Synthesized Labs
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGH
1
link nid title created date name cloud_roundbody
2
Classic Eterna
3376059
Classic Eterna
1380239352
9/26/2013 jeehyung 0
3
FMN aptamers
3376076
FMN aptamers
1380239352
9/26/2013 jeehyung 0
4
First Player Project
3376077
First Player Project
1380239352
9/26/2013 jeehyung 0
5
Example project..
3376152
Example project..
1380239355
9/26/2013 jeehyung 9
Propose your own RNA research project here : ] Most voted projects go "active" and receive synthesis slots!
6
Find Z - Here It Is!
3376156
Find Z - Here It Is!
1380239355
9/26/2013
SpaceFolder
0
My research goal is to become the RICHEST EteRNA player ever by designing space-age molecules that attract $$$BILLIONS$$$ in federal government grants.
7
Triloop with multiloop core phase 1
3376161
Triloop with multiloop core phase 1
1380239355
9/26/2013 Eli Fisker 9
Joint project between JandersonLee and I. This is the first phase of two. In the first phase we will focus on designing a 0-0-0-0 multiloop that will be extremely stable. In the second phase, we will pick one of the most stable designs and freeze the central core. As JL said: Immortalize your core! Then we will let players focus on designing the 7 base element triloops: 3 unpaired bases plus closing and backing pairs.
8
Two Bulge "Zigzag" - Both Conformations
3376162
Two Bulge "Zigzag" - Both Conformations
1380239355
9/26/2013 Brourd 0
The "zigzag" is a secondary structure motif, with two 1 nucleotide opposing bulges adjacent to each other. The player Quasispecies dedicated two separate labs to both of these zigzags during the original run of the player projects. One structure did quite well in the end, with chemical detection of the lonely base pair. However, the other structure failed, with little chemical detection of that lonely base pair using the known stable solutions. The goal of this project has two parts. Part one is this lab, to see if players can stabilize both zigzags using whatever solutions they please. Part 2, which will be run concurrently, will consist of 4 labs, each with a specific locked sequence in the zigzag, in order to determine if certain mismatches prove to be more stabilizing/destabilizing compared to others. This lab will take a full 40 slots for synthesis, and the other 4 labs will each take 12 slots for synthesis. I hope to see interesting sequences for this lab, and remember to try and vary your solutions for each submission! Good Luck!
9
Two Bulge "Zigzag" - Variation 2
3376164
Two Bulge "Zigzag" - Variation 2
1380239355
9/26/2013 Brourd 0
This is the first lab for part 2 of the Two Bulge "Zigzag". The locked sequence in the zigzags is a cytosine on one side, and an adenine on the other side. Based on the small graphic you see as a preview, the locked cytosine residues would be on the top half of the zigzags, and the adenine residues would be on the bottom half of the zigzags. 12 designs will be chosen for synthesis, and I hope to see interesting results from this lab!
10
FMN Binding Site Chemical Footprint - Round 2
3376174
FMN Binding Site Chemical Footprint - Round 2
1380239355
9/26/2013 Brourd 15
For round 2 of the FMN Binding Site Chemical Footprint project, the goal is to observe the SHAPE signal for the ligand binding site when rotated, with the loop sequence being AGAAGG/AGGAUAU. 30 Slots are requested for synthesis.
11
Modeled Impossible: 1 Nucleotide Bulge/Triloop Lonely base pair V2
3376176
Modeled Impossible: 1 Nucleotide Bulge/Triloop Lonely base pair V2
1380239355
9/26/2013 Brourd 0
In this lab, the goal is to stabilize the impossible secondary structure motif, of a bulge adjacent a triloop. Both triloop/bulge combos are present here, and 30 designs will be chosen for synthesis. This second part of the project specifically locks cytosine residues in the bulges of the structure, to determine if that contributes to stability of the bulge/triloop combination. I hope to see interesting designs from players!
12
TinkerToy Retread
3376178
TinkerToy Retread
1380239355
9/26/2013 jandersonlee 0
In the Triloop Buffet lab, the TinkerToy 15A submission took naturally occurring RNA snippets and tried to form a set of three triloop hairpins off of a 4-way multi-loop. The multiloop stuck, but the three hairpins did not all form. Can you do better for the three triloops off the same core structure?
13
Frog leg - relaxed
3376179
Frog leg - relaxed
1380239355
9/26/2013 Eli Fisker 0
Twin puzzle experiment - part 1 I wish to test how adjacent stacks in a multiloop affect the hardness of a lab design. I think designs with adjacent stacks in multiloops are harder to solve than designs with multiloops without adjacent stacks. I have made two twin lab designs. The only difference between them, are how the stems are spaced in the multiloop. Welcome to join.
14
Frog leg - Stretched toe
3376181
Frog leg - Stretched toe
1380239355
9/26/2013 Eli Fisker 0
Twin experiment - part 3 The twin experiment ended up with a triple. I wish to test how adjacent stacks in a multiloop affect the hardness of a lab design. I think designs with adjacent stacks in multiloops are harder to solve than designs with multiloops without adjacent stacks. This experiment is a variation over Frog leg - Electric. I think designs with multiloops with 3 adjacent stacks are harder to solve multiloops with 2 adjacent stacks. Welcome to join. Frog gymnastics
15
Motor Protein - Step 2
3376186
Motor Protein - Step 2
1380239355
9/26/2013 Eli Fisker 9
The idea for these experiments was born from the collaboration between Mat, JandersonLee and I on making a multiloop strategy for JLâ–’s bot JandersonLee coined the term Non hairpin stem.(Marked in the picture). <img src="http://i.imgur.com/TbvN897.png"/ style="max-width:500px; width:auto; height:auto"> I think a multiloop will be harder to solve if an adjacent stem is directly attached to either 1 or in particular both sides non hairpin Stem. I think a multiloop is easier to solve if no adjacent stems are directly attatched to the non hairpin stem, but there is loose bases in between. I think it matters a great deal where the adjacent stems is attached in a multiloop. The proposed experiments are an attempt to test that. The series is named in tribute to our cells little worker guy, the motor protein that takes care of transporting nutrition and all sorts of things around in our cells. <a href="http://www.youtube.com/watch?v=y-uuk4Pr2i8">Kinesin Protein walking on microtubule</a>
16
Motor Protein - Step 3
3376187
Motor Protein - Step 3
1380239355
9/26/2013 Eli Fisker 9
<br/>The idea for these experiments was born from the collaboration between Mat, JandersonLee and I on making a multiloop strategy for JLâ–’s bot<br/><br/>JandersonLee coined the term Non hairpin stem.(Marked in the picture).<br/><img src="http://i.imgur.com/TbvN897.png"/ style="max-width:500px; width:auto; height:auto"><br/><br/>I think a multiloop will be harder to solve if an adjacent stem is directly attached to either 1 or in particular both sides non hairpin Stem. I think a multiloop is easier to solve if no adjacent stems are directly attatched to the non hairpin stem, but there is loose bases in between. I think it matters a great deal where the adjacent stems is attached in a multiloop. The proposed experiments are an attempt to test that. <br/> <br/>The series is named in tribute to our cells little worker guy, the motor protein that takes care of transporting nutrition and all sorts of things around in our cells. <br/><br/><a href="http://www.youtube.com/watch?v=4TGDPotbJV4">Kinesin Transport Protein</a>
17
Intersecting stacks investigation
3376188
Intersecting stacks investigation
1380239355
9/26/2013 JR 0
This lab investigates the stability of 4 intersecting stacks. Vote to find out if we can find stabilizing sequences for the structure.
18
Intersecting stacks 2
3376189
Intersecting stacks 2
1380239355
9/26/2013 JR 0
This lab investigates the intersection of 4 stacks. Can we find strong stable sequences for this configuration. 30 slots are available.
19
Is RNA directional 1 of 2
3376190
Is RNA directional 1 of 2
1380239355
9/26/2013 JR 0
Is a bulge just a bulge or do bulges have an energy preference with stronger energy on one side or the other. Bases are locked on different sides of the bulge in parts 1 and 2. Will we get better overall scores from one side when compared to the other when scores from the 2 labs are compared?
20
Is RNA directional 2 of 2
3376191
Is RNA directional 2 of 2
1380239355
9/26/2013 JR 0
Is a bulge just a bulge or do bulges have an energy preference with stronger energy on one side or the other. Bases are locked on different sides of the bulge in parts 1 and 2. Will we get better overall scores from one side when compared to the other when scores from the 2 labs are compared?
21
Semicircle - 3 bends
3376195
Semicircle - 3 bends
1380239356
9/26/2013 Jieux 0
i love semicircles and want to see how they synthesize... long stacks should isolate that form.
22
Semicircle - 4 bends
3376196
Semicircle - 4 bends
1380239356
9/26/2013 Jieux 0
i love semicircles and want to see how they synthesize... long stacks should isolate that form. .(((((((((((.(.(.(.((((((((((((....))))))))))))))))))))))))))..
23
Semicircle - 5 bends
3376197
Semicircle - 5 bends
1380239356
9/26/2013 Jieux 9
i love semicircles and want to see how they synthesize... long stacks should isolate that form.
24
Location Dependent Chemical Footprints Part 1
3376198
Location Dependent Chemical Footprints Part 1
1380239356
9/26/2013 Brourd 0
This project is meant to investigate a theory, that the location of a loop will have an effect on the resulting chemical footprint. In this example, we have a 2-2 stem loop located in the first stack of the design's multibranch loop, and a 2-2 stem loop located in the second stack of the multibranch loop. Each 2-2 loop has an identical locked CAAG/CAAG sequence, and I hope to see interesting results from this experiment!
25
Location Dependent Chemical Footprints Part 2
3376199
Location Dependent Chemical Footprints Part 2
1380239356
9/26/2013 Brourd 0
This project is meant to investigate a theory, that the location of a loop will have an effect on the resulting chemical footprint. In this project, we have a 2-2 stem loop located in the first stack of the design's multibranch loop, and a 2-2 stem loop located in the third stack of the multibranch loop. Each 2-2 loop has an identical locked CAAG/CAAG sequence, and I hope to see interesting results from this experiment!
26
Location Dependent Chemical Footprints Part 3
3376200
Location Dependent Chemical Footprints Part 3
1380239356
9/26/2013 Brourd 0
This project is meant to investigate a theory, that the location of a loop will have an effect on the resulting chemical footprint. In this project, we have a 2-2 stem loop located in the second stack of the design's multibranch loop, and a 2-2 stem loop located in the third stack of the multibranch loop. Each 2-2 loop has an identical locked CAAG/CAAG sequence, and I hope to see interesting results from this experiment!
27
Location Dependent Chemical Footprints Part 4
3376201
Location Dependent Chemical Footprints Part 4
1380239356
9/26/2013 Brourd 0
This project is meant to investigate a theory, that the location of a loop will have an effect on the resulting chemical footprint. In this project, we have a single 2-2 stem loop located in the first stack of the design's multibranch loop. The 2-2 loop has a locked CAAG/CAAG sequence, and I hope to see interesting results from this experiment!
28
Location Dependent Chemical Footprints Part 5
3376202
Location Dependent Chemical Footprints Part 5
1380239356
9/26/2013 Brourd 0
This project is meant to investigate a theory, that the location of a loop will have an effect on the resulting chemical footprint. In this project, we have a single 2-2 stem loop located in the second stack of the design's multibranch loop. The 2-2 loop has a locked CAAG/CAAG sequence, and I hope to see interesting results from this experiment!
29
Location Dependent Chemical Footprints Part 6
3376203
Location Dependent Chemical Footprints Part 6
1380239356
9/26/2013 Brourd 0
This project is meant to investigate a theory, that the location of a loop will have an effect on the resulting chemical footprint. In this project, we have a single 2-2 stem loop located in the third stack of the design's multibranch loop. The 2-2 loop has a locked CAAG/CAAG sequence, and I hope to see interesting results from this experiment!
30
G-U GAGA Tetraloop Boost
3376212
G-U GAGA Tetraloop Boost
1380239356
9/26/2013 RedSpah 9 Test how G-U boosted Tetraloops will behave in different places.
31
Could Curves Survive?
3376213
Could Curves Survive?
1380239356
9/26/2013 RedSpah 0
Test to check if "wawan" Curves could really survive when synthesized.
32
Adding some sweet tetraloops
3376214
Adding some sweet tetraloops
1380239356
9/26/2013 jandersonlee 0
This lab borrows the multiloop core design from Brourd's "Adding some sweet G-C ..." and invites you to add your own design for three tetraloops, the neck closure, and barcode. It gives us a common platform to compare tetraloops. Each of the fixed portions of the three core arms ends in a different pair (counting orientations), so you can compare the same tetraloop in different contexts, or try to find the "best" tetraloop for each different context. I'm hoping that given a solid core to start with we can get a significant number of 94+ scores and perhaps even a few 100s. Since there were over 100 sumbmissions for the previous round of this design, I've asked for 80 slots so that most players can get at least one design synthesized. Good luck!
33
Teeny tRNA
3376215
Teeny tRNA
1380239356
9/26/2013
macclark52
0
This is a trailer for a lab puzzle I'd like to propose later if the number of permissible bases is increased a bit. Natural tRNAs have around 75 or more nucleotides. Judging from the tRNAs of several different species, the secondary structure is quite conserved, with variable base numbers mostly in the D loop (minimum of 7) and the variable region (minimum of 4). Is it possible to make a teeny tRNA (ttRNA) with only 63 nucleotides? In creating this ttRNA puzzle, I have removed one base pair from each of the four stem regions, and two each from the D loop and the variable region. Selected bases from the original natural sequence have been locked. I suspect that so much mutation would break it as a tRNA, but will it even make a stable real-life fold? There are 15 GC pairs in the E coli Arg-tRNA from which this structure was derived, so live it up! Image from Wikimedia
34
Repetitious sequences
3376216
Repetitious sequences
1380239356
9/26/2013 paramodic 9
I'm curious how well highly repetitious folds will form in wetlab. Feel free to experiment, and I'm really excited to see the most repetetive sequences my fellow players can come up with.
35
Palindromes part one
3376217
Palindromes part one
1380239356
9/26/2013 paramodic 0
Palindromes are words that can't be read correctly from left to right or right to left, such as "mom". Palindromes also occur naturally in RNA sequences so that it would be correct to read the sequence from 3' to 5' or from 5' to 3'. One simple example might be "AUGUCCUGUA", or "CUCGUAAUGCUC". One natural example occurs in the influenza genome, and is believed to contribute to the virus' pathogenesis. Since RNA palindromes often form simple hairpin structures (and I anticipate that this might be difficult), we're keeping this simple for the first round. Your mission, should you choose to accept it, is to make a palindrome on this secondary structure. Please note that this is not an inverted palindrome, where the bases on the 5' side are reflected and then mutated to the opposing base (eg, "AUGUC/GACAU")
36
Dimer B
3376219
Dimer B
1380239356
9/26/2013
ElNando888
0
This time, I would like to venture into another (for us) unexplored domain: RNA dimers. This lab experiment and its complementary one are designed to interact with each other. The question whether the sequences submitted for both labs will dimerize with each other in the test tube is mostly a question of concentration. Unfortunately, I have no idea what these concentrations will be, so I decided to make this simple test: should the majority of your designs show up with bases 7 to 18 rather protected, then we will know that the experimental conditions in the Cloud Lab are good enough to attempt experiments about RNA-RNA interactions. If not, well, we'll have to think of something else :) This part of the experiment is out of our hands. It will work or not and there's nothing we can do about it. The second challenge in those two labs, which will be the only difficulty if these labs are not run together, will be to see how difficult it is to come up with a good design while avoiding misfolds with the locked bases. Cleaning up the dotplot may prove more difficult than usual... If you decide to vote for this project, please vote for both, as the whole idea would lose a lot of its meaning if run separately. Have fun :)
37
Dimer A
3376220
Dimer A
1380239356
9/26/2013
ElNando888
12
Round 2 is a control run. The idea is to assert if the signal around 7-18 was really caused by dimerization with the Dimer B complementary sequence, or if it was something else.<br/><br/><hr/><br/><br/><br/>This time, I would like to venture into another (for us) unexplored domain: RNA dimers.<br/><br/>This lab experiment and its complementary one are designed to interact with each other. The question whether the sequences submitted for both labs will dimerize with each other in the test tube is mostly a question of concentration. Unfortunately, I have no idea what these concentrations will be, so I decided to make this simple test: should the majority of your designs show up with bases 7 to 18 rather protected, then we will know that the experimental conditions in the Cloud Lab are good enough to attempt experiments about RNA-RNA interactions. If not, well, we'll have to think of something else :)<br/><br/>This part of the experiment is out of our hands. It will work or not and there's nothing we can do about it. The second challenge in those two labs, which will be the only difficulty if these labs are not run together, will be to see how difficult it is to come up with a good design while avoiding misfolds with the locked bases. Cleaning up the dotplot may prove more difficult than usual...<br/><br/>If you decide to vote for this project, please vote for both, as the whole idea would lose a lot of its meaning if run separately. <br/><br/>Have fun :)<br/><br/><br/><img style="width: 410px" src="http://eternawiki.org/wiki/images/Dimer.png" />
38
Improving the Nearest Neighbor Energy Model Using Eterna
3376221
Improving the Nearest Neighbor Energy Model Using Eterna
1380239356
9/26/2013 mseetin 13
The nearest neighbor model includes many approximations, notably that many sequence-specific effects have been averaged due to lack of resources when the original measurements were made. Using high-throughput sequencing and EteRNA, we can more exhaustively probe the sequence space of various RNA structural motifs. By carefully designing structures that compete between two different versions of related motifs with different sequences, we can identify the thermodynamically favored and disfavored sequences of each motif.The nearest neighbor model includes many approximations, notably that many sequence-specific effects have been averaged due to lack of resources when the original measurements were made. Using high-throughput sequencing and Eterna, we can more exhaustively probe the sequence space of various RNA structural motifs and identify favorable and unfavorable sequences for our favorite structural motifs that aren't captured in the current energy model. <br/><br/>The way we can do this is to carefully design RNAs that can adopt two different, competing structures, and the two structures differ ONLY in the sequence of the motif in question. We also have to avoid any other alternative structures that might form. This sounds tricky, but I've developed a design approach that can be used. The aim is to make RNAs that have three identical stretches of 6 self-complementary nucleotides separated by two loops interest. Because there are three stretches of nucleotides that are self-complementary, the middle stretch can pair with either the first stretch or the third but not both at the same time. These two states are identical in every way, except for the hairpin loops that form in the two states. Thus, we can read out which hairpin loop nature prefers by seeing which structure the RNA adopts. If the third stretch of 6 nucleotides is exposed, nature prefers the first tetraloop. If the first stretch of six nucleotides is exposed, nature prefers the second tetraloop. If both are exposed, both loops are roughly equal. <br/><br/>One last tip. We know that the last two mismatched bases at the end of a helix can contribute to the helix's stability as well. In addition to three identical, self-complementary 6 nucleotides stretches, we also want the nucleotide before the first stretch to be the same as the 4th nucleotide of the first loop, and the nucleotide after the 3rd stretch to be equal to the first nucleotide of the second loop.<br/><br/>Here's an example from my pilot of this experiment within Eterna. I've removed the leading GGAAA necessary for transcription as well as the barcode hairpin and tail region for clarity. On top is my sequence, and below is the annotation<br/><br/>AGCAUGCGAAAGCAUGCGCCAGCAUGCG<br/>SHHHHHHNNNNHHHHHHNNNNHHHHHHS<br/><br/>The nucleotides above each HHHHHH are the three identical, self-complementary 6 nucleotide stretches I was talking about. These are all the same, and they can pair with one another. The nucleotides labeled NNNN are the two loops I was comparing, in this case GAAA and GCCA. The nucleotides labeled S are the ones that don't form base pairs but stack on the ends of the helices. The first S is an A, because that's the 4th member of the GAAA loop. The second S is a G, because that's the first member of the GCCA loop. With this design, I found that nature prefers the GAAA loop instead of GCCA, even though our energy model treats these the same.<br/><br/>The challenge comes in because not all self-complementary HHHHHH sequences will work with all loops, and not all loops can be compared with one another in this manner (trying to compare GGGG loops with CCCC loops might cause problems!), but with the power of the Eterna community, we can design enough sequences that we'll be able to identify sequences that help or hurt our designs more than was previously known, and we can put this information to use in our other labs. The scoring is currently set so that full points will be awarded if the first loop is chosen, so put the loop you think will be more stable in the first NNNN slot, and the loop you think would be less stable in the second NNNN slot, and try to make a different comparison compared to other players, even if only one loop differs by just one nucleotide. That might be the key! In the future, we might be able to have a more flexible score that would award full points if the RNA adopts either competing structure, but we'll work with this right now.
39
P5abc Mutants to Affect Folding Transitions
3376224
P5abc Mutants to Affect Folding Transitions
1380239357
9/26/2013 brant.gracia 0
P5abc is a sub-domain of the P4-P6 catalytic domain of the Tetrahymena ribozyme. During Mg2+-induced folding, P5abc undergoes a significant shift in secondary structure involving the rearrangement of about 10 base pairs. For the wild-type ribozyme, the incorrect extended conformation is populated in the absence of Mg2+ at low monovalent ion concentrations, but Mg2+ addition promotes internal folding within P5abc that shifts the equilibrium to the native secondary structure. For certain mutants that further stabilize the incorrect structure, Mg2+ addition is insufficient to promote the secondary structure transition in the isolated P5abc, but Mg2+-induced tertiary contacts between P5abc and the rest of the P4-P6 domain are sufficient to shit the equilibrium to the native secondary structure. By constructing P5abc mutants that are predicted to change the free energy difference between the two secondary structures of P5abc, we will test whether the kinetics and thermodynamics of ribozyme folding can be predicted from the separable parameters for the secondary structure rearrangement within P5abc and the values for the remainder of folding between the ribozyme core and the native P5abc.
40
Robot serial killer 1 - Lab killer too?
3376225
Robot serial killer 1 - Lab killer too?
1380239357
9/26/2013 Eli Fisker 9
This new series is related with the earlier Motor protein, Chicken legs and frog legs labs. The focus is still adjacent stems in multiloops. I want to explore how the number of adjacent stems from multiloops attached to non-hairpin stems affects how solvable the lab is. <br/><br/>I think it matters, how adjacent multiloops are attached. I think a lab gets harder to solve if a non-hairpin stem coming of from a multi loop, has one or worse, two adjacent neighbour stems in the multiloop. I think it gets even harder, if the non-hairpin stem is between two multiloops, which have adjacent stems to either 1 or, even worse, both sides. I also think the shorter the non-hairpin, the worse. With this series I aim to test out some of the worst case scenarios. <br/><br/>This lab puzzle is a descendant of puzzle Flower Power, which Janderson picked as a benchmark test for his puzzle solving robot, since it is a real serial bot killer.<br/><br/> <br/><br/> <a href="https://d2r1vs3d9006ap.cloudfront.net/s3_images/932180/flowerpower1.png?1374866463"><img src="https://d2r1vs3d9006ap.cloudfront.net/s3_images/932180/flowerpower1_inline.png?1374866463" alt="" /></a><br/><br/><br/><br/> Read more about the experiments background <a href="https://docs.google.com/document/d/1xcGO-tHMe5tTl6ZZbN2PNJTd_D2LKVCnSNJ6vKpB5bg/edit">here</a>.<br/><br/>Welcome to join the experiment!
41
Robot serial killer 3 - Lab killer too?
3376226
Robot serial killer 3 - Lab killer too?
1380239357
9/26/2013 Eli Fisker 9
This new series is related with the earlier Motor protein, Chicken legs and frog legs labs. The focus is still adjacent stems in multiloops. I want to explore how the number of adjacent stems from multiloops attached to non-hairpin stems affects how solvable the lab is. <br/><br/>I think it matters, how adjacent multiloops are attached. I think a lab gets harder to solve if a non-hairpin stem coming of from a multi loop, has one or worse, two adjacent neighbour stems in the multiloop. I think it gets even harder, if the non-hairpin stem is between two multiloops, which have adjacent stems to either 1 or, even worse, both sides. I also think the shorter the non-hairpin, the worse. With this series I aim to test out some of the worst case scenarios. <br/><br/>This lab puzzle is a descendant of puzzle Flower Power, which Janderson picked as a benchmark test for his puzzle solving robot, since it is a real serial bot killer.<br/><br/> <br/><br/> <a href="https://d2r1vs3d9006ap.cloudfront.net/s3_images/932180/flowerpower1.png?1374866463"><img src="https://d2r1vs3d9006ap.cloudfront.net/s3_images/932180/flowerpower1_inline.png?1374866463" alt="" /></a><br/><br/><br/><br/> Read more about the experiments background <a href="https://docs.google.com/document/d/1xcGO-tHMe5tTl6ZZbN2PNJTd_D2LKVCnSNJ6vKpB5bg/edit">here</a>.<br/><br/>Welcome to join the experiment!
42
Robot serial killer 2 - Lab killer too?
3376227
Robot serial killer 2 - Lab killer too?
1380239357
9/26/2013 Eli Fisker 9
This new series is related with the earlier Motor protein, Chicken legs and frog legs labs. The focus is still adjacent stems in multiloops. I want to explore how the number of adjacent stems from multiloops attached to non-hairpin stems affects how solvable the lab is. <br/><br/>I think it matters, how adjacent multiloops are attached. I think a lab gets harder to solve if a non-hairpin stem coming of from a multi loop, has one or worse, two adjacent neighbour stems in the multiloop. I think it gets even harder, if the non-hairpin stem is between two multiloops, which have adjacent stems to either 1 or, even worse, both sides. I also think the shorter the non-hairpin, the worse. With this series I aim to test out some of the worst case scenarios. <br/><br/>This lab puzzle is a descendant of puzzle Flower Power, which Janderson picked as a benchmark test for his puzzle solving robot, since it is a real serial bot killer.<br/><br/> <br/><br/> <a href="https://d2r1vs3d9006ap.cloudfront.net/s3_images/932180/flowerpower1.png?1374866463"><img src="https://d2r1vs3d9006ap.cloudfront.net/s3_images/932180/flowerpower1_inline.png?1374866463" alt="" /></a><br/><br/><br/><br/> Read more about the experiments background <a href="https://docs.google.com/document/d/1xcGO-tHMe5tTl6ZZbN2PNJTd_D2LKVCnSNJ6vKpB5bg/edit">here</a>.<br/><br/>Welcome to join the experiment!
43
Short Stacks 3
3376228
Short Stacks 3
1380239357
9/26/2013 kcabral28 0
This lab is a continuation of my Short Stacks lab project series. In this project I would like to experiment with the breakup of consecutive Adenines in large loops. Some of the data from my first lab seemed to indicate that this could help stabilize them if the Adenines were broken up about midway through the loop. <br/><br/>What I am looking for from players:<br/><br/>-I would like solutions that place either Guanines, Uracils or Cytosines in positions 1, 2 and 3 of the hairpin loops. If you decide to use Guanine for instance, place guanine in position 1 for all three loops. For your second solution place Guanine in position 2 for all three loops and so on.. <br/>-You can choose whatever sequence you like for the main body of the puzzle, but I would like it to be identical across all three design slots. <br/>-You can boost with a traditional guanine if you wish. I would like some of the solutions to be boost free; although the designs may be unstable in EteRNA's energy model.<br/>-I also require a few control solutions. Solutions where the loops contain only Adenines. I will try to provide a few unboosted control solutions myself. I also require a few boosted control solutions.<br/>-I will like to have at least a couple of solutions that place a particular nucleotide in a certain position. For example, two unique solutions that place a Uracil in position 1, ideally from different players.<br/>-Please consider these points when voting!<br/><br/>I know I am being very particular about what I am looking for from players, but it is the best way to eliminate any unwanted variables. In total this brings me to about 48 synthesis slots. I look forward to getting some interesting data! Thanks a lot everyone! <br/><br/>Below is an example of a boosted control solution with loop positions 1, 2 and 3 labelled. <br/><img src="http://imageshack.us/a/img35/1006/rzcw.png"><br/>
44
Ziggy 25 (aka Multiloop Test)
3376229
Ziggy 25 (aka Multiloop Test)
1380239357
9/26/2013 ribonucleic 13
This project tests how well zigzags and multiloops will hold in the lab. Is there a way to stabilize the zizag without destabilizing the multiloop combo? This labshould be done with at least 6 AUs as to prevent an overuse of GC pairs. Enjoy!
45
Small Loops- v. 1
3376230
Small Loops- v. 1
1380239357
9/26/2013 ribonucleic 12
Hoping to see some interesting designs to solve this lab. This is the first in a 4 part series to test how well small loop structures fold in real life, and if they do a significant job in nature. Enjoy the lab! :)
46
FMN Shape Test- 1st State
3376231
FMN Shape Test- 1st State
1380239357
9/26/2013 ribonucleic 9
This is the first state of one of my Cloudbeta switches. I am hoping to see some interesting designs with the locked bases which will become the FMN in the second state. The switch is not supposed to be easy, so if you do the lab, please try the real switch. Enjoy the lab!<br/><br/>Hopefully both states get picked so we can compare and analyze the results. Here is my original solve of the switch: http://eterna.cmu.edu/sites/default/files/chat_screens/40562_1375114809.png
47
FMN Shape Test- 2nd State
3376232
FMN Shape Test- 2nd State
1380239357
9/26/2013 ribonucleic 9
This is the second state of one of my Cloudbeta switches. I am hoping to see some interesting designs with the locked bases which is the FMN in this second state. The switch is not supposed to be easy, so if you do the lab, please try the real switch. Enjoy the lab!<br/><br/>Hopefully both states get picked so we can compare and analyze the results. Here is my original solve to the switch: http://eterna.cmu.edu/sites/default/files/chat_screens/40562_1375114809.png
48
Test of locking loop bases in a ribozyme-like structure
3376233
Test of locking loop bases in a ribozyme-like structure
1380239357
9/26/2013 ribonucleic 10
In this lab, all unpaired bases are locked, with A, U, or G, in order to keep the bases in a more natural sequence. The lab's objective is to solve this lab, while preventing any mispairs between the paired and the unpaired bases. Also, the lab is to be done with less than 40% GC (should be a max of 4 or 5). Enjoy! :)
49
Relaxed multiloop 1
3376234
Relaxed multiloop 1
1380239357
9/26/2013 Eli Fisker 10
I have an idea that bigger multiloops are more relaxed than smaller ones (hardcore adjacent ones excepted). I think that the numbers of single basepair between stems matters for how easy it is to solve a lab. I think it may also affect what closing basepair solve a multiloop will accepts. (if there is backing GC-pairs closeby helping to force the structure happen) I think orientation of GC-pairs won't matter as much in bigger multiloops as it does in the smaller ones. (I do remember exceptions in the small 1-1-1 branches multiloops). So what I will like to test this out with this lab, is if it easier to make winners in a lab with a multiloop with longer betewen it's stems? And can orientation of GC-pairs be reversed without as much penalty as in smaller multiloops? I made the stems in the design uneven, in an attempt to avoid misfolding, due to too similar sequence and length. Want to read more about the thoughts behind the experiment, check <a href="https://docs.google.com/document/d/1agplrs-h7WuKiIQ5Bcs_fQHwGDiClQ3num7H7kw8-GM/edit#bookmark=kix.woubp7lpwu9">here</a>.
50
Relaxed multiloop 2
3376235
Relaxed multiloop 2
1380239357
9/26/2013 Eli Fisker 9
I have an idea that bigger multiloops are more relaxed than smaller ones (hardcore adjacent ones excepted). I think that the numbers of single basepair between stems matters for how easy it is to solve a lab. I think it may also affect what closing basepair solve a multiloop will accepts. (if there is backing GC-pairs closeby helping to force the structure happen) I think orientation of GC-pairs won't matter as much in bigger multiloops as it does in the smaller ones. (I do remember exceptions in the small 1-1-1 branches multiloops). So what I will like to test this out with this lab, is if it easier to make winners in a lab with a multiloop with longer betewen it's stems? And can orientation of GC-pairs be reversed without as much penalty as in smaller multiloops? I made the stems in the design uneven, in an attempt to avoid misfolding, due to too similar sequence and length. Want to read more about the thoughts behind the experiment, check <a href="https://docs.google.com/document/d/1agplrs-h7WuKiIQ5Bcs_fQHwGDiClQ3num7H7kw8-GM/edit#bookmark=kix.woubp7lpwu9">here</a>.
51
Wobble Quad Stability 1
3376236
Wobble Quad Stability 1
1380239357
9/26/2013 Brourd 9
For this project, an investigation into the stability of the various G-U/G-U wobble base pair quads is being made. In this instance, we have a four base pair helix, connecting two multibranch loops. The two central base pairs of this four base pair stem, are a locked UG/UG tandem mismatch, or a 0.3 kcal quad. This will be ran alongside 7 other projects, with 4 projects using G-U base pairs, and 4 projects using A-U base pairs as a control. 30 slots are requested for synthesis.
52
New Frontier 2
3376237
New Frontier 2
1380239357
9/26/2013
ElNando888
0
The next "level" in the pseudoknot series: kissing interactions are stems nested in loops. The most basic ones involve hairpin loops said to be "kissing" each other. In this lab, we will attempt to create a pseudoknot where a hairpin loop interacts with an internal loop.
53
Wobble Quad Stability 2
3376238
Wobble Quad Stability 2
1380239357
9/26/2013 Brourd 14
For this project, an investigation into the stability of the various G-U/G-U wobble base pair quads is being made. In this instance, we have a four base pair helix, connecting two multibranch loops. The two central base pairs of this four base pair stem, are a locked GU/GU tandem mismatch, or a 1.3 kcal quad. This will be ran alongside 7 other projects, with 4 projects using G-U base pairs, and 4 projects using A-U base pairs as a control. 30 slots are requested for synthesis.
54
Wobble Quad Stability 3
3376239
Wobble Quad Stability 3
1380239357
9/26/2013 Brourd 14
For this project, an investigation into the stability of the various G-U/G-U wobble base pair quads is being made. In this instance, we have a four base pair helix, connecting two multibranch loops. The two central base pairs of this four base pair stem, are a locked GG/UU mismatch, or a -0.5 kcal quad. This will be ran alongside 7 other projects, with 4 projects using G-U base pairs, and 4 projects using A-U base pairs as a control. 30 slots are requested for synthesis.
55
Wobble Quad Stability 4
3376240
Wobble Quad Stability 4
1380239357
9/26/2013 Brourd 14
For this project, an investigation into the stability of the various G-U/G-U wobble base pair quads is being made. In this instance, we have a four base pair helix, connecting two multibranch loops. The two central base pairs of this four base pair stem, are a locked UU/GG mismatch, or a -0.5 kcal quad. This will be ran alongside 7 other projects, with 4 projects using G-U base pairs, and 4 projects using A-U base pairs as a control. 30 slots are requested for synthesis.
56
Wobble Quad Control 1
3376241
Wobble Quad Control 1
1380239357
9/26/2013 Brourd 14
For this project, an investigation into the stability of the various G-U/G-U wobble base pair quads is being made. In this instance, we have a four base pair helix, connecting two multibranch loops. The two central base pairs of this four base pair stem, are a control for the first lab, with two locked A-U pairs, or a -1.3 kcal quad. This will be ran alongside 7 other projects, with 4 projects using G-U base pairs, and 4 projects using A-U base pairs as a control. 30 slots are requested for synthesis.
57
Wobble Quad Control 2
3376242
Wobble Quad Control 2
1380239358
9/26/2013 Brourd 11
For this project, an investigation into the stability of the various G-U/G-U wobble base pair quads is being made. In this instance, we have a four base pair helix, connecting two multibranch loops. The two central base pairs of this four base pair stem, are a control for the second lab, with two locked A-U pairs, or a -1.1 kcal quad. This will be ran alongside 7 other projects, with 4 projects using G-U base pairs, and 4 projects using A-U base pairs as a control. 30 slots are requested for synthesis.
58
Wobble Quad Control 3
3376243
Wobble Quad Control 3
1380239358
9/26/2013 Brourd 11
For this project, an investigation into the stability of the various G-U/G-U wobble base pair quads is being made. In this instance, we have a four base pair helix, connecting two multibranch loops. The two central base pairs of this four base pair stem, are a control for the third lab, with two locked A-U pairs, or a -0.9 kcal quad. This will be ran alongside 7 other projects, with 4 projects using G-U base pairs, and 4 projects using A-U base pairs as a control. 30 slots are requested for synthesis.
59
Wobble Quad Control 4
3376244
Wobble Quad Control 4
1380239358
9/26/2013 Brourd 11
For this project, an investigation into the stability of the various G-U/G-U wobble base pair quads is being made. In this instance, we have a four base pair helix, connecting two multibranch loops. The two central base pairs of this four base pair stem, are a control for the fourth lab, with two locked A-U pairs, or a -0.9 kcal quad. This will be ran alongside 7 other projects, with 4 projects using G-U base pairs, and 4 projects using A-U base pairs as a control. 30 slots are requested for synthesis.
60
Relaxed multiloop 3
3376245
Relaxed multiloop 3
1380239358
9/26/2013 Eli Fisker 10
I have an idea that bigger multiloops are more relaxed than smaller ones (hardcore adjacent ones excepted). I think that the numbers of single basepair between stems matters for how easy it is to solve a lab. I think it may also affect what closing basepair solve a multiloop will accepts. (if there is backing GC-pairs closeby helping to force the structure happen) I think orientation of GC-pairs won't matter as much in bigger multiloops as it does in the smaller ones. (I do remember exceptions in the small 1-1-1 branches multiloops). So what I will like to test this out with this lab, is if it easier to make winners in a lab with a multiloop with longer betewen it's stems? And can orientation of GC-pairs be reversed without as much penalty as in smaller multiloops? I made the stems in the design uneven, in an attempt to avoid misfolding, due to too similar sequence and length. Want to read more about the thoughts behind the experiment, check <a href="https://docs.google.com/document/d/1agplrs-h7WuKiIQ5Bcs_fQHwGDiClQ3num7H7kw8-GM/edit#bookmark=kix.woubp7lpwu9">here</a>.
61
Five Adjacent Stem Multibranch Loop
3376246
Five Adjacent Stem Multibranch Loop
1380239358
9/26/2013 Brourd 0
Now, here is a structure players have not had the chance to play with before. A five stem multibranch loop, with all stacks being adjacent to one another, being classified as 0-0-0-0-0 in terms of the number of unpaired bases. A bulge has been inserted into one stack as a marker to determine that the stem definitely has one unpaired nucleotide compared to the rest of the chemical footprint, which I expect to feature a high amount of protection from the SHAPE probe.
62
SHAPE Profile - U-U Mismatch - Pilot Run
3376247
SHAPE Profile - U-U Mismatch - Pilot Run
1380239358
9/26/2013 Brourd 9
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the U-U mismatch. Since the use of longer RNA molecules is brand new, and the stability of such a long helix is unknown, only 25 slots are requested for synthesis in this pilot run.
63
SHAPE Profile - C-U Mismatch - Pilot Run
3376248
SHAPE Profile - C-U Mismatch - Pilot Run
1380239358
9/26/2013 Brourd 9
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying protected base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the C-U mismatch. Since the use of longer RNA molecules is brand new, and the stability of such a long helix is unknown, only 25 slots are requested for synthesis in this pilot run.
64
SHAPE Profile - U-C Mismatch - Pilot Run
3376249
SHAPE Profile - U-C Mismatch - Pilot Run
1380239358
9/26/2013 Brourd 9
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying protected base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the U-C mismatch. Since the use of longer RNA molecules is brand new, and the stability of such a long helix is unknown, only 25 slots are requested for synthesis in this pilot run.
65
SHAPE Profile - C-A Mismatch - Pilot Run
3376250
SHAPE Profile - C-A Mismatch - Pilot Run
1380239358
9/26/2013 Brourd 9
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying protected base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the C-A mismatch. Since the use of longer RNA molecules is brand new, and the stability of such a long helix is unknown, only 25 slots are requested for synthesis in this pilot run.
66
SHAPE Profile - A-C Mismatch - Pilot Run
3376251
SHAPE Profile - A-C Mismatch - Pilot Run
1380239358
9/26/2013 Brourd 9
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying protected base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the A-C mismatch. Since the use of longer RNA molecules is brand new, and the stability of such a long helix is unknown, only 25 slots are requested for synthesis in this pilot run.
67
SHAPE Profile - G-A Mismatch - Pilot Run
3376252
SHAPE Profile - G-A Mismatch - Pilot Run
1380239358
9/26/2013 Brourd 9
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying protected base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the G-A mismatch. Since the use of longer RNA molecules is brand new, and the stability of such a long helix is unknown, only 25 slots are requested for synthesis in this pilot run.
68
SHAPE Profile - A-G Mismatch - Pilot Run
3376253
SHAPE Profile - A-G Mismatch - Pilot Run
1380239358
9/26/2013 Brourd 9
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying protected base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the A-G mismatch. Since the use of longer RNA molecules is brand new, and the stability of such a long helix is unknown, only 25 slots are requested for synthesis in this pilot run.
69
Unmodified tRNA sequences
3376254
Unmodified tRNA sequences
1380239358
9/26/2013
macclark52
9
I'm interested in why the transcribed sequences of tRNA don't seem to fold (in natural mode) into the familiar "clover-leaf" secondary structure. The failure to fold might be due to the relatively high percentage of modified bases in tRNA. That is, the modifications might be necessary to stabilize the normal tRNA structure. I'd like to propose one or more lab puzzles based on some specific tRNA sequence: one in which selected unmodified bases of the natural tRNA, the anticodon (34-36) and a few other conserved regions are locked (as shown for the human serine tRNA here), and perhaps another in which there are different restrictions. In this puzzle, I have left off the terminal CCA which would be added to the 3' end of the sequence, because in the Teeny tRNA puzzle I posted earlier this sequence interacts strongly with the GG at the beginning of the published puzzle. The structures are stabilizable, at least in silico eterna, by making changes to some of the bases. My question is, can an RNA sequence with no modified bases fold into a functional tRNA? There are two layers to this question, only one of which can probably be addressed here. First, can a synthesized RNA sequence with no modified bases fold like a typical tRNA? The second question would be whether an unmodified RNA sequence could WORK like a real tRNA. The second question seems to go well beyond the bounds of the Eterna project, but would be interesting to think about.
70
Chicken Leg - Reversed
3376255
Chicken Leg - Reversed
1380239358
9/26/2013 Eli Fisker 9
This is a mod of JandersonLee's Chicken Leg and a continuation of the Chicken/Frog leg series. Adjacent stemmed multiloops did turn out to be hard, especially in the Motor protein series. However some of the results from the experiments with non hairpin stems in connection with adjacent multiloops, made me wonder about if it matter what side of the non hairpin stem, the multiloop is adjacently attached. Does it matter what side is adjacent? Does chirality plays a role here?
71
Reversed motor - step 1
3376256
Reversed motor - step 1
1380239358
9/26/2013 Eli Fisker 9
I think the length of the non-hairpin stem matter and that can affect how hard an adjacent multi loop is. Before we couldn't make the shorter designs, so I gave them long stems knowing that I wanted short stems. Now we can decide what length to make our RNA - from 1-89 nucleotides of length. Since I found the some of the results from Janderson and mine Motor protein and Chicken/Frog leg experiments to be different from what I expected, eg. that the labs with non-hairpins 2 times adjacently attached actually looked easier than those with less adjacent attachment, which was the opposite of what I expected. Basically I wish to see if turning the table - making the non hairpin stem short and prolonging the other stems - to take the pressure of them, changes what type of adjacent multi loop that is easier? Iâ–’m intrigued to see if changing the length of the non-hairpin stem, will change the outcome. <br/> <br/> Welcome to join the experiment. <br/>
72
Reversed motor - Step 2
3376257
Reversed motor - Step 2
1380239358
9/26/2013 Eli Fisker 10
I think the length of the non-hairpin stem matter and that can affect how hard an adjacent multi loop is. Before we couldn't make the shorter designs, so I gave them long stems knowing that I wanted short stems. Now we can decide what length to make our RNA - from 1-89 nucleotides of length. Since I found the some of the results from Janderson and mine Motor protein and Chicken/Frog leg experiments to be different from what I expected, eg. that the labs with non-hairpins 2 times adjacently attached actually looked easier than those with less adjacent attachment, which was the opposite of what I expected. Basically I wish to see if turning the table - making the non hairpin stem short and prolonging the other stems - to take the pressure of them, changes what type of adjacent multi loop that is easier? I made them of different length, as to avoid them mispairing too easily. Iâ–’m intrigued to see if changing the length of the non-hairpin stem, will change the outcome. <br/> <br/> Welcome to join the experiment. <br/>
73
Reversed motor - Step 3
3376258
Reversed motor - Step 3
1380239358
9/26/2013 Eli Fisker 10
I think the length of the non-hairpin stem matter and that can affect how hard an adjacent multi loop is. Before we couldn't make the shorter designs, so I gave them long stems knowing that I wanted short stems. Now we can decide what length to make our RNA - from 1-89 nucleotides of length. Since I found the some of the results from Janderson and mine Motor protein and Chicken/Frog leg experiments to be different from what I expected, eg. that the labs with non-hairpins 2 times adjacently attached actually looked easier than those with less adjacent attachment, which was the opposite of what I expected. Basically I wish to see if turning the table - making the non hairpin stem short and prolonging the other stems - to take the pressure of them, changes what type of adjacent multi loop that is easier? I made them of different length, as to avoid them mispairing too easily. Iâ–’m intrigued to see if changing the length of the non-hairpin stem, will change the outcome. <br/> <br/> Welcome to join the experiment. <br/>
74
Reversed motor - Step 4
3376259
Reversed motor - Step 4
1380239358
9/26/2013 Eli Fisker 10
I think the length of the non-hairpin stem matter and that can affect how hard an adjacent multi loop is. Before we couldn't make the shorter designs, so I gave them long stems knowing that I wanted short stems. Now we can decide what length to make our RNA - from 1-89 nucleotides of length. Since I found the some of the results from Janderson and mine Motor protein and Chicken/Frog leg experiments to be different from what I expected, eg. that the labs with non-hairpins 2 times adjacently attached actually looked easier than those with less adjacent attachment, which was the opposite of what I expected. Basically I wish to see if turning the table - making the non hairpin stem short and prolonging the other stems - to take the pressure of them, changes what type of adjacent multi loop that is easier? I made them of different length, as to avoid them mispairing too easily. Iâ–’m intrigued to see if changing the length of the non-hairpin stem, will change the outcome. <br/> <br/> Welcome to join the experiment. <br/>
75
Double 1-3 Loop
3376260
Double 1-3 Loop
1380239358
9/26/2013 RedSpah 9
While sitting at puzzlemaker, I was playing with two adjacent 1-3 Loops, and realized that it's impossible to make them stable if there's only a A-U or G-U in between. So here it is, Lab which will test and answer an important question: Will it Fold? Just remember - use A-U or G-U between 1-3's.
76
Testing 3D structure prediction of G/G mismatches (boosts!)
3376261
Testing 3D structure prediction of G/G mismatches (boosts!)
1380239358
9/26/2013 rhiju 0
Our lab has recently been focusing on understanding the stability and structure of G/G mismatches -- famous in Eterna as boosted 1 by 1 loops. These mismatches can actually form two conformations in solution (see graphic) and predicting which one is more stable is an unsolved problem. We think Rosetta can solve it now. We also recently discovered (partly by mining Eterna data) that SHAPE distinguishes which conformation is dominant. This projects will test our predictions and set a foundation for a cool puzzle where we will challenge players to stabilize one of the conformations!
77
Testing for crazy conformations of tandem G/A and A/G pairs
3376262
Testing for crazy conformations of tandem G/A and A/G pairs
1380239358
9/26/2013 rhiju 0
This is a quick pilot scan looking for unusual conformations of a classic model system in RNA folding. Tandem G/A pairs and A/G pairs can form a number of conformations, some of which are pretty wacky. We want to see how the flanking base pairs toggle the structure and whether Eterna's SHAPE data can detect these switches! Pilot sequences have 4 hairpins, each containing some variant of the motif. In the names below, W, S, and K refer to A/U, G/C, and G/U flanking pairs, respectively. More info: http://www.rcsb.org/pdb/explore/explore.do?structureId=2LX1
78
A codon riboswitch
3376263
A codon riboswitch
1380239358
9/26/2013 rhiju 12
This project tests an idea related to the origin of life, the so-called sterochemical hypothesis. I've hypothesized that there were switch-like molecules that converted amino acid signals to nucleic acid signals as an intermediate step in the development of the genetic code.<br/>I posted some slides on this idea <a href="https://drive.google.com/file/d/0B_ZX7iE4SSSOR2VHLVpXTjhjRkk/edit?usp=sharing">here</a>. I've designed a proof-of-concept switch that my lab has confirmed does change structure when it binds tryptophan, and we used eterna slot previously to carry out mutate-and-map, which suggested some interesting states at play. Can you help me put in a few mutations (4 max) that will stabilize each state?<br/>
79
SHAPE Profile - G-G Mismatch - Pilot Run
3376264
SHAPE Profile - G-G Mismatch - Pilot Run
1380239358
9/26/2013 Brourd 11
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying protected base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the G-G mismatch. Since the use of longer RNA molecules is brand new, and the stability of such a long helix is unknown, only 25 slots are requested for synthesis in this pilot run.
80
SHAPE Profile - C-C Mismatch - Pilot Run
3376265
SHAPE Profile - C-C Mismatch - Pilot Run
1380239358
9/26/2013 Brourd 9
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying protected base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the C-C mismatch. Since the use of longer RNA molecules is brand new, and the stability of such a long helix is unknown, only 25 slots are requested for synthesis in this pilot run.
81
Reversed G-C Multibranch Loop Closing Base Pairs 2
3376269
Reversed G-C Multibranch Loop Closing Base Pairs 2
1380239358
9/26/2013 Brourd 11
It is well known, that multibranch loops are best closed with G-C pairs for stability. We even have a general rule that states they should be flipped a certain way. Now, this rule is not without merit, as it has been observed that the guanine on the 3' side of the base pair can be exposed when the pair is not flipped correctly. The goal of this lab project is to determine if having these G-C pairs oriented like this contributes to instability in the design overall, and to determine how often and under what conditions, a reactive 3' Guanine residue will occur. This is the second target structure in this lab challenge, with the length of the unpaired strands in the multibranch loop, decreased by 1 nucleotide each. 40 slots are requested for synthesis.
82
Reversed G-C Multibranch Loop Closing Base Pairs 3
3376270
Reversed G-C Multibranch Loop Closing Base Pairs 3
1380239358
9/26/2013 Brourd 13
It is well known, that multibranch loops are best closed with G-C pairs for stability. We even have a general rule that states they should be flipped a certain way. Now, this rule is not without merit, as it has been observed that the guanine on the 3' side of the base pair can be exposed when the pair is not flipped correctly. The goal of this lab project is to determine if having these G-C pairs oriented like this contributes to instability in the design overall, and to determine how often and under what conditions, a reactive 3' Guanine residue will occur. This is the third target structure in this lab challenge, with the length of the unpaired strands in the multibranch loop, compared to the original target, decreased by 2 nucleotides each. 40 slots are requested for synthesis.
83
A-U Closing Base Pairs 3
3376271
A-U Closing Base Pairs 3
1380239358
9/26/2013 Brourd 10
For this project, the objective is to stabilize a structure with A-U closing base pairs. One -1.1 base pair quad locked at the dangling ends, one -1.3 quad locked at the central multi branch loop, and two locked base pair quads, closing each of the tetraloops. This is the third lab in this project, with the goal to test both the stability of locked A-U quads at the multibranch loop and open loop, as well as to test A-U/G-U hybrid base pair quads closing the tetraloops. The base pair "quads" now closing the tetraloops are -1 kcal and -1.4 kcal, or UA/UG and GU/AU. The initiating stem of the design has been increased in length by two base pairs, to be identical to the first two projects in the number of base pairs that can be mutated. Results from this lab will be compared to those of the first two, and I hope to see some interesting sequences from players! 40 slots are requested for synthesis.
84
A-U Closing Base Pairs 4
3376272
A-U Closing Base Pairs 4
1380239358
9/26/2013 Brourd 10
For this project, the objective is to stabilize a structure with A-U closing base pairs. One -0.9 base pair quad locked at the dangling ends, one -0.9 quad locked at the central multi branch loop, and two locked base pair quads, closing each of the tetraloops. This is the fourth lab in this project, with the goal to test both the stability of locked A-U quads at the multibranch loop and open loop, as well as to test A-U/G-U hybrid base pair quads closing the tetraloops. The base pair "quads" now closing the tetraloops are -1.3 kcal and -0.6 kcal, or GA/UU and UU/AG. The initiating stem of the design has been increased in length by two base pairs, to be identical to the first two projects in the number of base pairs that can be mutated. Results from this lab will be compared to those of the first two, and I hope to see some interesting sequences from players! 40 slots are requested for synthesis.
85
SHAPE Profile - U-U Mismatch - Pilot Run 2A
3376273
SHAPE Profile - U-U Mismatch - Pilot Run 2A
1380239358
9/26/2013 Brourd 11
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the U-U mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge.<br<br> For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
86
SHAPE Profile - U-U Mismatch - Pilot Run 2B
3376274
SHAPE Profile - U-U Mismatch - Pilot Run 2B
1380239358
9/26/2013 Brourd 11
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the U-U mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge.<br<br> For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
87
SHAPE Profile - C-U Mismatch - Pilot Run 2A
3376275
SHAPE Profile - C-U Mismatch - Pilot Run 2A
1380239358
9/26/2013 Brourd 14
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the C-U mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge.<br><br> For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
88
SHAPE Profile - C-U Mismatch - Pilot Run 2B
3376276
SHAPE Profile - C-U Mismatch - Pilot Run 2B
1380239358
9/26/2013 Brourd 15
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the C-U mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge.<br><br> For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
89
SHAPE Profile - C-A Mismatch - Pilot Run 2B
3376280
SHAPE Profile - C-A Mismatch - Pilot Run 2B
1380239359
9/26/2013 Brourd 14
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the C-A mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge.<br><br> For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
90
SHAPE Profile - A-C Mismatch - Pilot Run 2A
3376281
SHAPE Profile - A-C Mismatch - Pilot Run 2A
1380239359
9/26/2013 Brourd 13
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the A-C mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge.<br><br> For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
91
SHAPE Profile - A-C Mismatch - Pilot Run 2B
3376282
SHAPE Profile - A-C Mismatch - Pilot Run 2B
1380239359
9/26/2013 Brourd 14
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the A-C mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge.<br><br> For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
92
SHAPE Profile - G-A Mismatch - Pilot Run 2A
3376283
SHAPE Profile - G-A Mismatch - Pilot Run 2A
1380239359
9/26/2013 Brourd 14
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the G-A mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge.<br><br> For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
93
SHAPE Profile - G-A Mismatch - Pilot Run 2B
3376284
SHAPE Profile - G-A Mismatch - Pilot Run 2B
1380239359
9/26/2013 Brourd 13
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the G-A mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge.<br><br> For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
94
SHAPE Profile - A-G Mismatch - Pilot Run 2A
3376285
SHAPE Profile - A-G Mismatch - Pilot Run 2A
1380239359
9/26/2013 Brourd 11
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the A-G mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge. For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
95
SHAPE Profile - A-G Mismatch - Pilot Run 2B
3376286
SHAPE Profile - A-G Mismatch - Pilot Run 2B
1380239359
9/26/2013 Brourd 11
In RNA, interactions between any base can occur. In this series of lab projects, the goal is to investigate the SHAPE chemical footprint of these interactions, which can ultimately help with structure prediction and identifying stable base mismatches, for use in further experiments for determining the stability of these interactions. For this specific project, we will be testing the A-G mismatch, adjacent to various unstable secondary structures, including the open loop, a multiloop, two hairpin loops, and a single nucleotide bulge. For this pilot run, the sequences for the loops and the pairs closing them are locked. In addition, there will be two parts to each project, with orientation for the closing base pairs differing with each. 20 Slots are requested for synthesis.
96
Large GU stack
3376287
Large GU stack
1380239359
9/26/2013
player4596
9
I want to analyze the behaviour of large GU stacks, which are considered stable by eteRNA, in nature. Your task is to change the stacks and loops at the ends of the GU stack, so many possible influences by other bases/pairs can be studied. The submitted designs needn't fit the given outline, if the GU stack is not interrupted by unpaired bases.
97
Tetraloop Competition Series - GAAA
3376288
Tetraloop Competition Series - GAAA
1380239359
9/26/2013 JR 11
The majority of our puzzles all like the GAAA mismatch in Tetraloops but many solutions from nature have other configurations. Is this discrepancy due to a Eterna preference? To test this, this series will synthesize various Tetraloop motifs to see if there is a distinct rank or synthesis preference. This series of labs will test various Tetraloop configurations. If one configuration is superior to any other, I would think that the synthesis results would show superior as well, creating a clear rank in synthesis results. Feel free to add to the series with your favorite Tetraloop pattern. 25 slots requested per proposed lab.
98
Tetraloop Competition - UUCG
3376289
Tetraloop Competition - UUCG
1380239359
9/26/2013 JR 11
The majority of our puzzles all like the GAAA mismatch in Tetraloops but many solutions from nature have other configurations. Is this discrepancy due to a Eterna preference? To test this, this series will synthesize various Tetraloop motifs to see if there is a distinct rank or synthesis preference. This series of labs will test various Tetraloop configurations. If one configuration is superior to any other, I would think that the synthesis results would show superior as well, creating a clear rank in synthesis results. Feel free to add to the series with your favorite Tetraloop pattern. 25 slots requested per proposed lab.
99
Tetraloop Competition Series - UACG
3376290
Tetraloop Competition Series - UACG
1380239359
9/26/2013 JR 11
The majority of our puzzles all like the GAAA mismatch in Tetraloops but many solutions from nature have other configurations. Is this discrepancy due to a Eterna preference? To test this, this series will synthesize various Tetraloop motifs to see if there is a distinct rank or synthesis preference. This series of labs will test various Tetraloop configurations. If one configuration is superior to any other, I would think that the synthesis results would show superior as well, creating a clear rank in synthesis results. Feel free to add to the series with your favorite Tetraloop pattern. 25 slots requested per proposed lab.
100
Tetraloop Competition Series - GAGA
3376291
Tetraloop Competition Series - GAGA
1380239359
9/26/2013 JR 11
The majority of our puzzles all like the GAAA mismatch in Tetraloops but many solutions from nature have other configurations. Is this discrepancy due to a Eterna preference? To test this, this series will synthesize various Tetraloop motifs to see if there is a distinct rank or synthesis preference. This series of labs will test various Tetraloop configurations. If one configuration is superior to any other, I would think that the synthesis results would show superior as well, creating a clear rank in synthesis results. Feel free to add to the series with your favorite Tetraloop pattern. 25 slots requested per proposed lab.
Loading...
Main menu