagaatacttagatggaagagatgtataaaaaaggaggaaattgtaaaaaacatatttcgatcaattaaaccaggattcataaaaatataagtatatatataaatgatgtttcgtttagcgatgaacttcactcatatgataatacttaacaatataagtacataaaaaataaaataaaattaattgtttacgaaaagtctacaaatactgcatgtataattaatgttctctttatttatttatttataccttaccaagatatatctataaccgcatagaaatagaaggcgaagagataatttccaaaaacaagaaaaacctctaagctcaaaagggccggccatgtctccggagaggagaccagttgagattaggccagctacagcagctgatatggccgctgtttgtgacatcgttaaccattacattgagacttctacagtgaactttaggacagagccacaaacaccacaagagtggattgatgatcttgagaggttgcaagatagatacccttggttggttgctgaggttgagggtgttgtggctggtattgcttacgctggaccttggaaggctaggaacgcttacgattggacagttgagagtactgtttacgtgtcacataggcatcaaaggttgggcctcggatctacattgtacacacatttgcttaagtctatggaggcgcaaggttttaagtctgtggttgctgttattggccttccaaacgatccatctgttaggttgcatgaggctttgggatacacagccaggggtacattgcgcgcagctggatacaagcatggtggatggcatgatgttggtttttggcaaagggattttgagttgccagctcctccaaggccagttagaccagttacccagatctgaggcgcgccpORE Open Series Vector with BioBrick MCSX
6
BBa_K382001VectorV87451gatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatccctagggaagttcctattccgaagttcctattctctgaaaagtataggaacttctttgcgtattgggcgctcttggcctttttggccaccggtcgtacggttaaaaccaccccagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccactagacgctcaccgggctggttgccctcgccgctgggctggcggccgtctatggccctgcaaacgcgccagaaacgccgtcgaagccgtgtgcgagacaccgcagccgccggcgttgtggatacctcgcggaaaacttggccctcactgacagatgaggggcggacgttgacacttgaggggccgactcacccggcgcggcgttgacagatgaggggcaggctcgatttcggccggcgacgtggagctggccagcctcgcaaatcggcgaaaacgcctgattttacgcgagtttcccacagatgatgtggacaagcctggggataagtgccctgcggtattgacacttgaggggcgcgactactgacagatgaggggcgcgatccttgacacttgaggggcagagtgctgacagatgaggggcgcacctattgacatttgaggggctgtccacaggcagaaaatccagcatttgcaagggtttccgcccgtttttcggccaccgctaacctgtcttttaacctgcttttaaaccaatatttataaaccttgtttttaaccagggctgcgccctgtgcgcgtgaccgcgcacgccgaaggggggtgcccccccttctcgaaccctcccggcccgctctcgcgttggcagcatcacccataattgtggtttcaaaatcggctccgtcgatactatgttatacgccaactttgaaaacaactttgaaaaagctgttttctggtatttaaggttttagaatgcaaggaacagtgaattggagttcgtcttgttataattagcttcttggggtatctttaaatactgtagaaaagaggaaggaaataataaatggctaaaatgagaatatcaccggaattgaaaaaactgatcgaaaaataccgctgcgtaaaagatacggaaggaatgtctcctgctaaggtatataagctggtgggagaaaatgaaaacctatatttaaaaatgacggacagccggtataaagggaccacctatgatgtggaacgggaaaaggacatgatgctatggctggaaggaaagctgcctgttccaaaggtcctgcactttgaacggcatgatggctggagcaatctgctcatgagtgaggccgatggcgtcctttgctcggaagagtatgaagatgaacaaagccctgaaaagattatcgagctgtatgcggagtgcatcaggctctttcactccatcgacatatcggattgtccctatacgaatagcttagacagccgcttagccgaattggattacttactgaataacgatctggccgatgtggattgcgaaaactgggaagaagacactccatttaaagatccgcgcgagctgtatgattttttaaagacggaaaagcccgaagaggaacttgtcttttcccacggcgacctgggagacagcaacatctttgtgaaagatggcaaagtaagtggctttattgatcttgggagaagcggcagggcggacaagtggtatgacattgccttctgcgtccggtcgatcagggaggatattggggaagaacagtatgtcgagctattttttgacttactggggatcaagcctgattgggagaaaataaaatattatattttactggatgaattgttttagtacctagatgtggcgcaacgatgccggcgacaagcaggagcgcaccgacttcttccgcatcaagtgttttggctctcaggccgaggcccacggcaagtatttgggcaaggggtcgctggtattcgtgcagggcaagattcggaataccaagtacgagaaggacggccagacggtctacgggaccgacttcattgccgataaggtggattatctggacaccaaggcaccaggcgggtcaaatcaggaataagggcacattgccccggcgtgagtcggggcaatcccgcaaggagggtgaatgaatcggacgtttgaccggaaggcatacaggcaagaactgatcgacgcggggttttccgccgaggatgccgaaaccatcgcaagccgcaccgtcatgcgtgcgccccgcgaaaccttccagtccgtcggctcgatggtccagcaagctacggccaagatcgagcgcgacagcgtgcaactggctccccctgccctgcccgcgccatcggccgccgtggagcgttcgcgtcgtctcgaacaggaggcggcaggtttggcgaagtcgatgaccatcgacacgcgaggaactatgacgaccaagaagcgaaaaaccgccggcgaggacctggcaaaacaggtcagcgaggccaagcaagccgcgttgctgaaacacacgaagcagcagatcaaggaaatgcagctttccttgttcgatattgcgccgtggccggacacgatgcgagcgatgccaaacgacacggcccgctctgccctgttcaccacgcgcaacaagaaaatcccgcgcgaggcgctgcaaaacaaggtcattttccacgtcaacaaggacgtgaagatcacctacaccggcgtcgagctgcgggccgacgatgacgaactggtgtggcagcaggtgttggagtacgcgaagcgcacccctatcggcgagccgatcaccttcacgttctacgagctttgccaggacctgggctggtcgatcaatggccggtattacacgaaggccgaggaatgcctgtcgcgcctacaggcgacggcgatgggcttcacgtccgaccgcgttgggcacctggaatcggtgtcgctgctgcaccgcttccgcgtcctggaccgtggcaagaaaacgtcccgttgccaggtcctgatcgacgaggaaatcgtcgtgctgtttgctggcgaccactacacgaaattcatatgggagaagtaccgcaagctgtcgccgacggcccgacggatgttcgactatttcagctcgcaccgggagccgtacccgctcaagctggaaaccttccgcctcatgtgcggatcggattccacccgcgtgaagaagtggcgcgagcaggtcggcgaagcctgcgaagagttgcgaggcagcggcctggtggaacacgcctgggtcaatgatgacctggtgcattgcaaacgctagggccttgtggggtcagttccggctgggggttcagcagccagcgctttactgagatcctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggatctcctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgctagtggatctcccagtcacgacgttgtaaaacgggcgccccgcGGGAATTCGCGGCCGCTTCTAGAACTAGTAGCGGCCGCTGCAGGctagtgatatccctgtgtgaaattgttatccgctacgcgtgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcccatgggaagttcctattccgaagttcctattctctgaaaagtataggaacttcagcgatcgcagacgtcaacgtggatacttggcagtggttacttggcttttcctttattttcttttggacggaagcggtggttactttgtcacacatttaaaaaaacacgtgtttctcacttttttctattcccgtcacaaacaattttaagaaagatccatctatcgtgatctttctatcaaacaaaagaaaaaaggtcttcatagtaacgctacaacatcaaatatgtggttgctctgacatcagtcgggaaaataaggatatggcggcattggccacatctattggggtcccaacttcctttcacaaaaaaattaaattgggtgtcccaacttttatctttgatatagtgacatgagtatcgggagcattggacaatggataaaatgagaactaaaaaaattctggttaatttttgatcattgttatttaaaaggttattttatctataatctacccatattgatcagttttatttaaatttgtttagctaccgctccacgagagagatcctcatcttaaaaatggaatatggaaattacacacgaccccaaaagtatattttttctctggagaatgctatttagagctttgactatatggtctgaattagaaagacgggaaataaaatctgctaagtgatataagctctaagtaggcgatgtgtgatggagaacaccttttctttaacagtcttcatgttttacagattcgcgaacttcgaatatccctatacggtctgtctaaccctcgtgtgtcttttgagtccaagataaaggccattattgagtaacatagacatgctggaatccaaccattgaagtcacaactgtccatgtagattctttggagaatctgaaaagtcttaataaaggtggtgtttcaaagaaaacaaaacaaatgagttaagaaaaaaaaatatcatgtagtggtcgagtattatgttatttattgtgtagctaccaatctttattctttaaatctgacataaaatgctacaaactttttacctcgtctatagccccaaaaaacctaaccacggttctaaaaccacacacagtgattttggttgacgacaatgcctctccttcctcaaaacgatttatttacattttttaaatcaaatgttacattttataccataattaagtctttttacagaatacttagatggaagagatgtataaaaaaggaggaaattgtaaaaaacatatttcgatcaattaaaccaggattcataaaaatataagtatatatataaatgatgtttcgtttagcgatgaacttcactcatatgataatacttaacaatataagtacataaaaaataaaataaaattaattgtttacgaaaagtctacaaatactgcatgtataattaatgttctctttatttatttatttataccttaccaagatatatctataaccgcatagaaatagaaggcgaagagataatttccaaaaacaagaaaaacctctaagctcaaaagggccggccatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggaggccggttctttttgtcaagaccgacctgtccggtgccctgaatgaacttcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgactcatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaggcgcgccpORE Open Series Vector with BioBrick MCSX
7
BBa_K382002VectorV97726gatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatccctagggaagttcctattccgaagttcctattctctgaaaagtataggaacttctttgcgtattgggcgctcttggcctttttggccaccggtcgtacggttaaaaccaccccagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccactagacgctcaccgggctggttgccctcgccgctgggctggcggccgtctatggccctgcaaacgcgccagaaacgccgtcgaagccgtgtgcgagacaccgcagccgccggcgttgtggatacctcgcggaaaacttggccctcactgacagatgaggggcggacgttgacacttgaggggccgactcacccggcgcggcgttgacagatgaggggcaggctcgatttcggccggcgacgtggagctggccagcctcgcaaatcggcgaaaacgcctgattttacgcgagtttcccacagatgatgtggacaagcctggggataagtgccctgcggtattgacacttgaggggcgcgactactgacagatgaggggcgcgatccttgacacttgaggggcagagtgctgacagatgaggggcgcacctattgacatttgaggggctgtccacaggcagaaaatccagcatttgcaagggtttccgcccgtttttcggccaccgctaacctgtcttttaacctgcttttaaaccaatatttataaaccttgtttttaaccagggctgcgccctgtgcgcgtgaccgcgcacgccgaaggggggtgcccccccttctcgaaccctcccggcccgctctcgcgttggcagcatcacccataattgtggtttcaaaatcggctccgtcgatactatgttatacgccaactttgaaaacaactttgaaaaagctgttttctggtatttaaggttttagaatgcaaggaacagtgaattggagttcgtcttgttataattagcttcttggggtatctttaaatactgtagaaaagaggaaggaaataataaatggctaaaatgagaatatcaccggaattgaaaaaactgatcgaaaaataccgctgcgtaaaagatacggaaggaatgtctcctgctaaggtatataagctggtgggagaaaatgaaaacctatatttaaaaatgacggacagccggtataaagggaccacctatgatgtggaacgggaaaaggacatgatgctatggctggaaggaaagctgcctgttccaaaggtcctgcactttgaacggcatgatggctggagcaatctgctcatgagtgaggccgatggcgtcctttgctcggaagagtatgaagatgaacaaagccctgaaaagattatcgagctgtatgcggagtgcatcaggctctttcactccatcgacatatcggattgtccctatacgaatagcttagacagccgcttagccgaattggattacttactgaataacgatctggccgatgtggattgcgaaaactgggaagaagacactccatttaaagatccgcgcgagctgtatgattttttaaagacggaaaagcccgaagaggaacttgtcttttcccacggcgacctgggagacagcaacatctttgtgaaagatggcaaagtaagtggctttattgatcttgggagaagcggcagggcggacaagtggtatgacattgccttctgcgtccggtcgatcagggaggatattggggaagaacagtatgtcgagctattttttgacttactggggatcaagcctgattgggagaaaataaaatattatattttactggatgaattgttttagtacctagatgtggcgcaacgatgccggcgacaagcaggagcgcaccgacttcttccgcatcaagtgttttggctctcaggccgaggcccacggcaagtatttgggcaaggggtcgctggtattcgtgcagggcaagattcggaataccaagtacgagaaggacggccagacggtctacgggaccgacttcattgccgataaggtggattatctggacaccaaggcaccaggcgggtcaaatcaggaataagggcacattgccccggcgtgagtcggggcaatcccgcaaggagggtgaatgaatcggacgtttgaccggaaggcatacaggcaagaactgatcgacgcggggttttccgccgaggatgccgaaaccatcgcaagccgcaccgtcatgcgtgcgccccgcgaaaccttccagtccgtcggctcgatggtccagcaagctacggccaagatcgagcgcgacagcgtgcaactggctccccctgccctgcccgcgccatcggccgccgtggagcgttcgcgtcgtctcgaacaggaggcggcaggtttggcgaagtcgatgaccatcgacacgcgaggaactatgacgaccaagaagcgaaaaaccgccggcgaggacctggcaaaacaggtcagcgaggccaagcaagccgcgttgctgaaacacacgaagcagcagatcaaggaaatgcagctttccttgttcgatattgcgccgtggccggacacgatgcgagcgatgccaaacgacacggcccgctctgccctgttcaccacgcgcaacaagaaaatcccgcgcgaggcgctgcaaaacaaggtcattttccacgtcaacaaggacgtgaagatcacctacaccggcgtcgagctgcgggccgacgatgacgaactggtgtggcagcaggtgttggagtacgcgaagcgcacccctatcggcgagccgatcaccttcacgttctacgagctttgccaggacctgggctggtcgatcaatggccggtattacacgaaggccgaggaatgcctgtcgcgcctacaggcgacggcgatgggcttcacgtccgaccgcgttgggcacctggaatcggtgtcgctgctgcaccgcttccgcgtcctggaccgtggcaagaaaacgtcccgttgccaggtcctgatcgacgaggaaatcgtcgtgctgtttgctggcgaccactacacgaaattcatatgggagaagtaccgcaagctgtcgccgacggcccgacggatgttcgactatttcagctcgcaccgggagccgtacccgctcaagctggaaaccttccgcctcatgtgcggatcggattccacccgcgtgaagaagtggcgcgagcaggtcggcgaagcctgcgaagagttgcgaggcagcggcctggtggaacacgcctgggtcaatgatgacctggtgcattgcaaacgctagggccttgtggggtcagttccggctgggggttcagcagccagcgctttactgagatcctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggatctcctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgctagtggatctcccagtcacgacgttgtaaaacgggcgccccgcggaaAGCTTGGGATCTTCTGCAAGCATCTCTATTTCCTGAAGGTCTAACCTCGAAGATTTAAGATTTAATTACGTTTATAATTACAAAATTGATTCTAGTATCTTTAATTTAATGCTTATACATTATTAATTAATTTAGTACTTTCAATTTGTTTTCAGAAATTATTTTACTATTTTTTATAAAATAAAAGGGAGAAAATGGCTATTTAAATACTAGCCTATTTTATTTCAATTTTAGCTTAAAATCAGCCCCAATTAGCCCCAATTTCAAATTCAAATGGTCCAGCCCAATTCCTAAATAACCCACCCCTAACCCGCCCGGTTTCCCCTTTTGATCCATGCAGTCAACGCCCAGAATTTCCCTATATAATTTTTTAATTCCCAAACACCCCTAACTCTATCCCATTTCTCACCAACCGCCACATAGATCTATCCTCTTATCTCTCAAACTCTCTCGAACCTTCCCCTAACCCTAGCAGCCTCTCATCATCCTCACCTCAAAACCCACCGGAGAATTCGCGGCCGCTTCTAGAATTAGAGGACTAGTAGCGGCCGCTGCAGGctagtgatatccctgtgtgaaattgttatccgctacgcgtgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcccatgggaagttcctattccgaagttcctattctctgaaaagtataggaacttcagcgatcgcagacgtcaacgtggatacttggcagtggttacttggcttttcctttattttcttttggacggaagcggtggttactttgtcacacatttaaaaaaacacgtgtttctcacttttttctattcccgtcacaaacaattttaagaaagatccatctatcgtgatctttctatcaaacaaaagaaaaaaggtcttcatagtaacgctacaacatcaaatatgtggttgctctgacatcagtcgggaaaataaggatatggcggcattggccacatctattggggtcccaacttcctttcacaaaaaaattaaattgggtgtcccaacttttatctttgatatagtgacatgagtatcgggagcattggacaatggataaaatgagaactaaaaaaattctggttaatttttgatcattgttatttaaaaggttattttatctataatctacccatattgatcagttttatttaaatttgtttagctaccgctccacgagagagatcctcatcttaaaaatggaatatggaaattacacacgaccccaaaagtatattttttctctggagaatgctatttagagctttgactatatggtctgaattagaaagacgggaaataaaatctgctaagtgatataagctctaagtaggcgatgtgtgatggagaacaccttttctttaacagtcttcatgttttacagattcgcgaacttcgaatatccctatacggtctgtctaaccctcgtgtgtcttttgagtccaagataaaggccattattgagtaacatagacatgctggaatccaaccattgaagtcacaactgtccatgtagattctttggagaatctgaaaagtcttaataaaggtggtgtttcaaagaaaacaaaacaaatgagttaagaaaaaaaaatatcatgtagtggtcgagtattatgttatttattgtgtagctaccaatctttattctttaaatctgacataaaatgctacaaactttttacctcgtctatagccccaaaaaacctaaccacggttctaaaaccacacacagtgattttggttgacgacaatgcctctccttcctcaaaacgatttatttacattttttaaatcaaatgttacattttataccataattaagtctttttacagaatacttagatggaagagatgtataaaaaaggaggaaattgtaaaaaacatatttcgatcaattaaaccaggattcataaaaatataagtatatatataaatgatgtttcgtttagcgatgaacttcactcatatgataatacttaacaatataagtacataaaaaataaaataaaattaattgtttacgaaaagtctacaaatactgcatgtataattaatgttctctttatttatttatttataccttaccaagatatatctataaccgcatagaaatagaaggcgaagagataatttccaaaaacaagaaaaacctctaagctcaaaagggccggccatgtctccggagaggagaccagttgagattaggccagctacagcagctgatatggccgctgtttgtgacatcgttaaccattacattgagacttctacagtgaactttaggacagagccacaaacaccacaagagtggattgatgatcttgagaggttgcaagatagatacccttggttggttgctgaggttgagggtgttgtggctggtattgcttacgctggaccttggaaggctaggaacgcttacgattggacagttgagagtactgtttacgtgtcacataggcatcaaaggttgggcctcggatctacattgtacacacatttgcttaagtctatggaggcgcaaggttttaagtctgtggttgctgttattggccttccaaacgatccatctgttaggttgcatgaggctttgggatacacagccaggggtacattgcgcgcagctggatacaagcatggtggatggcatgatgttggtttttggcaaagggattttgagttgccagctcctccaaggccagttagaccagttacccagatctgaggcgcgccpORE Expression Series Vector with BioBrick MCSX
8
BBa_K382003VectorV107920GctagtgatatccctgtgtgaaattgttatccgctacgcgtgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcccatgggaagttcctattccgaagttcctattctctgaaaagtataggaacttcagcgatcgcagacgtcaacgtggatacttggcagtggttacttggcttttcctttattttcttttggacggaagcggtggttactttgtcacacatttaaaaaaacacgtgtttctcacttttttctattcccgtcacaaacaattttaagaaagatccatctatcgtgatctttctatcaaacaaaagaaaaaaggtcttcatagtaacgctacaacatcaaatatgtggttgctctgacatcagtcgggaaaataaggatatggcggcattggccacatctattggggtcccaacttcctttcacaaaaaaattaaattgggtgtcccaacttttatctttgatatagtgacatgagtatcgggagcattggacaatggataaaatgagaactaaaaaaattctggttaatttttgatcattgttatttaaaaggttattttatctataatctacccatattgatcagttttatttaaatttgtttagctaccgctccacgagagagatcctcatcttaaaaatggaatatggaaattacacacgaccccaaaagtatattttttctctggagaatgctatttagagctttgactatatggtctgaattagaaagacgggaaataaaatctgctaagtgatataagctctaagtaggcgatgtgtgatggagaacaccttttctttaacagtcttcatgttttacagattcgcgaacttcgaatatccctatacggtctgtctaaccctcgtgtgtcttttgagtccaagataaaggccattattgagtaacatagacatgctggaatccaaccattgaagtcacaactgtccatgtagattctttggagaatctgaaaagtcttaataaaggtggtgtttcaaagaaaacaaaacaaatgagttaagaaaaaaaaatatcatgtagtggtcgagtattatgttatttattgtgtagctaccaatctttattctttaaatctgacataaaatgctacaaactttttacctcgtctatagccccaaaaaacctaaccacggttctaaaaccacacacagtgattttggttgacgacaatgcctctccttcctcaaaacgatttatttacattttttaaatcaaatgttacattttataccataattaagtctttttacagaatacttagatggaagagatgtataaaaaaggaggaaattgtaaaaaacatatttcgatcaattaaaccaggattcataaaaatataagtatatatataaatgatgtttcgtttagcgatgaacttcactcatatgataatacttaacaatataagtacataaaaaataaaataaaattaattgtttacgaaaagtctacaaatactgcatgtataattaatgttctctttatttatttatttataccttaccaagatatatctataaccgcatagaaatagaaggcgaagagataatttccaaaaacaagaaaaacctctaagctcaaaagggccggccatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggaggccggttctttttgtcaagaccgacctgtccggtgccctgaatgaacttcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgactcatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaggcgcgccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatccctagggaagttcctattccgaagttcctattctctgaaaagtataggaacttctttgcgtattgggcgctcttggcctttttggccaccggtcgtacggttaaaaccaccccagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccactagacgctcaccgggctggttgccctcgccgctgggctggcggccgtctatggccctgcaaacgcgccagaaacgccgtcgaagccgtgtgcgagacaccgcagccgccggcgttgtggatacctcgcggaaaacttggccctcactgacagatgaggggcggacgttgacacttgaggggccgactcacccggcgcggcgttgacagatgaggggcaggctcgatttcggccggcgacgtggagctggccagcctcgcaaatcggcgaaaacgcctgattttacgcgagtttcccacagatgatgtggacaagcctggggataagtgccctgcggtattgacacttgaggggcgcgactactgacagatgaggggcgcgatccttgacacttgaggggcagagtgctgacagatgaggggcgcacctattgacatttgaggggctgtccacaggcagaaaatccagcatttgcaagggtttccgcccgtttttcggccaccgctaacctgtcttttaacctgcttttaaaccaatatttataaaccttgtttttaaccagggctgcgccctgtgcgcgtgaccgcgcacgccgaaggggggtgcccccccttctcgaaccctcccggcccgctctcgcgttggcagcatcacccataattgtggtttcaaaatcggctccgtcgatactatgttatacgccaactttgaaaacaactttgaaaaagctgttttctggtatttaaggttttagaatgcaaggaacagtgaattggagttcgtcttgttataattagcttcttggggtatctttaaatactgtagaaaagaggaaggaaataataaatggctaaaatgagaatatcaccggaattgaaaaaactgatcgaaaaataccgctgcgtaaaagatacggaaggaatgtctcctgctaaggtatataagctggtgggagaaaatgaaaacctatatttaaaaatgacggacagccggtataaagggaccacctatgatgtggaacgggaaaaggacatgatgctatggctggaaggaaagctgcctgttccaaaggtcctgcactttgaacggcatgatggctggagcaatctgctcatgagtgaggccgatggcgtcctttgctcggaagagtatgaagatgaacaaagccctgaaaagattatcgagctgtatgcggagtgcatcaggctctttcactccatcgacatatcggattgtccctatacgaatagcttagacagccgcttagccgaattggattacttactgaataacgatctggccgatgtggattgcgaaaactgggaagaagacactccatttaaagatccgcgcgagctgtatgattttttaaagacggaaaagcccgaagaggaacttgtcttttcccacggcgacctgggagacagcaacatctttgtgaaagatggcaaagtaagtggctttattgatcttgggagaagcggcagggcggacaagtggtatgacattgccttctgcgtccggtcgatcagggaggatattggggaagaacagtatgtcgagctattttttgacttactggggatcaagcctgattgggagaaaataaaatattatattttactggatgaattgttttagtacctagatgtggcgcaacgatgccggcgacaagcaggagcgcaccgacttcttccgcatcaagtgttttggctctcaggccgaggcccacggcaagtatttgggcaaggggtcgctggtattcgtgcagggcaagattcggaataccaagtacgagaaggacggccagacggtctacgggaccgacttcattgccgataaggtggattatctggacaccaaggcaccaggcgggtcaaatcaggaataagggcacattgccccggcgtgagtcggggcaatcccgcaaggagggtgaatgaatcggacgtttgaccggaaggcatacaggcaagaactgatcgacgcggggttttccgccgaggatgccgaaaccatcgcaagccgcaccgtcatgcgtgcgccccgcgaaaccttccagtccgtcggctcgatggtccagcaagctacggccaagatcgagcgcgacagcgtgcaactggctccccctgccctgcccgcgccatcggccgccgtggagcgttcgcgtcgtctcgaacaggaggcggcaggtttggcgaagtcgatgaccatcgacacgcgaggaactatgacgaccaagaagcgaaaaaccgccggcgaggacctggcaaaacaggtcagcgaggccaagcaagccgcgttgctgaaacacacgaagcagcagatcaaggaaatgcagctttccttgttcgatattgcgccgtggccggacacgatgcgagcgatgccaaacgacacggcccgctctgccctgttcaccacgcgcaacaagaaaatcccgcgcgaggcgctgcaaaacaaggtcattttccacgtcaacaaggacgtgaagatcacctacaccggcgtcgagctgcgggccgacgatgacgaactggtgtggcagcaggtgttggagtacgcgaagcgcacccctatcggcgagccgatcaccttcacgttctacgagctttgccaggacctgggctggtcgatcaatggccggtattacacgaaggccgaggaatgcctgtcgcgcctacaggcgacggcgatgggcttcacgtccgaccgcgttgggcacctggaatcggtgtcgctgctgcaccgcttccgcgtcctggaccgtggcaagaaaacgtcccgttgccaggtcctgatcgacgaggaaatcgtcgtgctgtttgctggcgaccactacacgaaattcatatgggagaagtaccgcaagctgtcgccgacggcccgacggatgttcgactatttcagctcgcaccgggagccgtacccgctcaagctggaaaccttccgcctcatgtgcggatcggattccacccgcgtgaagaagtggcgcgagcaggtcggcgaagcctgcgaagagttgcgaggcagcggcctggtggaacacgcctgggtcaatgatgacctggtgcattgcaaacgctagggccttgtggggtcagttccggctgggggttcagcagccagcgctttactgagatcctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggatctcctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgctagtggatctcccagtcacgacgttgtaaaacgggcgccccgcggaaAGCTTGGGATCTTCTGCAAGCATCTCTATTTCCTGAAGGTCTAACCTCGAAGATTTAAGATTTAATTACGTTTATAATTACAAAATTGATTCTAGTATCTTTAATTTAATGCTTATACATTATTAATTAATTTAGTACTTTCAATTTGTTTTCAGAAATTATTTTACTATTTTTTATAAAATAAAAGGGAGAAAATGGCTATTTAAATACTAGCCTATTTTATTTCAATTTTAGCTTAAAATCAGCCCCAATTAGCCCCAATTTCAAATTCAAATGGTCCAGCCCAATTCCTAAATAACCCACCCCTAACCCGCCCGGTTTCCCCTTTTGATCCATGCAGTCAACGCCCAGAATTTCCCTATATAATTTTTTAATTCCCAAACACCCCTAACTCTATCCCATTTCTCACCAACCGCCACATAGATCTATCCTCTTATCTCTCAAACTCTCTCGAACCTTCCCCTAACCCTAGCAGCCTCTCATCATCCTCACCTCAAAACCCACCGGApORE Expression Series Vector with BioBrick MCSX
9
BBa_K382004VectorV119286AGAGCTCATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCGACGGCCTGTGGGCATTCAGTCTGGATCGCGAAAACTGTGGAATTGATCAGCGTTGGTGGGAAAGCGCGTTACAAGAAAGCCGGGCTATTGCTGTGCCAGGCAGTTTTAACGATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAGCGCGAAGTCTTTATACCGAAAGGTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCGATGCGGTCACTCATTACGGCAAAGTGTGGGTCAATAATCAGGAAGTGATGGAGCATCAGGGCGGCTATACGCCATTTGAAGCCGATGTCACGCCGTATGTTATTGCCGGGAAAAGTGTACGTATCACCGTTTGTGTGAACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACCGACGAAAACGGCAAGAAAAAGCAGTCTTACTTCCATGATTTCTTTAACTATGCCGGAATCCATCGCAGCGTAATGCTCTACACCACGCCGAACACCTGGGTGGACGATATTACCGTGGTGACGCATGTCGCGCAAGACTGTAACCACGCTTCTGTTGACTGGCAGGTGGTGGCCAATGGTGATGTCAGCGTTGAACTGCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACTAGCGGGACTTTGCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTGTGCGTCACAGCCAAAAGCCAGACAGAGTGTGATATTTACCCGCTTCGCGTCGGCATCCGGTCAGTGGCAGTGAAGGGCGAACAGTTCCTGATTAACCACAAACCGTTCTACTTTACTGGCTTTGGTCGTCATGAAGATGCGGACTTGCGTGGCAAAGGATTCGATAACGTGCTGATGGTGCACGACCACGCATTAATGGACTGGATTGGGGCCAACTCCTACCGTACCTCGCATTACCCTTACGCTGAAGAGATGCTCGACTGGGCAGATGAACATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTCGAAGCGGGCAACAAGCCGAAAGAACTGTACAGCGAAGAGGCAGTCAACGGGGAAACTCAGCAAGCGCACTTACAGGCGATTAAAGAGCTGATAGCGCGTGACAAAAACCACCCAAGCGTGGTGATGTGGAGTATTGCCAACGAACCGGATACCCGTCCGCAAGGTGCACGGGAATATTTCGCGCCACTGGCGGAAGCAACCCGTAAACTCGACCCGACTCGTCCGATCACCTGCGTCAATGTAATGTTCTGCGACGCTCACACCGATACCATCAGCGATCTCTTTGATGTGCTGTGCCTGAACCGTTATTACGGATGGTATGTCCAAAGCGGCGATTTGGAAACGGCAGAGAAGGTACTGGAAAAAGAACTTCTGGCCTGGCAGGAGAAACTGCATCAGCCGATTATCATCACCGAATACGGCGTGGATACGTTAGCCGGGCTGCACTCAATGTACACCGACATGTGGAGTGAAGAGTATCAGTGTGCATGGCTGGATATGTATCACCGCGTCTTTGATCGCGTCAGCGCCGTCGTCGGTGAACAGGTATGGAATTTCGCCGATTTTGCGACCTCGCAAGGCATATTGCGCGTTGGCGGTAACAAGAAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGCGGCTTTTCTGCTGCAAAAACGCTGGACTGGCATGAACTTCGGTGAAAAACCGCAGCAGGGAGGCAAACAATGAGGTACCTTTTGctagtgatatccctgtgtgaaattgttatccgctacgcgtgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcccatgggaagttcctattccgaagttcctattctctgaaaagtataggaacttcagcgatcgcagacgtcaacgtggatacttggcagtggttacttggcttttcctttattttcttttggacggaagcggtggttactttgtcacacatttaaaaaaacacgtgtttctcacttttttctattcccgtcacaaacaattttaagaaagatccatctatcgtgatctttctatcaaacaaaagaaaaaaggtcttcatagtaacgctacaacatcaaatatgtggttgctctgacatcagtcgggaaaataaggatatggcggcattggccacatctattggggtcccaacttcctttcacaaaaaaattaaattgggtgtcccaacttttatctttgatatagtgacatgagtatcgggagcattggacaatggataaaatgagaactaaaaaaattctggttaatttttgatcattgttatttaaaaggttattttatctataatctacccatattgatcagttttatttaaatttgtttagctaccgctccacgagagagatcctcatcttaaaaatggaatatggaaattacacacgaccccaaaagtatattttttctctggagaatgctatttagagctttgactatatggtctgaattagaaagacgggaaataaaatctgctaagtgatataagctctaagtaggcgatgtgtgatggagaacaccttttctttaacagtcttcatgttttacagattcgcgaacttcgaatatccctatacggtctgtctaaccctcgtgtgtcttttgagtccaagataaaggccattattgagtaacatagacatgctggaatccaaccattgaagtcacaactgtccatgtagattctttggagaatctgaaaagtcttaataaaggtggtgtttcaaagaaaacaaaacaaatgagttaagaaaaaaaaatatcatgtagtggtcgagtattatgttatttattgtgtagctaccaatctttattctttaaatctgacataaaatgctacaaactttttacctcgtctatagccccaaaaaacctaaccacggttctaaaaccacacacagtgattttggttgacgacaatgcctctccttcctcaaaacgatttatttacattttttaaatcaaatgttacattttataccataattaagtctttttacagaatacttagatggaagagatgtataaaaaaggaggaaattgtaaaaaacatatttcgatcaattaaaccaggattcataaaaatataagtatatatataaatgatgtttcgtttagcgatgaacttcactcatatgataatacttaacaatataagtacataaaaaataaaataaaattaattgtttacgaaaagtctacaaatactgcatgtataattaatgttctctttatttatttatttataccttaccaagatatatctataaccgcatagaaatagaaggcgaagagataatttccaaaaacaagaaaaacctctaagctcaaaagggccggccatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggaggccggttctttttgtcaagaccgacctgtccggtgccctgaatgaacttcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgactcatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaggcgcgccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatccctagggaagttcctattccgaagttcctattctctgaaaagtataggaacttctttgcgtattgggcgctcttggcctttttggccaccggtcgtacggttaaaaccaccccagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccactagacgctcaccgggctggttgccctcgccgctgggctggcggccgtctatggccctgcaaacgcgccagaaacgccgtcgaagccgtgtgcgagacaccgcagccgccggcgttgtggatacctcgcggaaaacttggccctcactgacagatgaggggcggacgttgacacttgaggggccgactcacccggcgcggcgttgacagatgaggggcaggctcgatttcggccggcgacgtggagctggccagcctcgcaaatcggcgaaaacgcctgattttacgcgagtttcccacagatgatgtggacaagcctggggataagtgccctgcggtattgacacttgaggggcgcgactactgacagatgaggggcgcgatccttgacacttgaggggcagagtgctgacagatgaggggcgcacctattgacatttgaggggctgtccacaggcagaaaatccagcatttgcaagggtttccgcccgtttttcggccaccgctaacctgtcttttaacctgcttttaaaccaatatttataaaccttgtttttaaccagggctgcgccctgtgcgcgtgaccgcgcacgccgaaggggggtgcccccccttctcgaaccctcccggcccgctctcgcgttggcagcatcacccataattgtggtttcaaaatcggctccgtcgatactatgttatacgccaactttgaaaacaactttgaaaaagctgttttctggtatttaaggttttagaatgcaaggaacagtgaattggagttcgtcttgttataattagcttcttggggtatctttaaatactgtagaaaagaggaaggaaataataaatggctaaaatgagaatatcaccggaattgaaaaaactgatcgaaaaataccgctgcgtaaaagatacggaaggaatgtctcctgctaaggtatataagctggtgggagaaaatgaaaacctatatttaaaaatgacggacagccggtataaagggaccacctatgatgtggaacgggaaaaggacatgatgctatggctggaaggaaagctgcctgttccaaaggtcctgcactttgaacggcatgatggctggagcaatctgctcatgagtgaggccgatggcgtcctttgctcggaagagtatgaagatgaacaaagccctgaaaagattatcgagctgtatgcggagtgcatcaggctctttcactccatcgacatatcggattgtccctatacgaatagcttagacagccgcttagccgaattggattacttactgaataacgatctggccgatgtggattgcgaaaactgggaagaagacactccatttaaagatccgcgcgagctgtatgattttttaaagacggaaaagcccgaagaggaacttgtcttttcccacggcgacctgggagacagcaacatctttgtgaaagatggcaaagtaagtggctttattgatcttgggagaagcggcagggcggacaagtggtatgacattgccttctgcgtccggtcgatcagggaggatattggggaagaacagtatgtcgagctattttttgacttactggggatcaagcctgattgggagaaaataaaatattatattttactggatgaattgttttagtacctagatgtggcgcaacgatgccggcgacaagcaggagcgcaccgacttcttccgcatcaagtgttttggctctcaggccgaggcccacggcaagtatttgggcaaggggtcgctggtattcgtgcagggcaagattcggaataccaagtacgagaaggacggccagacggtctacgggaccgacttcattgccgataaggtggattatctggacaccaaggcaccaggcgggtcaaatcaggaataagggcacattgccccggcgtgagtcggggcaatcccgcaaggagggtgaatgaatcggacgtttgaccggaaggcatacaggcaagaactgatcgacgcggggttttccgccgaggatgccgaaaccatcgcaagccgcaccgtcatgcgtgcgccccgcgaaaccttccagtccgtcggctcgatggtccagcaagctacggccaagatcgagcgcgacagcgtgcaactggctccccctgccctgcccgcgccatcggccgccgtggagcgttcgcgtcgtctcgaacaggaggcggcaggtttggcgaagtcgatgaccatcgacacgcgaggaactatgacgaccaagaagcgaaaaaccgccggcgaggacctggcaaaacaggtcagcgaggccaagcaagccgcgttgctgaaacacacgaagcagcagatcaaggaaatgcagctttccttgttcgatattgcgccgtggccggacacgatgcgagcgatgccaaacgacacggcccgctctgccctgttcaccacgcgcaacaagaaaatcccgcgcgaggcgctgcaaaacaaggtcattttccacgtcaacaaggacgtgaagatcacctacaccggcgtcgagctgcgggccgacgatgacgaactggtgtggcagcaggtgttggagtacgcgaagcgcacccctatcggcgagccgatcaccttcacgttctacgagctttgccaggacctgggctggtcgatcaatggccggtattacacgaaggccgaggaatgcctgtcgcgcctacaggcgacggcgatgggcttcacgtccgaccgcgttgggcacctggaatcggtgtcgctgctgcaccgcttccgcgtcctggaccgtggcaagaaaacgtcccgttgccaggtcctgatcgacgaggaaatcgtcgtgctgtttgctggcgaccactacacgaaattcatatgggagaagtaccgcaagctgtcgccgacggcccgacggatgttcgactatttcagctcgcaccgggagccgtacccgctcaagctggaaaccttccgcctcatgtgcggatcggattccacccgcgtgaagaagtggcgcgagcaggtcggcgaagcctgcgaagagttgcgaggcagcggcctggtggaacacgcctgggtcaatgatgacctggtgcattgcaaacgctagggccttgtggggtcagttccggctgggggttcagcagccagcgctttactgagatcctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggatctcctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgctagtggatctcccagtcacgacgttgtaaaacgggcgccccgcggaaAGCTTpORE Reporter Series Vector with BioBrick MCSX
10
BBa_K382005VectorV128203gatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatccctagggaagttcctattccgaagttcctattctctgaaaagtataggaacttctttgcgtattgggcgctcttggcctttttggccaccggtcgtacggttaaaaccaccccagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccactagacgctcaccgggctggttgccctcgccgctgggctggcggccgtctatggccctgcaaacgcgccagaaacgccgtcgaagccgtgtgcgagacaccgcagccgccggcgttgtggatacctcgcggaaaacttggccctcactgacagatgaggggcggacgttgacacttgaggggccgactcacccggcgcggcgttgacagatgaggggcaggctcgatttcggccggcgacgtggagctggccagcctcgcaaatcggcgaaaacgcctgattttacgcgagtttcccacagatgatgtggacaagcctggggataagtgccctgcggtattgacacttgaggggcgcgactactgacagatgaggggcgcgatccttgacacttgaggggcagagtgctgacagatgaggggcgcacctattgacatttgaggggctgtccacaggcagaaaatccagcatttgcaagggtttccgcccgtttttcggccaccgctaacctgtcttttaacctgcttttaaaccaatatttataaaccttgtttttaaccagggctgcgccctgtgcgcgtgaccgcgcacgccgaaggggggtgcccccccttctcgaaccctcccggcccgctctcgcgttggcagcatcacccataattgtggtttcaaaatcggctccgtcgatactatgttatacgccaactttgaaaacaactttgaaaaagctgttttctggtatttaaggttttagaatgcaaggaacagtgaattggagttcgtcttgttataattagcttcttggggtatctttaaatactgtagaaaagaggaaggaaataataaatggctaaaatgagaatatcaccggaattgaaaaaactgatcgaaaaataccgctgcgtaaaagatacggaaggaatgtctcctgctaaggtatataagctggtgggagaaaatgaaaacctatatttaaaaatgacggacagccggtataaagggaccacctatgatgtggaacgggaaaaggacatgatgctatggctggaaggaaagctgcctgttccaaaggtcctgcactttgaacggcatgatggctggagcaatctgctcatgagtgaggccgatggcgtcctttgctcggaagagtatgaagatgaacaaagccctgaaaagattatcgagctgtatgcggagtgcatcaggctctttcactccatcgacatatcggattgtccctatacgaatagcttagacagccgcttagccgaattggattacttactgaataacgatctggccgatgtggattgcgaaaactgggaagaagacactccatttaaagatccgcgcgagctgtatgattttttaaagacggaaaagcccgaagaggaacttgtcttttcccacggcgacctgggagacagcaacatctttgtgaaagatggcaaagtaagtggctttattgatcttgggagaagcggcagggcggacaagtggtatgacattgccttctgcgtccggtcgatcagggaggatattggggaagaacagtatgtcgagctattttttgacttactggggatcaagcctgattgggagaaaataaaatattatattttactggatgaattgttttagtacctagatgtggcgcaacgatgccggcgacaagcaggagcgcaccgacttcttccgcatcaagtgttttggctctcaggccgaggcccacggcaagtatttgggcaaggggtcgctggtattcgtgcagggcaagattcggaataccaagtacgagaaggacggccagacggtctacgggaccgacttcattgccgataaggtggattatctggacaccaaggcaccaggcgggtcaaatcaggaataagggcacattgccccggcgtgagtcggggcaatcccgcaaggagggtgaatgaatcggacgtttgaccggaaggcatacaggcaagaactgatcgacgcggggttttccgccgaggatgccgaaaccatcgcaagccgcaccgtcatgcgtgcgccccgcgaaaccttccagtccgtcggctcgatggtccagcaagctacggccaagatcgagcgcgacagcgtgcaactggctccccctgccctgcccgcgccatcggccgccgtggagcgttcgcgtcgtctcgaacaggaggcggcaggtttggcgaagtcgatgaccatcgacacgcgaggaactatgacgaccaagaagcgaaaaaccgccggcgaggacctggcaaaacaggtcagcgaggccaagcaagccgcgttgctgaaacacacgaagcagcagatcaaggaaatgcagctttccttgttcgatattgcgccgtggccggacacgatgcgagcgatgccaaacgacacggcccgctctgccctgttcaccacgcgcaacaagaaaatcccgcgcgaggcgctgcaaaacaaggtcattttccacgtcaacaaggacgtgaagatcacctacaccggcgtcgagctgcgggccgacgatgacgaactggtgtggcagcaggtgttggagtacgcgaagcgcacccctatcggcgagccgatcaccttcacgttctacgagctttgccaggacctgggctggtcgatcaatggccggtattacacgaaggccgaggaatgcctgtcgcgcctacaggcgacggcgatgggcttcacgtccgaccgcgttgggcacctggaatcggtgtcgctgctgcaccgcttccgcgtcctggaccgtggcaagaaaacgtcccgttgccaggtcctgatcgacgaggaaatcgtcgtgctgtttgctggcgaccactacacgaaattcatatgggagaagtaccgcaagctgtcgccgacggcccgacggatgttcgactatttcagctcgcaccgggagccgtacccgctcaagctggaaaccttccgcctcatgtgcggatcggattccacccgcgtgaagaagtggcgcgagcaggtcggcgaagcctgcgaagagttgcgaggcagcggcctggtggaacacgcctgggtcaatgatgacctggtgcattgcaaacgctagggccttgtggggtcagttccggctgggggttcagcagccagcgctttactgagatcctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggatctcctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaataaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgctagtggatctcccagtcacgacgttgtaaaacgggcgccccgcggaaAGCTTpORE Reporter Series Vector with BioBrick MCSX
11
12
BBa_K382010ColorC1413CCCACAAACACACGCTCGGACGCATATTACACATGTTCATACACTTAATACTCGCTGTTTTGAATTGATGTTTTAGGAATATATATGTAGAATACGGGTTACTACGAAGTTTTCACAGGTCGTGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGTCGCCAAAATTCAAACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTGATTCTCTTTGATAACTTCCTAGTAACCCGCATTCTCTCTTTTGTATTCCAATTTTCTTGATTAATCTTTCCTGCACAAAAACATGCTTGATCCACTAAGTGACATATATGCTGCCTTCGTATATATAGTTCTGGTAAAATTAACATTTTGGGTTTATCTTTATTTAAGGCATCGCCATGGGGamiRNA Construct for lycopene epsilon cyclase (LUT2)X
13
BBa_K382011ColorC2413CCCACAAACACACGCTCGGACGCATATTACACATGTTCATACACTTAATACTCGCTGTTTTGAATTGATGTTTTAGGAATATATATGTAGAGCATCTCTTCGATATAAACGTTCACAGGTCGTGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGTCGCCAAAATTCAAACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTGATTCTCTTTGATCGTTTAAATCGAAGAGACGCTCTCTCTTTTGTATTCCAATTTTCTTGATTAATCTTTCCTGCACAAAAACATGCTTGATCCACTAAGTGACATATATGCTGCCTTCGTATATATAGTTCTGGTAAAATTAACATTTTGGGTTTATCTTTATTTAAGGCATCGCCATGGGGamiRNA Construct for carotene beta-ring hydroxylase (BETA-OHASE 1)X
14
BBa_K382012ColorC3413CCCACAAACACACGCTCGGACGCATATTACACATGTTCATACACTTAATACTCGCTGTTTTGAATTGATGTTTTAGGAATATATATGTAGACTACAAGTCGTTGCATAATTTTCACAGGTCGTGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGTCGCCAAAATTCAAACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTGATTCTCTTTGATAATTATCCAACGACTTGCAGTCTCTCTTTTGTATTCCAATTTTCTTGATTAATCTTTCCTGCACAAAAACATGCTTGATCCACTAAGTGACATATATGCTGCCTTCGTATATATAGTTCTGGTAAAATTAACATTTTGGGTTTATCTTTATTTAAGGCATCGCCATGGGGamiRNA Construct for lycopene beta cyclase (LYC)X
15
16
BBa_K382013AllergyA1436CTAGACCCacaaacacacgctcggacgcatattacacatgttcatacacttaatactcgctgttttgaattgatgttttaggaatatatatgtagaGTACAGCTCGCCGTCCACTATtcacaggtcgtgatatgattcaattagcttccgactcattcatccaaataccgagtcgccaaaattcaaactagactcgttaaatgaatgaatgatgcggtagacaaattggatcattgattctctttgaTTAGTGGTCGGCGAGCTGCACtctctcttttgtattccaattttcttgattaatctttcctgcacaaaaacatgcttgatccactaagtgacatatatgctgccttcgtatatatagttctggtaaaattaacattttgggtttatctttatttaaggcatcgccatgGGACTAGTAGCGGCCGCTGCAamiRNA GFP in pSB1C3X
17
BBa_K382014AllergyA21334CTAGAATGATAGAAGAGGAGATTGAGGTAGACGTCGATATTAAAGCCAGGGCTGACAAGTTCCACAAGTTCATCAGAAGATCACAACATGTGCCCAAAGCCACTCACTACATTAAGGGATGTGATCTGCTCGAAGGCGAGTGGGGAAAAGTTGGAAGCATACTCTTGTGGAAATTAGTTTTTGGTAATGGTTATATATATCGCACCTTAATATATTAGATCATGGTAACGTATTTTTTAATATGGTAACTAGACCAATTGGTAAGGAAATAATTATTTTCTTTTTTCCTTTTAGTATAAAATAGTTAAGTGATGTTAATTAGTATGATTATAATAATATAGTTGTTATAATTGTGAAAAAATAATTTATAAATATATTGTTTACATAAACAACATAGTAATGTAAAAAAATATGACAAGTGATGTGTAAGACGAAGAAGATAAAAGTTGAGAGTAAGTATATTATTTTTAATGAATTTGATCGAACATGTAAGATGATATACTAGCATTAATATTTGTTTTAATCATAATAGTAATTCTAGCTGGTTTGATGAATTAAATATCAATGATAAAATACTATAGTAAAAATAAGAATAAATAAATTAAAATAATATTTTTTTATGATTAATAGTTTATTATATAATTAAATATCTATACCATTACTAAATATTTTAGTTTAAAAGTTAATAAATATTTTGTTAGAAATTCCAATCTGCTTGTAATTTATCAATAAACAAAATATTAAATAACAAGCTAAAGTAACAAATAATATCAAACTAATAGAAACAGTAATCTAATGTAACAAAACATAATCTAATGCTAATATAACAAAGCGCAAGATCTATCATTTTATATAGTATTATTTTCAATCAACATTCTTATTAATTTCTAAATAATACTTGTAGTTTTATTAACTTCTAAATGGATTGACTATTAATTAAATGAATTAGTCGAACATGAATAAACAAGGTAACATGATAGATCATGTCATTGTGTTATCATTGATCTTACATTTGGATTGATTACAGTTGGGAAATTGGGTTCGAAA**CCTTGAATTCGCGGCCGCACTAGATACCATATTAAAAAATACGTTACCATGATCTAATATATTAAGGTGCGATATATATAACCATTACCAAAAACTAATTTCCACAAGAGTATGCTTCCAACTTTTCCCCACTCGCCTTCGAGCAGATCACATCCCTTAATGTAGTGAGTGGCTTTGGGCACATGTTGTGATCTTCTGATGAACTTGTGGAACTTGTCAGCCCTGGCTTTAATATCGACGTCTACCTCAATCTCCTCTTCTATCATACTAGTAGCGGCCGCTGCABet w/ PDK intron in pSB1C3missing DNA
18
BBa_K382015AllergyA31415CCTTGAATTCGCGGCCGCATCTAGAATGGCTGGAGTGATGAAGTTGGCATGCTTGCTCTTGGCCTGCATGATTGTGGCCGGTCCAATCACATCGAACGCTGCGCTAAGCTGTGGCTCAGTTAACAGCAACTTGGCAGCGTGCATTGGCTACGTGCTCCAAGGTGGTGTCATTCCCCCAGCGTGTTGCTCCGGCGTTAAAAACCTCAACAGCATAGCCAAGACGACCCCAGACCGTCAGCAAGCTTGCAATTGCATTCAAGGTGCCGCTAGAGCCTTAGGCTCTGGTCTCAACGCTGGCCGTGCAGCTGACTAGACCAATTGGTAAGGAAATAATTATTTTCTTTTTTCCTTTTAGTATAAAATAGTTAAGTGATGTTAATTAGTATGATTATAATAATATAGTTGTTATAATTGTGAAAAAATAATTTATAAATATATTGTTTACATAAACAACATAGTAATGTAAAAAAATATGACAAGTGATGTGTAAGACGAAGAAGATAAAAGTTGAGAGTAAGTATATTATTTTTAATGAATTTGATCGAACATGTAAGATGATATACTAGCATTAATATTTGTTTTAATCATAATAGTAATTCTAGCTGGTTTGATGAATTAAATATCAATGATAAAATACTATAGTAAAAATAAGAATAAATAAATTAAAATAATATTTTTTTATGATTAATAGTTTATTATATAATTAAATATCTATACCATTACTAAATATTTTAGTTTAAAAGTTAATAAATATTTTGTTAGAAATTCCAATCTGCTTGTAATTTATCAATAAACAAAATATTAAATAACAAGCTAAAGTAACAAATAATATCAAACTAATAGAAACAGTAATCTAATGTAACAAAACATAATCTAATGCTAATATAACAAAGCGCAAGATCTATCATTTTATATAGTATTATTTTCAATCAACATTCTTATTAATTTCTAAATAATACTTGTAGTTTTATTAACTTCTAAATGGATTGACTATTAATTAAATGAATTAGTCGAACATGAATAAACAAGGTAACATGATAGATCATGTCATTGTGTTATCATTGATCTTACATTTGGATTGATTACAGTTGGGAAATTGGGTTCGAAACTAGACAGCTGCACGGCCAGCGTTGAGACCAGAGCCTAAGGCTCTAGCGGCACCTTGAATGCAATTGCAAGCTTGCTGACGGTCTGGGGTCGTCTTGGCTATGCTGTTGAGGTTTTTAACGCCGGAGCAACACGCTGGGGGAATGACACCACCTTGGAGCACGTAGCCAATGCACGCTGCCAAGTTGCTGTTAACTGAGCCACAGCTTAGCGCAGCGTTCGATGTGATTGGACCGGCCACAATCATGCAGGCCAAGAGCAAGCATGCCAACTTCATCACTCCAGCCATACTAGTAGCGGCCGCTGCALTP w/ PDK intron in pSB1C3missing DNA
19
BBa_K382016AllergyA41429CTAGAATGAAGATGATAATCCAAATTTTCTTCATCATCTCCCTCATTTCAACCATCTCTTTTGCCTCTGTTCAAGACTTTTGTGTAGCTGACCCAAAGGGTCCTCAAAGCCCATCAGGTTACTCTTGCAAGAACCCTGACCAAGTCACCGAAAATGACTTTGCATTTACCGGCCTCGGCACAGCTGGAAACACTTCCAACATCATTAAAGCCGCAGTGACTCCAGCCTTTGCTCCTGCTTACGCAGGCATCAATGGCCTTGGCGTATCTCTGGCTCGTCTTGACTTAGCCGGTGGTGGTGTCATCACTAGACCAATTGGTAAGGAAATAATTATTTTCTTTTTTCCTTTTAGTATAAAATAGTTAAGTGATGTTAATTAGTATGATTATAATAATATAGTTGTTATAATTGTGAAAAAATAATTTATAAATATATTGTTTACATAAACAACATAGTAATGTAAAAAAATATGACAAGTGATGTGTAAGACGAAGAAGATAAAAGTTGAGAGTAAGTATATTATTTTTAATGAATTTGATCGAACATGTAAGATGATATACTAGCATTAATATTTGTTTTAATCATAATAGTAATTCTAGCTGGTTTGATGAATTAAATATCAATGATAAAATACTATAGTAAAAATAAGAATAAATAAATTAAAATAATATTTTTTTATGATTAATAGTTTATTATATAATTAAATATCTATACCATTACTAAATATTTTAGTTTAAAAGTTAATAAATATTTTGTTAGAAATTCCAATCTGCTTGTAATTTATCAATAAACAAAATATTAAATAACAAGCTAAAGTAACAAATAATATCAAACTAATAGAAACAGTAATCTAATGTAACAAAACATAATCTAATGCTAATATAACAAAGCGCAAGATCTATCATTTTATATAGTATTATTTTCAATCAACATTCTTATTAATTTCTAAATAATACTTGTAGTTTTATTAACTTCTAAATGGATTGACTATTAATTAAATGAATTAGTCGAACATGAATAAACAAGGTAACATGATAGATCATGTCATTGTGTTATCATTGATCTTACATTTGGATTGATTACAGTTGGGAAATTGGGTTCGAAACTAGAGATGACACCACCACCGGCTAAGTCAAGACGAGCCAGAGATACGCCAAGGCCATTGATGCCTGCGTAAGCAGGAGCAAAGGCTGGAGTCACTGCGGCTTTAATGATGTTGGAAGTGTTTCCAGCTGTGCCGAGGCCGGTAAATGCAAAGTCATTTTCGGTGACTTGGTCAGGGTTCTTGCAAGAGTAACCTGATGGGCTTTGAGGACCCTTTGGGTCAGCTACACAAAAGTCTTGAACAGAGGCAAAAGAGATGGTTGAAATGAGGGAGATGATGAAGAAAATTTGGATTATCATCTTCATACTAGTAGCGGCCGCTGCAGer w/ PDK intron in pSB1C3missing DNA
20
21
BBa_K382020FlavorF1206GAATTCGCGGCCGCTTCTAGAATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCAAACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTATGATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTATACTAGTAGCGGCCGCTGCAGArabidopsis optimized Brazzein
22
BBa_K382021FlavorF2701GAATTCGCGGCCGCTTCTAGAATGAAGGAGCTTACCATGCTTTCACTTTCTTTTTTCTTCGTGTCTGCTCTTTTGGCTGCTGCTGCTAACCCTCTTTTGTCTGCTGCTGATTCTGCTCCAAACCCTGTTCTCGATATCGATGGAGAGAAATTGAGAACCGGAACAAACTATTATATCGTGCCTGTGCTTAGAGATCACGGTGGAGGACTCACTGTTAGTGCTACTACTCCAAACGGAACCTTCGTGTGTCCACCTAGAGTTGTTCAGACTAGGAAGGAAGTGGATCATGATAGACCACTCGCTTTTTTCCCTGAAAATCCTAAAGAGGATGTTGTTAGAGTTTCTACCGATTTGAACATCAACTTTTCTGCTTTCATGCCTTGTAGATGGACCTCTTCAACTGTGTGGAGACTCGATAAGTATGATGAGTCTACCGGACAGTATTTCGTGACTATCGGAGGAGTGAAGGGTAATCCTGGTCCTGAGACTATTAGTTCTTGGTTTAAAATCGAGGAGTTCTGTGGATCTGGTTTCTATAAACTTGTGTTTTGCCCAACTGTGTGTGGATCTTGTAAAGTGAAATGTGGTGATGTGGGAATCTATATCGATCAAAAGGGAAGGAGGAGACTTGCTTTGTCTGATAAGCCTTTCGCTTTCGAGTTCAACAAAACCGTTTATTTCACTAGTAGCGGCCGCTGCAGArabidopsis optimized Miraculin
23
BBa_K382022FlavorF3544GAATTCGCGGCCGCTTCTAGAGGGATCTTCTGCAAGCATCTCTATTTCCTGAAGGTCTAACCTCGAAGATTTAAGATTTAATTACGTTTATAATTACAAAATTGATTCTAGTATCTTTAATTTAATGCTTATACATTATTAATTAATTTAGTACTTTCAATTTGTTTTCAGAAATTATTTTACTATTTTTTATAAAATAAAAGGGAGAAAATGGCTATTTAAATACTAGCCTATTTTATTTCAATTTTAGCTTAAAATCAGCCCCAATTAGCCCCAATTTCAAATTCAAATGGTCCAGCCCAATTCCTAAATAACCCACCCCTAACCCGCCCGGTTTCCCCTTTTGATCCATGCAGTCAACGCCCAGAATTTCCCTATATAATTTTTTAATTCCCAAACACCCCTAACTCTATCCCATTTCTCACCAACCGCCACATAGATCTATCCTCTTATCTCTCAAACTCTCTCGAACCTTCCCCTAACCCTAGCAGCCTCTCATCATCCTCACCTCAAAACCCACCGGAACTAGTAGCGGCCGCTGCAGpENTCUP2 plant specific promoter
24
BBa_K382023FlavorF4294GAATTCGCGGCCGCATCTAGAGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCACTAGTAGCGGCCGCTGCAGNosT plant specific terminator
25
BBa_K382024FlavorF5297GAATTCGCGGCCGCTTCTAGATGAGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCACTAGTAGCGGCCGCTGCAGNosT plant specific terminator with Stop
26
BBa_K382025FlavorF6737GAATTCGCGGCCGCTTCTAGAAGTGCTTGGTCTCACCCACAATTCGAAAAGACTAGAATGAAGGAGCTTACCATGCTTTCACTTTCTTTTTTCTTCGTGTCTGCTCTTTTGGCTGCTGCTGCTAACCCTCTTTTGTCTGCTGCTGATTCTGCTCCAAACCCTGTTCTCGATATCGATGGAGAGAAATTGAGAACCGGAACAAACTATTATATCGTGCCTGTGCTTAGAGATCACGGTGGAGGACTCACTGTTAGTGCTACTACTCCAAACGGAACCTTCGTGTGTCCACCTAGAGTTGTTCAGACTAGGAAGGAAGTGGATCATGATAGACCACTCGCTTTTTTCCCTGAAAATCCTAAAGAGGATGTTGTTAGAGTTTCTACCGATTTGAACATCAACTTTTCTGCTTTCATGCCTTGTAGATGGACCTCTTCAACTGTGTGGAGACTCGATAAGTATGATGAGTCTACCGGACAGTATTTCGTGACTATCGGAGGAGTGAAGGGTAATCCTGGTCCTGAGACTATTAGTTCTTGGTTTAAAATCGAGGAGTTCTGTGGATCTGGTTTCTATAAACTTGTGTTTTGCCCAACTGTGTGTGGATCTTGTAAAGTGAAATGTGGTGATGTGGGAATCTATATCGATCAAAAGGGAAGGAGGAGACTTGCTTTGTCTGATAAGCCTTTCGCTTTCGAGTTCAACAAAACCGTTTATTTCACTAGTAGCGGCCGCTGCAGArabidopsis optimized Miraculin with StrepII N-terminus tag
27
BBa_K382026FlavorF7242GAATTCGCGGCCGCTTCTAGAAGTGCTTGGTCTCACCCACAATTCGAAAAGACTAGAATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCAAACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTATGATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTATACTAGTAGCGGCCGCTGCAGArabidopsis optimized Brazzein with StrepII N-terminus tag
28
BBa_K382027FlavorF8737GAATTCGCGGCCGCTTCTAGAATGAAGGAGCTTACCATGCTTTCACTTTCTTTTTTCTTCGTGTCTGCTCTTTTGGCTGCTGCTGCTAACCCTCTTTTGTCTGCTGCTGATTCTGCTCCAAACCCTGTTCTCGATATCGATGGAGAGAAATTGAGAACCGGAACAAACTATTATATCGTGCCTGTGCTTAGAGATCACGGTGGAGGACTCACTGTTAGTGCTACTACTCCAAACGGAACCTTCGTGTGTCCACCTAGAGTTGTTCAGACTAGGAAGGAAGTGGATCATGATAGACCACTCGCTTTTTTCCCTGAAAATCCTAAAGAGGATGTTGTTAGAGTTTCTACCGATTTGAACATCAACTTTTCTGCTTTCATGCCTTGTAGATGGACCTCTTCAACTGTGTGGAGACTCGATAAGTATGATGAGTCTACCGGACAGTATTTCGTGACTATCGGAGGAGTGAAGGGTAATCCTGGTCCTGAGACTATTAGTTCTTGGTTTAAAATCGAGGAGTTCTGTGGATCTGGTTTCTATAAACTTGTGTTTTGCCCAACTGTGTGTGGATCTTGTAAAGTGAAATGTGGTGATGTGGGAATCTATATCGATCAAAAGGGAAGGAGGAGACTTGCTTTGTCTGATAAGCCTTTCGCTTTCGAGTTCAACAAAACCGTTTATTTCACTAGAAGTGCTTGGTCTCACCCACAATTCGAAAAGACTAGTAGCGGCCGCTGCAGArabidopsis optimized Miraculin with StrepII C-terminus tag
29
BBa_K382028FlavorF9242GAATTCGCGGCCGCTTCTAGAATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCAAACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTATGATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTATACTAGAAGTGCTTGGTCTCACCCACAATTCGAAAAGACTAGTAGCGGCCGCTGCAGArabidopsis optimized Brazzein with StrepII C-terminus tag
30
31
BBa_K382029FenceE1556GAATTCGCGGCCGCTTCTAGACCAGAAGGTAATTATCCAAGATGTAGCATCAAGAATCCAATGTTTACGGGAAAAACTATGGAAGTATTATGTGAGCTCAGCAAGAAGCAGATCAATATGCGGCACATATGCAACCTATGTTCAAAAATGAAGAATGTACAGATACAAGATCCTATACTGCCAGAATACGAAGAAGAATACGTAGAAATTGAAAAAGAAGAACCAGGCGAAGAAAAGAATCTTGAAGACGTAAGCACTGACGACAACAATGAAAAGAAGAAGATAAGGTCGGTGATTGTGAAAGAGACATAGAGGACACATGTAAGGTGGAAAATGTAAGGGCGGAAAGTAACCTTATCACAAAGGAATCTTATCCCCCACTACTTATCCTTTTATATTTTTCCGTGTCATTTTTGCCCTTGAGTTTTCCTATATAAGGAACCAAGTTCGGCATTTGTGAAAACAAGAAAAAATTTGGTGTAAGCTATTTTCTTTGAAGTACTGAGGATACAACTTCAGAGAAATTTGTAAGTTTGACTAGTAGCGGCCGCTGCAGCaMV (Cauliflower Mosaic Virus) promoter
32
BBa_K382030FenceE2671AAGCTTGAATTCGCGGCCGCTTCTAGATCTCCAAACGATCCTGTGACCAACATTTGTCAGGCTGCTGATAAGCAACTCTTCACCCTCGTGGAATGGGCTAAGAGAATCCCACACTTTAGTAGTCTCCCTCTCGATGATCAAGTGATCTTGTTGAGGGCTGGATGGAACGAACTTCTCATTGCTTCATTTTCTCATAGGAGTATCGATGTGAGAGATGGTATCCTTCTTGCTACTGGACTCCATGTTCATAGAAACTCTGCTCATTCTGCTGGAGTTGGAGCAATTTTCGATAGAGTGCTCACCGAGCTTGTGTCTAAAATGAGGGATATGAGGATGGATAAGACCGAACTCGGATGCCTTAGGGCTATCATTCTTTTCAACCCTGATGCTAAAGGATTGAGTAACCCATCTGAAGTGGAGGTGTTGAGAGAGAAAGTTTATGCTAGTCTTGAGACATATTGCAAACAAAAGTATCCTGAGCAACAGGGAAGATTCGCTAAACTCCTCCTTAGACTCCCTGCTTTGAGATCAATCGGACTCAAATGCCTCGAACACTTGTTTTTCTTCAAACTCATCGGAGATACCCCAATCGATACCTTCCTTATGGAAATGCTTGAGGCTCCTCACCAATTGGCTTGAACTAGTAGCGGCCGCTGCAGCTCGAGGGATCCHuman RxRef (Retinoic Acid Receptor)
33
BBa_K382031FenceE3689AAGCTTGAATTCGCGGCCGCTTCTAGAGTGGAGTATGAGAGTACCATGAACAACATCTGCCAGGCTGCTAACATTTGTCAGGCTACCAACAAACAACTCTTCCAACTCGTGGAATGGGCTAAACACATCCCTCACTTCACATCATTGCCACTTGAGGATCAAGTTCTTCTCCTTAGGGCTGGATGGAACGAGCTTCTTATCGCTGCTTTCTCTCATAGGAGTGTGGATGTTAAGGATGGTATCGTGCTCGCTACTGGTCTTACCGTTCATAGAAACTCTGCTCACCAGGCTGGAGTGGGAACAATTTTCGATAGAGTGCTCACTGAGCTTGTGGCTAAAATGAGGGAGATGAAGATGGATAAGACCGAGCTTGGATGTTTGAGATCTGTGATTCTCTTCAACCCTGAAGTGAGAGGACTCAAATCTGCTCAGGAGGTTGAGTTGCTTAGGGAAAAAGTGTATGCTGCTTTGGAGGAGTATACCAGAACCACTCACCCAGATGAGCCTGGAAGATTCGCTAAACTCCTCTTGAGACTCCCATCTCTTAGGAGTATCGGATTGAAATGCCTCGAACACCTCTTTTTCTTTAGGCTTATCGGTGATGTTCCAATCGATACCTTTCTCATGGAAATGCTTGAGAGTCCTAGTGATTCATAAACTAGTAGCGGCCGCTGCAGCTCGAGGGATCCLocust RxRef (Retinoic Acid Receptor)
34
BBa_K382032FenceE4368GAATTCGCGGCCGCTTCTAGAATGGTTGCTTTCGCTACTGAAAAAAAACAGGATTTGAACTTGCTCTCTAAAATTGCTTCTGGTGATGGACATGGAGAAAACTCTTCATATTTCGATGGATGGAAGGCTTATGAGGAAAACCCATTTCACCCTATCGATAGACCTGATGGAGTGATCCAAATGGGATTGGCTGAGAACCAACTCTGTGGAGATCTCATGAGAAAATGGGTGCTCAAACACCCTGAGGCTTCAATCTGTACATCTGAGGGAGTGAATCAGTTTAGTGATATCGCTATCTTTGAATTTCCAAAACCTTCAACCCCTCCTGGATCTTCTGGTGGTGCTCCTACTAGTAGCGGCCGCTGCAGACC degradation tail + linker
35
BBa_K382033FenceE51061GGATCCGAATTCGCGGCCGCTTCTAGAAGGCCTGAATGTGTTGTGCCTGAGACTCAATGTGCTATGAAGAGGAAGGAGAAAAAAGCTCAAAAGGAAAAGGATAAGCTCCCTGTGTCTACTACTACCGTGGATGATCACATGCCACCAATCATGCAATGCGAACCTCCACCACCTGAGGCTGCTAGGATACACGAAGTTGTGCCTAGATTCTTGAGTGATAAGCTCCTCGAAACAAACAGACAAAAAAACATCCCACAACTCACCGCTAATCAACAATTTCTTATTGCTAGACTCATCTGGTATCAGGATGGATATGAGCAACCTAGTGATGAGGATTTGAAAAGGATCACCCAAACCTGGCAACAAGCTGATGATGAGAATGAGGAGAGTGATACTCCATTCAGACAAATCACCGAGATGACTATTCTTACCGTTCAACTCATCGTGGAATTTGCTAAGGGATTGCCTGGATTCGCTAAAATCTCTCAACCTGATCAAATCACCCTTCTCAAGGCTTGTTCTAGTGAGGTTATGATGCTTAGAGTGGCTAGGAGATATGATGCTGCTAGTGATAGTGTGCTCTTTGCTAACAACCAGGCTTATACAAGGGATAACTATAGGAAGGCTGGAATGGCTTATGTTATTGAGGATCTTCTCCACTTCTGTAGATGTATGTATTCTATGGCTCTCGATAACATCCACTATGCTCTTCTCACCGCTGTTGTGATATTCAGTGATAGACCTGGACTTGAGCAACCACAATTGGTTGAGGAAATCCAGAGATATTATCTCAACACCCTTAGGATCTATATCTTGAACCAGCTTTCTGGATCTGCTAGGAGTTCTGTGATCTATGGAAAAATCCTTTCTATCCTCTCTGAGCTTAGAACACTCGGAATGCAAAATTCAAACATGTGTATTAGTCTCAAACTCAAAAACAGGAAACTCCCTCCATTTCTTGAGGAGATCTGGGATGTGGCTGATATGAGTCACACTCAACCTCCACCAATCTTGGAATCTCCAACAAACCTCTGAACTAGTAGCGGCCGCTGCAGCCATGGEcrDEF (Ectosome Receptor)
36
BBa_K382034FenceE61282GAATTCGCGGCCGCTTCTAGACAACTATTTTTATGTATGCAAGAGTCAGCATATGTATAATTGATTCAGAATCGTTTTGACGAGTTCGGATGTAGTAGTAGCCATTATTTAATGTACATACTAATCGTGAATAGTGATATGATGAAACATTGTATCTTATTGTATAAATATCCATAAACACATCATGAAAGACACTTTCTTTCACGGTCTGAATTAATTATGATACAATTCTAATAGAAAACGAATTAAATTACGTTGAATTGTATGAAATCTAATTGAACAAGCCAACCACGACGACGACTAACGTTGCCTGGATTGACTCGGTTTAAGTTAACCACTAAAAAAACGGAGCTGTCATGTAACACGCGGATCGAGCAGGTCACAGTCATGAAGCCATCAAAGCAAAAGAACTAATCCAAGGGCTGAGATGATTAATTAGTTTAAAAATTAGTTAACACGAGGGAAAAGGCTGTCTGACAGCCAGGTCACGTTATCTTTACCTGTGGTCGAAATGATTCGTGTCTGTCGATTTTAATTATTTTTTTGAAAGGCCGAAAATAAAGTTGTAAGAGATAAACCCGCCTATATAAAGTGGAATTGTGAGCGGATAACAATTAATTGTCTCGTTGTCCTCCTCACTTTCATCAGCCGTTTTGAATCTCCGGCGACTTGACAGAGAAGAACAAGGAAGGTGGAATTGTGAGCGGATAACAATTAAGACTAAGAGAGAAAGTAAGAGATAATCCAGGAGATTCATTCTCCGTTTTGAATCTTCCTCAATCTCATCTTCTTCCGCTCTTTCTTTCCAAGGTAATAGGAACTTTCTGGATCTACTTTATTTGCTGGATCTCGATCTTGTTTTCTCAATTTCCTTGAGATCTGGTATTCGTTTAATTTGGATCTGTGAACCTCCACTAAATCTTTTGGTTTTACTAGAATCGATCTAAGTTGACCGATCAGTTAGCTCGATTATAGCTACCAGAATTTGGCTTGACCTTGATGGAGAGATCCATGTTCATGTTACCTGGGAAATGATTTGTATATGTGAATTGAAATCTGAACTGTTGAAGTTAGATTGAATCTGAACACTGTCAATGTTAGATTGAATCTGAACACTGTTTAAGTTAGATGAAGTTTGTGTATAGATTCTTCGAAACTTTAGGATTTGTAGTGTCGTACGTTGAACAGAAAGCTATTTCTGATTCAATCAGGGTTTATTTGACTGTATTGAACTCTTTTTGTGTGTTTGCAGCTCATAAAAAACTAGTAGCGGCCGCTGCAGAct2pLacO (Actin promoter with LacO sites)
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
Loading...
 
 
 
Parts
Team Allergy Plasmids
Team Allergy
Team Color Plasmids
Team Color Primers
Team Vector Plasmids
Team Vector Primers
Team Flavor
Team Fence