QianLab Order
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
 
Still loading...
ABCDEFGHIJKLMNOPQRSTUVWX
1
http://www.sigmaaldrich.com/catalog/product/sigma/h6647?lang=en&region=USNameVendorCatalog #ItemUnitQuantityRemark
2
7/1/2013Alex CootsMilliporeSLHA 033 SSMillex Filter Unit with MF-Millipore Membrane 0.45 um50 / box2For filtering virus
3
7/1/2013Alex CootsInvitrogen10131-035G418, Geneticin®1 bottle2Lab supply
4
7/1/2013Alex CootsInvitrogen25200-1140.25% Trypsin-EDTA (1X), Phenol Red20 x 100 ml1Lab supply
5
7/1/2013Juliana MagdalonCorning431080175 cm2 angled neck, vent cap flask50 pack/case1 caseCell culture
6
7/1/2013Ben ZhangCorning455850mL PP Centrifuge Tubes, Sterile 25/Universal pack500/case5Lab supply
7
7/1/2013xiangwei GaoInvitrogenLC6876.Novex® TBE-Urea Sample Buffer (2X)10mL2Library construction
8
7/1/2013Ben ZhangFisherPI-22811Protein A Plus Agarose5ml1Lab supply
9
7/7/2013Jun ZhouFisherNC9664283 CELL FREEZING MEDIUM 50ML50mL5lab Supply -buy bulk if deals
10
7/8/2013Ben ZhangSigmaE6654-5X1MLEZview™ Red Anti-c-Myc Affinity Gel
5X1ML1Lab supply
11
7/8/2013Juliana MagdalonVWR89125-172Ethanol, Pure, 200 Proof (100%),USP, KOPTEC1 Gallon/case of 41Lab Supply -buy bulk if deals
12
7/8/2013Ben ZhangCorning29443-045_4487Corning® Costar® Stripette® serological pipettes 5mL50/bag 200/case15Lab supply (try to buy in bulk or with promo)
13
7/8/2013Ben ZhangCorning29443-045_4489Corning® Costar® Stripette® serological pipettes 25mL25/bag 200/case10Lab supply (try to buy in bulk or with promo)
14
7/8/2013Xiangwei GaoIDTGalm-ForGGCCAAGCTTaggaaaagaccagcaaac25 nmol1UTR construction and validation
15
7/8/2013Xiangwei GaoIDTGalm-RevGCATCCATGGaaaccattgggaaagttc25 nmol1UTR construction and validation
16
7/8/2013Xiangwei GaoIDTGtf2h5-ForGGCCAAGCTTcgcaggcgcagtgagt25 nmol1UTR construction and validation
17
7/8/2013Xiangwei GaoIDTGtf2h5-RevGCATCCATGGtgaccatcttttcccag25 nmol1UTR construction and validation
18
7/8/2013Xiangwei GaoIDTHerpud1-ForGGCCAAGCTTaaagacgccaagtgtc25 nmol1UTR construction and validation
19
7/8/2013Xiangwei GaoIDTHerpud1-RevGCATCCATGGgctccatgtctgcgtcg25 nmol1UTR construction and validation
20
7/8/2013Xiangwei GaoIDTMatr3-ForGGCCAAGCTTgggcgctctcgcgagat25 nmol1UTR construction and validation
21
7/8/2013Xiangwei GaoIDTMatr3-RevGCATCCATGGtggacattgtagaactat25 nmol1UTR construction and validation
22
7/8/2013Xiangwei GaoIDTPttg1ip-ForGGCCAAGCTTctagctcggcgttgg25 nmol1UTR construction and validation
23
7/8/2013Xiangwei GaoIDTPttg1ip-RevGCATCCATGGtgagtgcgtc25 nmol1UTR construction and validation
24
7/8/2013Xiangwei GaoIDTScpep1-ForGGCCAAGCTTagtccccgcgcaagc25 nmol1UTR construction and validation
25
7/8/2013Xiangwei GaoIDTScpep1-RevGCATCCATGGgctccatgatgaaaac25 nmol1UTR construction and validation
26
7/8/2013Jun ZhouIDTmActin-ForTGTCACCAACTGGGACGATA25 nmol1m6A IP efficiency test
27
7/8/2013Jun ZhouIDTmActin-RevACCCTCATAGATGGGCACAG25 nmol1m6A IP efficiency test
28
7/8/2013Jun ZhouIDTPtpn4-ForCCTCCCATCCCGGTCTCCACC25 nmol1m6A IP efficiency test
29
7/8/2013Jun ZhouIDTPtpn4-RevGGCTGCCCATCTTCAGGGGT25 nmol1m6A IP efficiency test
30
7/8/2013Jun ZhouIDTGrm1-ForGCCTCAGTGTGACGGTGGCC25 nmol1m6A IP efficiency test
31
7/8/2013Jun ZhouIDTGrm1-RevAGCTTGCCGTCACCGACGTG25 nmol1m6A IP efficiency test
32
7/8/2013Jun ZhouIDTDrd1a-ForTGTGTGGTTTGGCTGGGCGA25 nmol1m6A IP efficiency test
33
7/8/2013Jun ZhouIDTDrd1a-RevTGGAGATGGAGCCTCGGGGC25 nmol1m6A IP efficiency test
34
7/8/2013Jun ZhouIDTTlr3-ForTGCTCAGGAGGGTGGCCCTT25 nmol1m6A IP efficiency test
35
7/8/2013Jun ZhouIDTTlr3-RevCGGGGTTTGCGCGTTTCCAG25 nmol1m6A IP efficiency test
36
7/8/2013Jun ZhouIDTRps21-ForCTGCGGAGGCACGAGCTACT25 nmol1m6A IP efficiency test
37
7/8/2013Jun ZhouIDTRps21-RevTTCCGCGGCACGTACAGGTC25 nmol1m6A IP efficiency test
38
7/14/2013Ben ZhangIDTM18OEQ-FACGGGAACCTCAGAGAATCTA25 nmol1For qPCR of overexpressed MRPL18
39
7/14/2013Ben ZhangIDTM18OEQ-RACTCAATGGTGATGGTGATGAT25 nmol1For qPCR of overexpressed MRPL18
40
7/14/2013Ben ZhangSigmaC2759-250MGCarbonyl cyanide 3-chlorophenylhydrazone (CCCP)250MG1Mitochondrial uncoupling
41
7/16/2013Juliana MagdalonSigmaI-70183-Isobutyl-1-methylxanthine100 mg1adipocyte differentiation
42
7/16/2013Alex CootsAddgenePlasmid 46340Flag Depdc5 pRK5 11For GCN2/mTORC1 experiments
43
7/17/2013Mridusmita SaikiaSTAPLES1387762" Avery® Economy Binder with Label Holder and Round Rings, Black16Lab Supply-please buy bulk if there is an option
44
7/17/2013Mridusmita SaikiaSTAPLES477938Sanford Sharpie® Permanent Markers, Ultra-Fine Tip, BLUE Ink, 12/Pk12/Pk1Lab Supply
45
7/17/2013Mridusmita SaikiaSTAPLES491831Avery® Multicolored Plastic Insertable Tab Dividers, 8-Tab8 tab/Set1Lab Supply
46
7/17/2013Ben ZhangInvitrogen AM2295 RNase I (Cloned) 100 U/μl25000 units1Lab supply
47
7/16/2013Ben ZhangProteintech11302-1-APRPL4 Rabbit Polyclonal antibody150ul/27ug1Ribosome pull down
48
7/19/2013Crystal ConnLonza-VWR95042-498DMEM 4.5 G/L GLUCOS 500ML PK1212bottles/case2Lab Supply
49
7/19/2013Crystal ConnLonza-VWR95042-492D-PBS 1X W/O CA++/MG++ PK1212bottles/case2Lab Supply
50
7/19/2013Xiangwei GaoBio-Rad165-3308Short Plates (5)5 plates1Lab Supply
51
7/19/2013xiangwei GaoInvitrogen10296-028TRIzol® LS Reagent200 ml1Lab supply
52
7/19/2013Ben ZhangCorning4488PIPETTE,10ML,PPW,PS,S,IND,50BA 200/Case 10Lab supply
53
7/19/2013Jun Zhousigma342483Sodium phosphate 25g1for m6A IP buffer
54
7/19/2013Jun ZhouInvitrogen61005Dynabeads® Oligo(dT)255ml1Oligo dT pull-down
55
7/22/2013Mridusmita SaikiaLife TechnologiesAM1560mirVana™ miRNA Isolation Kit, with phenol Kit1Small RNA isolation
56
7/19/2013Shubing Qian STAPLES957039Staples® #2 Side Advance Mechanical Pencils11
57
7/22/2013Juliana Magdalon15596-018Trizol Reagent200 mL bottle1For qPCR
58
7/22/2013Jun  ZhouRoche1168184200111PCR amplication, lab supply
59
7/22/2013Jun ZhouNEBR0136SBamHI 10,000 units1lab supply
60
7/24/2013Ben ZhangLonza-VWR95042-498DMEM 4.5 G/L GLUCOS 500ML PK1212bottles/case2Lab Supply
61
7/26/2013Mridusmita SaikiaLife TechnologiesAM9780RNaseZap250 mL Bottle1For RNAse decontamination of surfaces
62
7/26/2013Mridusmita SaikiaLife TechnologiesAM9930Nuclease-Free Water (not DEPC-Treated)500 mL Bottle1For RNA meant for downstream qPCR and transfection
63
7/29/2013Ben ZhangLPSL250901 1.5ml tube,flat cap,grad, RNAse,DNAse free,1M/UNunit10Lab supply
64
7/30/2013xiangwei GaoClontech631106Tet System Approved FBS500ml/bottle1For Tet system cell culture
65
7/31/2013Ben ZhangFisher Scientific02-707-1381-200UL RND GEL LOAD-NS 960/PK Pack of 960 3Lab supply
66
7/31/2013Ben ZhangThermo Scientific(Fisher)PI-26619PageRuler* Plus Prestained Protein Ladder 10-250kDa 2x250ul5Lab supply
67
7/31/2013Ben ZhangFisherPI88518Thermo Scientific* Pierce* PVDF Membranes
box2Lab supply
68
7/31/2013Jun ZhouInvitrogen4374966High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor, 200 Reactions 200RXN1RT kit for Q-PCR
69
8/2/2013Mridusmita SaikiaInvitrogen LC6675 Novex® TBE Running Buffer (5X)1L Bottle1For Gel running
70
8/2/2013Mridusmita SaikiaBio-Rad161-014540% acrylamide and bis-acrylamide solution, 19:1 2 x 500 ml/case1Urea-PAGE gel for detection/purification of tRNAs
71
8/3/2013xiangwei GaoCorning8160Costar® Spin-X® Centrifuge Tube Filterscase1For library construction
72
8/4/2013xiangwei GaoInvitrogen18080-044SuperScript® III Reverse Transcriptase10000 U2Lab supply
73
8/4/2013xiangwei Gaoepicentre (Fisher)CL9025KCircLigase TM II ssDNA Ligase5000 Units1For library construction
74
8/5/2013Jun ZhouIDThFto-shRNA1-SACCGGGCTGATCAGAAGCCAGAATGTCTCGAGACATTCTGGCTTCTGATCAGCTTTTTTG25 nmol1human Fto shRNA constructs
75
8/5/2013Jun ZhouIDThFto-shRNA1-ACGAACAAAAAAGCTGATCAGAAGCCAGAATGTCTCGAGACATTCTGGCTTCTGATCAGCC25 nmol1human Fto shRNA constructs
76
8/5/2013Jun ZhouIDThFto-shRNA2-SACCGGGGATGACTCTCATCTCGAAGGCTCGAGCCTTCGAGATGAGAGTCATCCTTTTTTG25 nmol1human Fto shRNA constructs
77
8/5/2013Jun ZhouIDThFto-shRNA2-ACGAACAAAAAAGGATGACTCTCATCTCGAAGGCTCGAGCCTTCGAGATGAGAGTCATCCC25 nmol1human Fto shRNA constructs
78
8/5/2013Jun ZhouIDThFto-shRNA3-SACCGGGGTGGCAGTGTACAGTTATAGCTCGAGCTATAACTGTACACTGCCACCTTTTTTG25 nmol1human Fto shRNA constructs
79
8/5/2013Jun ZhouIDThFto-shRNA3-ACGAACAAAAAAGGTGGCAGTGTACAGTTATAGCTCGAGCTATAACTGTACACTGCCACCC25 nmol1human Fto shRNA constructs
80
8/5/2013Ben ZhangVascoFJ23504SINGLEFOLD TOWELS - NATURALcase2Lab supply
81
8/5/2013Ben ZhangFisher Scientific22-042-817Pipet, Pasteur; Fisherbrand; 9 in.; Case of 250 Case of 2506Lab supply for tissue culture
82
8/5/2013Juliana MagdalonFisherBP220-212D-Sucrose (Molecular Biology)2.5kg1For sucrose gradient
83
8/6/2013Crystal ConnBeckman (VWR)BK349622TUBE POLYCARBONATE 3.5ML PK25Pack of 251Lab use for Ultracentrafuge
84
8/6/2013Ben ZhangAirgasCD FG50Food Grade Carbon Dioxide, Size 50 Pound Cylinder, CGA32050 Pound1Lab supply
85
8/6/2013Ben ZhangSigma AldrichHPA028774-100ULAnti-MRPL18 antibody produced in rabbit100 uL1We're out of this antibody
86
8/8/2013Ben ZhangLPSL134770 1250uL refill, QuickRack grd, natural, 8x96/UNcase10Lab supply
87
8/8/2013Ben ZhangInvitrogen10777019RNaseOUT™ Recombinant Ribonuclease Inhibitor 5,000 units2Lab supply
88
8/8/2013Ben ZhangIDTProbe actin5'-biotin-TEG-AAAAACAAATAAAGCCATGCCAATCTCA-3'1 umol1RNA pull down
89
8/8/2013Juliana MagdalonInvitrogen25200-1140.25% Trypsin-EDTA (1X), Phenol Red20 x 100 ml2Lab supply
90
8/12/2013Juliana MagdalonFisher Scientific09-898-12BWeighing Paper500/PK2Lab supply
91
8/12/2013Jun ZhouInvitrogenAM1350MPoly(A) Tailing Kit with Manual25 rxns 1in vitro transcription
92
8/12/2013Jun ZhouInvitrogenAM1908MMEGAclear™ Kit with Manual 20 rxns 1in vitro transcription
93
8/12/2013Jun ZhouInvitrogenAM1333MEGAscript® T7 Kit 25 reactions1in vitro transcription
94
8/12/2013Jun ZhouTrilinkN-1013N6-Methyladenosine-5'-Triphosphate100 uL1in vitro transcription
95
8/12/2013Jun ZhouInvitrogenAM8045ARCA 10 units1in vitro transcription
96
8/13/2013Alex CootscNEG772007MCEasyTag EXPRE35S Protein Labeling Mix [35S]-, 7mCi (259MBq)7mCi1S35 labelling
97
8/13/2013Ben ZhangSigmaG7126-5KGGlycine5KG1Lab supply
98
8/13/2013Ben ZhangSigmaT1503-5KGTrizma® base5KG1Lab supply
99
8/13/2013Ben ZhangVWRBDH1135-4LPMethanol, ACS Grade.Case of 4 (4 l)1Lab supply
100
8/19/2013Alex CootsGE (Fisher)28906839Hyperfilm ECL 8x10 in100/box5Lab supply
Loading...
 
 
 
FY2014 Original
Original
FY 2016 Original
FY 2015 Original
Order
FY2014 order
FY 2015 order
FY 2016 order
FY2017 input sheet
FY 2017 for Ben & Fang