R85 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79X80X81X82X83X84X85X86X87X88
2
1Atedus
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4162843
GGAGGGAGGAAGCUGAAGGAUGUCGAAAGGGUGGUUGUGUACGCACGCGCGUAUACACCACCCUUUCACAUCCUUCACUUCCUCCCAAAAGUGCUGGUUCGCCAGCACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.207weak75.300.9270.463-1.8091.346500001.5377001.51441.49190000001.46990000000000000001.448700000001.428001.407900000000000000-0.88061.47864.17961.98140002.352300000000-1.605800000000002.29834.3946
3
2Orave
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4163096
GGAGGGAGGUUGCUGUUGUGUGUCGGUGUUAAAGUUGGUCGGGUGUUAACCCGAUCACUUUAAUACCACACAUAACACAACCUCCCAAAAGGGUCGGUUCGCCGGCCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.501weak89.700.2530.1261.03610.81680.6139-0.1712000.1226000-0.04840.24430.72770.2420.0708000.120600000.12040.2402-0.170300-0.1700.060.17970.23910.238501.06190.23540000.11760000.00630.81490.40581.48490.62380.11320.113100-0.337700.11290.11280.11270000.1126000-0.1686000.11240.1123-0.1683000.1122000.33540.22310-0.1680000.11140.111300.66340.11041.1402
4
3Laarararon
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4163894
GGAGAGGCGAAGCUGAAGGUGGUCGAGUGGUAAGUUGUAAGGGCGUUAGCCCUUACACUUACCACUCACUACCUUCACUUCGCCUCAAAACUUGUGCUUCGGCACAAGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.181weak70.100.5270.264-1.60170.90450.8964000.888500.88060001.730801.701400.8435000.836500.82951.2290.408000000000001.605800000000000000.7965-0.8453.44700000000.760200000001.4976000000000000.74320000.7378002.86651.4132.1856
5
4Stone
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4164835
GGAGUCUACGUGCUGUGAUCAGUCGACUGUCAAGUUGAUCAGUCGAGAGACUGAUCACUUGACAGUCACUGAUCACACACGUAGACAAAAGUGACUCUUCGGAGUCACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.041weak82.501.5990.8000000000000000000000000000000000000000000-11.422900-10.2523000000000000000000000000000000000000000011.42290
6
5Wood
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4164839
GGAGUCUACGUGCUGUGAUCAGUCGACUGUCUUGUUGUACAGUCGAGAGACUGUACACAAGACAGUCACUGAUCACACACGUAGACAAAAGUGUGUCUUCGGACACACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.071weak83.500.4710.2350000.91280.90450000000000000000001.77690000000000000000000-2.514400000000000000000000000000000000000000001.7459-2.45281.71593.3181
7
6Hay
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4164841
GGAGUCUACGUGCUGUGAUCAGUCGACUGUCUAGUUGUACAGUCGAGAGACUGUACACUAGACAGUCACUGAUCACACACGUAGACAAAAGUGUCUCUUCGGAGACACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.053weak84.500.5830.2911.1588-4.12162.26520000000001.11990000000000000000000001.10750000000000000000000000000000000000000000000000000001.0954-2.875
8
7Probably 4 - Jieux - SHAPE Profile - Most Likely Base Pair U/A 1.2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4167186
GGAGCACUGCCGCUGUACCAUGUCGCCACGUACGUUGGAUCUAGGAAACUAGGUCCACGUACGUGGCACAUGGUACACGGUAGUGCAAAACUGUGAGUUCGCUCGCAGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.458weak87.60.0250.2770.151-0.32390.88620.75910.11650.23240.116100.11590.11580000.57560.22970.11470.11460.05730.057200000.28530.6238000000.11330000.11320.78590.335700.111800.1117-0.231400000.99490.33050.32940.10970.10960.218700.1092000.109100000.10900.10890000.10870-0.1223000.1085-0.23040.108400.09430000-0.013700.10770.10760.21470.3210.53211.0322
9
8You Hey! (U/A Most likely base pair v.1.2 - 1-0 Bulges with C)
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4170752
GGAGUACUAGUGCUGUACAUUGUCGGUCUUAUGGUUGAGUAUGCAAAAGCAUACUCACCAUAAGAUCACAAUGUACACACUAGUACAAAAGUAUGUCUUCGGACAUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.19weak76.300.3970.1981.58650.7872.30660000000000.76300.757200000000000.37720.375800000000.74591.4699000000001.448700000000000.71910000.71400000000000000000.7089000.703900.69900.69421.03050.34232.01270
10
9Freestyle 2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4175447
GGAGAACGGUGGCUGUAGUGUGUCGUGGGUCAAGUUGAGUCAGCGAGAGCUGACUCACUUGACUCACACACGCUACACCACUGUUCAAAAGCUAUCGUUCGCGAUAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.36weak78.400.2340.1171.3140.66680.12120.132600.1325000000.13230.65710.131300000000.13110.13090.39120.13020000000000.13010.517600-0.2765000000.25810.12890.12870.1286000.12840000000.19220.0640.1279-0.275700000.12770.12760.1274000000.127300000000.1271-0.4215-0.273500.88070.99651.8341
11
10Jr Modified
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4175454
GGACGUUGAUAGCUGUUAGUAGUCGUCAGUAUUGUUGUUAGUAGGAAACUACUAACACAAUACUGACACUACUAACACUAUCAACGAAAAGACGAUCUUCGGAUCGUCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.05weak80.400.3910.195000001.586500000-2.51443.075400000001.514400001.4919000000000000000000001.46990000000000000-2.45280000000001.4487000000001.42800001.407901.38830
12
11Last one (Likely shape UA 1.2)
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4177626
GGAGCAUACUAGCUGAUACUAGUCGAUAUCAUGGUUGUAUCUACGAAAGUAGAUGCACUAUGAUAUCACUAGUAUCACUAGUAUGCAAAAGCAAUGCUUCGGCAUUGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.168weak83.500.3940.1973.12350.77481.5260000000000.757200000000000.751500.7459000000001.46991.448700000000000.7191000.7140000000000001.407900000000.6990000000.694200000-1.06330.68940.68472.01271.973
13
12SP U/A V1.2 V1
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4182873
GGAGCAGUCAGGCUGCAGCUGGUCGCAUGCAUCGUUGGAGGUGCUUCGGCACCUCCACGAUGCAUGCACCAGCUGCACCUGACUGCAAAAGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.156weak80.400.930.46503.123400003.028800000002.93980000000000000000000000000000000000000000000000000002.8559000000000000000000002.7766
14
13SP U/A V1.2 V2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4182945
GGAGGAGUCAUGCUGAUGCAUGUCGUCUGCAUUGUUGUAGGUGCGAAAGCACCUACACGAUGCAGGCACAUGCAUCACAUGACUCCAAAAGGAUGUCUUCGGACAUCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.071weak80.400.790.395-6.0575000000002.1042000000002.0608001.01991.00961.9793000000000000000000000001.9409000000000000000000000000000000000000001.9041.8684
15
14spmlbpu/av1.2-2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4196243
GGAGCACACGUGCUGUGUGUGGUCGUGGUGCACGUUGGGCGUUGGAGACAACGCCCACGUGCACCACACCACACACACACGUGUGCAAAAGCCUCUCUUCGGAGAGGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.036weak80.400.8350.41800004.12160000003.9585000000003.80790000000000000000000000000000000000000000000000000000000000003.6682000003.5385
16
15spmlbpu/av1.2-3
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4196245
GGAGCACACGUGCUGAGUGUGGUCGUGGUGCACGUUGGGCGUUGGAGACAACGCCCACGUGCACCACACCACACUCACACGUGUGCAAAAGGCUCUCUUCGGAGAGCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.039weak82.500.3150.15700001.8091.77690000001.745900000000000000000000000000000000000000000000000000000000000000.86540.8580000000001.6871.6591.632
17
16spmlbpu/av1.2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4196298
GGAGGAGAGCUGCUGAGAGAGGUCGAGCUGGAGGUUGGCCCAUGGAGACAUGGGCCACCUCCAGCUCACCUCUCUCACAGCUCUCCAAAAGCGUCUCUUCGGAGACGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.06weak82.500.2880.144-4.9056000.64070.6366000000000000000001.2572000000000000000000000000000000001.24160000000000000000000000000000003.59120
18
17MLBRUA Omei 1
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4213309
GGAGCUAUGAUGCUGUCUUAUGUCGAACAUGUAGUUGACUUGACGAAAGUCAAGUCACUACAUGUUCACAUAAGACACAUCAUAGCAAAGCCAUGACUUCGGUCGUGGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.078weak82.500.2850.14200.13651.9084000000000.94520000000000000000000000.47042.2978000000000000.910800.902500000000000000000000000.8945000.886500000000-1.7769000.87881.7272
19
18Fiskers UA variation D1
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4218610
GGAGCGUAGCUGCUGUACAAUGUCGUCAUGUACGUUGGUUGAUCGAAAGAUCGACCACGUACAUGACACAUUGUACACAGUUACGCAAAAGCAGUGGUUCGCCAUUGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.41weak88.700.1980.0991.04780.51940.61530.087800.08770.0877000.0876000.86830.08680.08670.0866-0.11490000-0.114600.43040.0860.085900.1716000.08570000.76550.169800000000.08480.08480.4221-0.1163000000.1684-0.200200.0841000000.084100.08400.16770.0838-0.03250-0.03240000.0834-0.1156000.08330.08320.083100-0.1986-0.03220.14940.14891.06241.0512
20
19Fiskers UA variation D2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4218622
GGAGCGUAGCUGCUGUAGACUGUCGUCAUUAUCGUUGGUUGAUCGAAAGAUCGACCACGAUGAUGACACAGUUUACACAGUUACGCAAAAGCUUAGGUUCGCCUAAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.327weak75.300.1650.0820.96890.67430.663200.132500.26420.26360.13160001.04190.13010.12990.12970000.12960000.64360.12860.1284000000000.76450.12730000000000.253900.126800.1266000000000000000000000.25260000.126100.12600000000.12580.12570.62430.8051
21
20Fiskers UA variation D3
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4218634
GGAGCGUAGCUGCUGCAGACUGUCGUCAGUAUGGUUGCUUGAUCGAAAGAUCGAGCACCAUGCUGACACAGUUUGCACAGUUACGCAAAAGCAUAGGUUCGCCUAUGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.22weak84.500.1850.0921.36210.07490.90740.181200-0.290600-0.289700.18080.60720.06910000000000.53280.3540000000000.93650.34840000000000.34720.346-0.286400.1727000000000000000.172400000.1721-0.56950.1718000-0.284000000-0.28310.34250.68030.22530.16891.0033
22
21MLBP Basics
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4232391
GGAGUUAGUAGGCUGAGUAAUGUCGUUAGUAUUGUUGACAACAUGAAAAUGUUGUCACAAUACUAACACAUUACUCACCUACUAACAAAAGUAGGGCUUCGGCCCUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.15weak84.500.7010.35102.51442.45280002.394100000000000000004.5695000000000004.36990000000000002.13820000000000000000000000000002.0935000000002.050600
23
22Nameless 1
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4241908
GGAGCUAGAUAGCUGAUAGAUGUCGAUAGAUUCGUUGAUAGAUCGAAAGAUCUAUCACGAAUCUAUCACAUCUAUCACUAUCUAGCAAAAGCUUAUCUUCGGAUAAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.106weak82.500.5710.285002.29110000000000001.13260000000000-2.5144-2.4528000000000000000001.11990000000000000000000001.1075000001.0954000000001.08350002.12112.0771
24
23Most Likely AU 2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4246398
GGAGUAUAUAUGCUGAUAUAUGUCGAUAUAUAUGUUGCUAUAUGGAAACAUAUAGCACAUAUAUAUCACAUAUAUCACAUAUAUACAAAAGGUAAUCUUCGGAUUACCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.08weak79.400.2440.122-1.1317-0.82550000000000.54541.6100000000000000000000000000000000000.533800000000000000000000000000000000.53100.528200.52541.55170.51461.01871.0084
25
24Zoom
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4251616
GGAGCAUGUAGGCUGGUGUAGGUCGGUACGUAGGUUGGAUGUCCGAAAGGACAUCCACCUACGUACCACCUACACCACCUACAUGCAAAAGGUCUGCUUCGGCAGACCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.065weak84.500.6410.3210000000000002.514400002.452800000000000000002.3941000000000000000002.33810000002.28470000000000000000000000000002.2337
26
25BD3 - Brourd - MLBP U/A 1.2 R1 - Sub 3
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.2
4275018
GGAAACUAGUAGCUGAGACAUGUCGUAUCGAUAGUUGAUCCAUCUCCGGAUGGAUCACUAUCGAUACACAUGUCUCACUACUAGUUAAAAUACUGACUUCGGUCAGUAAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.086weak80.400.4180.209-2.8890.5338000001.0563000000001.0453000000000000000001.034501.023900000002.00670.99340.983600000.9740.964600.9554000000000.946400000000000000000.937500.9288001.823800.9036
27
26Veedintele
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4164736
GGCACCCACUCCGUCUUUAUUCUGCAUUACUUCCUUCUCCUCGCGCUAGCGAGGAGAGGAAGUAAUGAGAAUAAAGAGGAGUGGGUAAAACAUGGGCUUCGGCCUAUGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.062weak78.400.3910.1960.1748000.888500.88061.7308000001.70140000000000000000000000.84350.8365000000000000.829500000.4130.411300000.8160000000001.605800000000.79650000000.79020.7841.54381.52040.7545
28
27Xeso
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4165365
GGCCCACCCUUCGUCUUAAUUCUGCAUAUCCUUCUUCUCCUCCCUGCUGGGAGGAGAGAAGGAUAUGAGAAUUGAGAGAAGGGUGGAAAACUAUGGCUUCGGCCAUAGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.449weak85.600.310.1551.921400.4780-0.5576000000.159100.85710.31270.15610.155900.15560.15540.1551000.15490.92090000000.1532000.1530.7592000000000.15161.41992.83210.57760.57430000.14340000000.14320000.14300000000.1427000.1425000.14230000.283900.07090.0709-0.27650.28270.14650.8374
29
28JR_ShapeUA_Sub1
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4165754
GGACGUUAGUUCGUCUUAGUUCUGCUUAGUAUUCUUCUUAGUUGGAAACAAUUAAGAGAAUAUUAAGAGAAUUAAGAGAAUUAACGAAAAGUCAAUCUUCGGAUUGACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.131weak85.600.7020.3510000000002.104200000000000002.060800000000002.01920000000000000000000000000000001.979300000000000001.9409000001.9043.66836.8353
30
29Esisonbi
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4165773
GGAACCACCCUCGUCUAUCUUCUGCUAUUAUACCUUCUUCGUAGUUCCCUGCGGAGAGGUAUAAUAGAGAAGAUAGAGAGGGUGGUAAAAGCCUUACUUCGGUAAGGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.613weak90.700.5330.267-0.59410.29111.2755-0.2074000.23110000-0.20672.7010.44570000000001.31950.43790.218500000000.2181.29120.85340-0.3201000.2129000.84441.86460.82190.40930.2042000.2038000000.203400000000-0.3191000000000000.2030000.2026000.40350.68061.57271.1658
31
30Probably 12 - Jieux - SHAPE Profile - Most Likely Base Pair U/A 1.4
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4167265
GGAGCACUGCUCGUCCACCAGCUGCCCACGUAACUUCUAUCUAGGAAACUAGGUAGAGUUACGUGGGAGCUGGUGGAGAGUAGUGCAAAAGUGGGACUUCGGUCCUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.556weak91.800.2790.140.9041.15590.67540.2694000.134500000.06721.6570.19750000000001.93710.12900.128800.128600.128500.128301.01610.63100.1261000000.12590.25120.99460.2480.37070.1234-0.189900.12330-0.255300.24560-0.06620.12250.12240.1222000000.12210.24350000000.12160.1215-0.18850000.2423000.1210.2415-0.13470.41110.7132
32
31Meechl MLBP UA 1.4
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4169114
GGAGAUAGUUACGUCUAAACUCUGCAAGUAAUUCUUCUCAAAUCUAAUGAUUUGAGAGAAUUACUUGAGAGUUUAGAGUAACUAUCAAAAGAUAUUCUUCGGAAUAUCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.101weak83.500.8320.4160001.809-3.123401.7769000001.745900000001.715900.85070.843500000000004.81730000000001.58041.5558000000000000000000000000000000000000-3.02881.5321.50895.69221.40313.6158
33
32Lego s
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4173965
GGAGGUAUAUCCGUCAUCUAUCUGCGAUGGAUACUUCCAUGUAGGAAACUACGUGGAGUAUCUAUCGAGAUAGGUGAGGGUAUACCAAAACUGGCACUUCGGUGUCAGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.365weak82.500.3420.1710.97370.45231.191700.2970000000.14831.89140.2901000000000.28931.70620.56550000000000.84111.1091000000.276500.13810.137900.2750.27420-0.387800.2735000000.272700000000000000000.27200.27130000.270500000.26980.53671.062
34
33Vinnie s Valentine
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4173971
GGCACACAAUCCGUCUUUAUUCUGCAUUACUUCCUUCUCCUAGCGAAAGCUAGGAGAGGAAGUAAUGAGAAUAAAGAGGAUUGUGUAAAAGUAGCUCUUCGGAGUUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.048weak76.300.4360.218-4.121602.61650.520601.03041.0199000001.00960.99950000000000.9897000000000000.98000000000000.970500000.96110.9520.943000000000000.934200000000.925600000.9171000-3.95850.90873.50750.86932.5415
35
34Stairs
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4175924
GGAUUUGUUAGCGUCUGUUAGCUGCUGAUUGAUCUUCUGAUAGUGAAAAUUGUUAGAGGUUAGUUAGAGUUGAUAGAGUUGAUAGAAGAAAUCGGGUUUCGACUUGGUAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.638weak76.30.0820.8980.494.05940.35210.36780.91120.18190.72240.35990.7146-0.02880.3548000.66980.3498-0.033300.347400.34620-0.19060.49740.34262.014300.33460.33350.33240000.33130.65820.65391.29090.32170000000.95580.31760.63121.85842.4180.60092.05970.87500.29080.290-0.379000.28910.28830.28750.28670.2858000.8502000.2826000000.28180.2810.836000.55430.27641.09340.7042.11731.04762.30281.13591.48952.0477
36
35Hay U! (UA most likely base pair v1.4 - UC 2.2kcal tetra)
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4179922
GGAGUACUAAUCGUCGGAUUACUGCUAUGUACACUUCGUAUGACUAACGUCGUACGAGUGUACAUGGAGUAAUCCGAGAUUAGUACAAAAGCUAUACUUCGGUAUAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.218weak84.500.8930.446-1.191400.904500.89640000000000000000000.888500000000002.5962000000000.8581.6871.6590.8227000.8160000000000000000000000000000000.80940000.80297.43243.58312.7866
37
36MLBP-UA1_4-c
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4181570
GGAGACUAUAGCGUCGUCAUCCUGCCUUAUAUCCUUCCAUUAUCGAAAGAUAAUGGAGGAUAUAAGGAGGAUGACGAGCUAUAGUUAGAACUUAAUCUUCGGAUUAAGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.056weak79.400.3470.173-3.1234000000000001.58650000000001.56171.53771.5144000000000000000000000001.49190000000000001.469900000000001.44870000000000001.42802.7767
38
37UA Var. 1.4
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4183276
GGAGCAUGAUGCGUCGUAUAGCUGCGUAUCUAGCUUCGUAUAGCGAAAGCUAUACGAGCUAGAUACGAGCUAUACGAGCAUCAUGCAAAAGCUUAGCUUCGGCUAAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.073weak84.501.1710.5856.05750000000000010.806400000000005.126300000004.876400000000000000000000000-6.0575000004.6498000000000000000000000004.443300
39
38Good Night
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4187661
GGAGCUGACUACGUCAAUCUACUGCCACUCGAACUUCCUCGAGCGAAAGCUCGAGGAGUUCGAGUGGAGUAGAUUGAGUAGUCAGCAAAAGAGGAUCUUCGGAUCCUCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.018weak82.500.420.214.12160000000000000000000000000000000003.958500000000000000000000000000000000000000000000000000000
40
39SHAPE Profile - var1.4 - 1st
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4195402
GGAGAUAUAUACGUCUAUAUACUGCUAUAUAUACUUCUAUAUAGGAAACUAUAUAGAGUAUAUAUAGAGUAUAUAGAGUAUAUAUCAAAACGACAUCUUCGGAUGUCGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.353weak82.501.8670.9332.5144000000000004.78822.338100000000000000000000000000000002.2847-1.412700000000000000000002.233700000000000000000019.74739.56013.0883
41
40spmlbpu/av1.4
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4196412
GGAGGAGAGCUCGUCAGAGAGCUGCAGCUGGAGCUUCGCCCAUGGAGACAUGGGCGAGCUCCAGCUGAGCUCUCUGAGAGCUCUCCAAAAGCCACUCUUCGGAGUGGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.022weak82.500.2630.1311.41271.393000001.373901.35530000000000-4.1216001.3372000000000000000000000000000000000000000000000000000000000001.319501.302401.2856
42
41spmlbpu/av1.4-2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4196419
GGAGCACACGUCGUCUGUGUGCUGCUGGUGCACCUUCGGCGUUGGAGACAACGCCGAGGUGCACCAGAGCACACAGAGACGUGUGCAAAAGCGACUCUUCGGAGUCGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.072weak84.500.6950.347000000-4.1216000002.5144000000000000000000000000000000000000000000000000000000000000000000000000000
43
42SP U/A V1.4 V3
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4210509
GGAGGUCAGCACGUCUGCUCUCUGCUCUCGACACUUCCUCGUCGGAAACGACGUGGAGUGUCGAGAGAGAGAGCAGAGUGCUGACCAAAAGGAGCUCUUCGGAGCUCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.118weak83.500.7070.353-4.1217000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
44
43Fiskers UA variation D1
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4224372
GGAGCGAUUGACGUCAUGUUACUGCAGAUCUAGCUUCCAGCAUGGAAACAUGUUGGAGCUAGAUCUGAGUAACAUGAGUCGAUCGCAAAAGCUGAGGUUCGCCUUAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.398weak88.700.3620.181-0.37671.93141.04250.173500.173200000-0.36371.28090.17050-0.44820-0.44620.08520.17010.2544001.00750.167600.16740.33360000000.99091.1428000.16300.1627000.16250.24310.40350.16120.16090.16060.1604000.31970.15960-0.1260000000.15890000.316700.15810.15790.157600.15740000.15710000000-0.1290.33670.61781.1451
45
44Fiskers UA variation D2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4224387
GGAGCGAUUGACGUCAUUAGACUGCUGUAUAUCCUUCGAGCAUCGAAAGAUGUUCGAGGAUGUACAGAGUCUGAUGAGUCGAUCGCAAAAGCUAUGGUUCGCCAUAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.246weak78.400.2940.1471.18790.5441.341600000.26760000.13361.44860.5240000.2613000001.543700.256600.256000000.25531.01091.00080000.24960.249000.2483000.24770.24710000.246500000.2459000000000.245300.24470000000-0.38850.2435000000000.725200.4812
46
45Fiskers UA variation D3
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4224406
GGAGCGAUUGACGUCGUUAGACUGCAGACGAUCCUUCGUGCAUGGAAACAUGUACGAGGAUUGUCUGAGUCUGACGAGUCGAUCGCAAAAGCAUUGGUUCGCCAAUGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.405weak70.100.4240.2122.03291.46770.58370.2910.290100000002.5448000.2820.14080.1406000.28040.27960.55611.77520.136400.2720.27130000001.07340000.267600.2669000.26620.66110.91710.52130.26000.259300.25860.2580000000000000.25730.256600000.2560000.25530000-0.216200.50680.25280.5031.24180.515
47
46mlbp 1.4 Heavy
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4239339
GGAGGCUCAUCCGUCAGUGUACUGCGACUGGUGCUUCAUCACUGGAAACAGUGAUGAGCACCAGUCGAGUACACUGAGGGUGAGCCAAAAGCAGACCUUCGGGUCUGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.038weak83.500.8950.4476.05772.939800000000002.8559000000000000000000000000000000002.776600000000000000002.7017000000000000000000002.63062.563204.87654.6499
48
47Var 1.4 1
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4241922
GGAGCUAGAUGCGUCGAUAAGCUGCGAUACUAGCUUCGAUCUAGGAAACUAGAUCGAGCUAGUAUCGAGCUUAUCGAGCAUCUAGCAAAAGCUGAUGUUCGCAUCAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
-0.008weak83.501.8960.9480-99.962600000000000000000000011.42290000000000010.2523000000000000000000000000000000000000009.299300000000-50.00078.50847.84147.27156.7788
49
48UA v1.4 2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4246419
GGAGUAUAUAUCGUCAUAUAUCUGCAUAUAUAUCUUCGUAUAUCGAAAGAUAUACGAGAUAUAUAUGAGAUAUAUGAGAUAUAUACAAAAGUUGGACUUCGGUCCAACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.098weak85.600.4620.2311.15880001.145600000004.38150000000000000000000001.0835000001.0719000001.0605000000000000000000000000001.0494000000000001.038501.0279
50
49R. B.
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4252351
GGAGGUGGAUGCGUCUGGAUGCUGCGAUGGAUACUUCAGGAUGCGAAAGCAUCCUGAGUAUCCAUCGAGCAUCCAGAGCAUCCACCAAAAGGAAAGCUUCGGCUUUCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.082weak82.501.3220.66111.42295.4035.12610000009.299300000000000000000000000000000000000000000000000000000000000000000000008.50840000000
51
50BD2 - Brourd - MLBP U/A 1.4 R1 - Sub 2
SHAPE Profile - Most Likely Base Pair U/A - Variation 1.4
4275095
GGAAAACUAGACGUCUAUGUACUGCAUCAGUAUCUUCAGAUGUCCUUGGACAUCUGAGAUACUGAUGAGUACAUAGAGUCUAGUUUAAAAUAUCUGCUUCGGCAGAUAAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.267weak84.500.7860.3930.9771.37390001.355300001.33721.96634.38690000000001.23790000000000001.2228000000003.538501.16583.379200000000000000000000001.113900000000001.1016001.08962.13273.12.0248
52
51Reusedre
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4167138
GGAGGAGGCGGCAGGUAGAUGGGACGAGAGGGAGCCGAAUGGUGACGACACCAUUCGCUCCUUCUCGCUCAUCUACCGCCGCCUCCAAAACUUAGCCUUCGGGCUAAGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.123weak85.600.5080.2546.05770.39281.94090000001.90400.9432.751200000000001.80110000000000000000000003.4773.360200000000000000000000000000000000000001.652401.62550
53
52Diaena
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4167396
GGAGAGGAGAGCAGGAGGGAGGGACGGGAUAUAGCCGAGUAGGUGUGAACCUACUCGCUAUAUCUCGCCCUCCUUCCGCUCUCCUCAAAACUUGGGCUUCGGCCUAAGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.234weak72.200.5090.2550-0.74731.4835000.736300.73090001.44080.71520.71020.70510001.73230.34530000000000.6858000000000000000.6811001.34400-0.741700.667500-0.736300.663100000000.658700.654401.51943.65880.582101.15070000000000-0.690501.13772.2247
54
53Zariquisve
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4167643
GGAGGAGGGAGCAGAUUAAUAGGACGAGAGGAGGCCGGCGGUACAGGAGUACCGCCGCCUCCUCUCGCCUAUUAAUCGCUCCCUCCAAAACUUGAGCUUCGGCUCAAGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.12weak78.400.5640.282000000000001.41271.3930001.3739000000-0.7996-0.79320000000000000000000-1.561701.3553000001.337200-1.537700-0.37901.285600000001.269301.2534001.23791.222801.2080000000001.19362.3315
55
54Meechl MLBP CG 2
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4169147
GGAGUAAUUAGCAGAAUUACAUGACGUAUUAAUGCCGACUUAUCUAAUGAUAAGUCGCAUUAAUACGCAUGUAAUUCGCUAAUUACAAAAGUGAUACUUCGGUGUUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.488weak80.401.0580.5293.55380.88062.573900.85070000000000.84350000.836500000.82950000000.8227000.81600.8094000000003.88965.16431.45410.72180000000000000.71660000000.71150000000000.706500.7015000000.69671.37422.0197
56
55The Beauty of the Eagle
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4173679
GGACGAGUAUGCAGUUAAUGAUGACGUUAACAUGCCGUAGUAUCUUCGGAUAUUACGCAUGUUGACGCAUUAUUAACGCAUAUUCGAAAAGUCUGUCUUCGGACGGACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.467weak85.600.1710.0860.26340.33730.242300.080700.04660000.160901.50510.0792-0.11440.07910.15790.07890.078800.078800.07871.28290.07760.077500.0774000-0.114100.0774-0.03670.0773000.07720.15420000.03850.15390.03850.3830.229300.0764-0.113900-0.11380000.0763000.07630.1523000.07610-0.11360.15190-0.113500000.075900.075900.0758000-0.2636-0.0373-0.11290.33930.52460.5543
57
56
Mod 2 - Zanna s BooYah III (Variation 1) - Jieux - SHAPE Profile - Most Likely Base Pair C/G - Variation 2
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4181026
GGAGCACGCGGCAGGUGUGUGGGACGGUGCGCGGCCGUGCGUAUGAGAGUGCGCGCGCUGUGCACCGCCCGCACACCGCCGUGUGCAAAAGGUGUGCUUCGGCGCGCCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
1.086
medium
80.40.030.3290.180.65760.92520.3771-0.084-0.026700000.05710.17110.14240.65080.11310.11290.11280.11270.19680.08430.11220.05610.05610.0560.77820.221800.05540000000.05540.22110.02660.05520.1102000.08260.1650.19210.43711.24120.3960.10380.21380.42570.18180-0.0305000.0530.2380.026400.0529-0.03060-0.083400-0.083300.2109000.052700.15780.052600.052500.1050.1572-0.03080.05240.104600.26080.59040.32970.38550.89151.0585
58
57Pulling Hair 2 (C/G most likely bp v.2)
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4186554
GGAGCACUGAGCAGGUUAUCAUGACGAUCAUAUGCCGGUAUGACAAAAGUCAUAUCGCGUAUGAUCGCAUGAUGACCGCUUAGUGCAAAAGUAUCUCUUCGGAGAUACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.449weak79.400.3820.191-1.25711.12411.43470.238500000-0.3304000.945200000000.470400.23460.929800000.2319000.2314000.2308000-0.329300000.01681.13722.00521.09851.08650.10660.21590000.215400000.2150000000-0.3250000-0.3240.21450000.21400000.42630.4245-0.011100.21040.52341.83
59
58Pulling Hair 3 (C/G most likely bp v.2)
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4186561
GGAGCACUGAGCAGAGUAUCAUGACGAUCAUACGCCGGUAUGACAAAAGUCAUAUCGCGUAUGAUCGCGUGAUGCUCGCUUAGUGCAAAAGAAUGACUUCGGUCAUUCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.692weak88.700.4370.2180.85160.83271.51990.477700000.39650.2373-0.064800.93890.312-0.22220.15580.155500000.155301.22690.153100.1529000-0.2217000.15270.45590.15170.15150.15130000-0.22130.67621.91592.65421.27481.94440.41490000.1381000.1379000-0.220800000000-0.2203000000-0.2198000.13770.27470.13720.1370.1368-0.0289-0.08230.13591.34051.4073
60
59Real
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4187671
GGAGCUGACUGCAGGAAUCUAGGACGACUCGAAGCCGCUCGAGCGAAAGCUCGAGCGCUUCGAGUCGCCUAGAUUCCGCAGUCAGCAAAAGUCGAUCUUCGGAUCGACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0weak80.401.0980.54927.89788.508407.841403.77293.635700000000000000000000000000000000000000000000000000000000000000000000000000000012.697200
61
60SHAPE Profile - var2 - 1st
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4195436
GGAGAUAUAUGCAGAUAUAUAUGACGAUAUAUAGCCGUAUAUAGGAAACUAUAUACGCUAUAUAUCGCAUAUAUAUCGCAUAUAUCAAAACGUGAUCUUCGGAUCACGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.058weak86.600.3020.151-3.12342.78610000000001.37391.355300000000001.337200000000000000000000001.3195000000000000000000000000000001.302400000000006.1138
62
61SHAPE Profile - var2 - 2th
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4195441
GGAGAUGUAUGCAGAUAUGUAUGACGAUACAUAGCCGUAUGUAGGAAACUACAUACGCUAUGUAUCGCAUACAUAUCGCAUACAUCAAAACGUCGACUUCGGUCGACGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.053weak83.500.4440.22200002.10420000000000002.0608000000000000000000000000000000000000000000000000000000000000000000002.01921.9793
63
62spmlbpc/gv2
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4203027
GGAGGAGAGCGCAGGAGAGAGGGACGGCUGGAGGCCGGCCCAUGGAGACAUGGGCCGCCUCCAGCCGCCCUCUCUCCGCGCUCUCCAAAACCGACUCUUCGGAGUCGGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.107weak84.501.3320.666-1.859500000000005.71170000000000000000000000000000000000000000000000000000000000000000000000000000
64
63spmlbpc/gv2-2
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4203029
GGAGCACACGGCAGGUGUGUGGGACGGGUGCACGCCGGCCGUUGGAGACAACGGCCGCGUGCACCCGCCCACACACCGCCGUGUGCAAAACCGAGUCUUCGGACUCGGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.02weak85.600.1870.0941.00E-0402.93980000000000000000000000000000000000000000000000000000000000000000000000000000000000000
65
64SP C/G V.2 V1
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4208804
GGAGCUCGUAGCAGCAUCGAUGGACGAUCGUACGCCGCAUGCUCGAAAGAGCAUGCGCGUACGAUCGCCAUCGAUGCGCUACGAGCAAAAGGUGCUCUUCGGAGCACCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0weak81.401.8190.9090000000000000000000000000000000000000000000000000000000000000000000011.422900000000000000000010.2523
66
65SP C/G V.2 V3
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4212801
GGAGGUCCUAGCAGCUACCUCGGACGAUCCUGUGCCGGAUCCUCGAAAGAGGAUCCGCUCAGGAUCGCUGAGGUAGCGCUAGGACCAAAAGCAGGACUUCGGUCCUGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.124weak83.500.6890.3442.514400000000001.24161.22640002.39410000004.569500000000000000000000000000000000000000000000000000000000000002.233702.1849
67
66mod of Hyphema s pulling hair
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4215900
GGAGCACUGAGCAGAGUAUCAUGACGAUCAUACGCCGGUAUGACGAAAGUCAUAUCGCGUAUGAUCGCGUGAUGCUCGCUUAGUGCAAAAGAAUGGCUUCGGCCAUUCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.573weak90.700.3010.151.71081.0980.43730.145500000.145300.14510.28941.14440.28530.142400.10150000001.94970.13910.27740.138500000-0.182200.41380.41210000000.137200.34170.34060.47451.00660.134000.13390.1337-0.0484000000000000.13330.133100.13300-0.18160.13280.13260-0.181200000.264500.1321-0.09770.2946-0.04891.35391.1565
68
67mod of Janelle s Beauty of the Eagle
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4215912
GGACGAGUAUGCAGUUAAUGAUGACGUUAACAUGCCGUAGUAUCUUCGGAUAUUACGCAUGUUGACGCAUUAUUAACGCAUAUUCGAAAAGUCCGGCUUCGGCCGGACAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.118weak82.500.1880.0941.06330.35320.351900.350700.3495000001.03760.34470000.3435-0.410600000.680.67540000.3365000000000000000000.9995000000.3321000000000-0.7473000000000000000000000000.65980.98
69
68Fiskers CG variation D1
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4227050
GGAGCGAUUUGCAGACUUAGAUGACGUUCGAUGGCCGCUGCAUCGAAAGAUGUAGCGCCAUUGAACGCAUCUGAGUCGCAGAUCGCAAAAGCUUAGGUUCGCCUGAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.528weak88.700.2780.1392.25421.2641.6167-0.083700.12410.24750-0.20750000.85880000000000.15971.32670.1205000000.12030.2401000.390.71080-0.20620.1183000.1182000.11810.35290.410.2920.23310000.232500.116100.347200-0.205800.11560.02530.11520-0.0899000000000.11490-0.20450.2293-0.2041-0.20370.2288000.11430.114100.70160.8968
70
69Fiskers CG variation D2
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4227072
GGAGCGUAGUGCAGUACUAUCAGACGUUCGACAGCCGCAGCAUCGAAAGAUGUUGCGCUGUUGAACGCUGAUGGUACGCAUUACGCAAAACGUAUGGUUCGCCGUACGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
1.317
medium
91.80.0230.2530.1380.5990.35450.86060.26190.1308-0.01220.05810.0290.1470.0290.1590.24510.81520.07150.08570.00140.01430.042800.0014000.11391.2930.11230.0561000.05610.056400.028000.40450.20870.05560.02780.0278-0.0278000.0555-0.05550.12480.31790.17940.28890.027000.08240.02750.08230.082200.026700.02740.04110.15030.02730.05460.08090.08180.02720.1089-0.02820.0272-0.08350.08150.0272-0.02820.08140.0542-0.02820.0271-0.028200.05420.1082-0.055200.02590.1080.40180.68071.3691
71
70Fiskers CG variation D3
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4227093
GGAGCGUAUUGCAGCAUGACAUGACGUAUCAAUGCCGCAGCAUGGAAACAUGUUGCGCAUUGAUACGCAUGUUAUGCGCAGUACGCAAAACGUGAGGUUCGCCUUACGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.515weak85.60.0250.2710.148-0.13380.6874-0.20460.19510.0974-0.51720-0.17210.09730.387900.19361.1650.19060.0952-0.0764000.04750.04750000.848100.09410.09410000000.0940.37440.46590.13960.046500.09290000.2780.1060.64270.2747-0.07950.31910.13660.0910.09090.09080.09070.18110.09050.090400.090300.0902000.0902000.180-0.17060.08990.1795000.089700.08960000.08950.089400.089300.0080.26690.26611.0968
72
71CG Var 2 1
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4241963
GGAGCUAGUAGCAGAUGAUCUAGACGAUCUAUCGCCGCUAGAUCGAAAGAUCUAGCGCGAUAGAUCGCUAGAUCAUCGCUACUAGCAAAAGCUAGUGUUCGCACUAGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.022weak86.600.5680.2842.514402.45282.39410000000000000000000000000000000000002.3381000002.284700000000000000000000000000000000000000004.3699
73
72CG Var 2 2
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4241969
GGAGCUAGUAGCAGAUGAUCUAGACGAUCUAUAGCCGAUAGAUCGAAAGAUCUAUCGCUAUAGAUCGCUAGAUCAUCGCUACUAGCAAAAGCAAUCCUUCGGGAUUGCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.076weak80.401.7030.8520020.5045000009.29934.44314.25420000000000000000000000000000000000000007.84140000000000000000000000000000000000013.55750
74
73CG V2 2
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4246445
GGAGUAUAUAGCAGUAUAUAUAGACGAUAUAUGGCCGCAUAUAUGAAAAUAUAUGCGCCAUAUAUCGCUAUAUAUACGCUAUAUACAAAACGUAAACUUCGGUUUACGAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.318weak78.400.380.190.02660.4491.669300.4156000.4139000.41220.81760.00890-0.3966-0.3951-0.3935000.20320.2027000.804500000000000.400600000000000.3990.39740.7886000000000-0.392000000000.3928000.391200000000000.389700.38820.7704002.2591.4837
75
74Leah
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4252572
GGAGCUACAUGCAGCGAUGUACGACGACAUGUGGCCGCAUGUACGAAAGUACAUGCGCCACAUGUCGCGUACAUCGCGCAUGUAGCAAAAGGUGUGCUUCGGCACACCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.126weak78.401.5350.768002.5144000000000000000000000000000000000000000000000002.4528000000000000000000000000000000002.39410-1.48812.23372.1849
76
75MLBP Var 2 Sub 1
SHAPE Profile - Most Likely Base Pair C/G - Variation 2
4276523
GGAGGCCCUAGCAGUAGCUAACGACGUACCUAUGCCGUACUUCAGAAAUGAAGUACGCAUAGGUACGCGUUAGCUACGCUAGGGCCAAAAGAGCUGCUUCGGCAGUUCAAAAGAAACAACAACAACAAC
...(((((((((.((((((((((.((((((((((..((((((((....)))))))).)))))))))))))))))))))))))))))....(((((((....))))))).....................
0.014weak80.400.2870.1441.2732-3.57431.22640000000000001.211600000000000000000000000000000000001.19711.1829000000000000000000000000000000000-5.71173.42710
77
76JR_ShapeCGVar_Sub1
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4165742
GGCAUUGGAAACAAUGCCAAAAAGUUAUGCCGUAUUGGAAACAAUACGCAUAACAAAAGACAUACUUCGGUAUGUCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.986weak83.100.8470.4240.66660.11940.4640000.11850.29530.38660.46670.580.1159000.1157-0.374-0.18670.08891.21681.48730.8432.36562.10530.21010.20960.104700-0.18390.10460.31280.2081-0.1836-0.1832-0.0789000.31090.66910.3590.71290000.2033000.202800.10130.07012.54990.41481.33982.24752.10131.39210.97140.74330.4371-0.17830.52180.86210.51460.7661.83810.33310.57951.46830000000000000000000
78
77Best shot!
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4169027
GGAUAUAACAAUAUAUCCAACAAUAUAUGCCGAUAUAACAAUAUAUCGCAUAUAACAAAAUAUAUUUCGAUGUAUUAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................2.973
medium
800.1371.5020.8190.23430.06820.2150.13770.3640.61792.07832.14721.15831.34761.84630.8480.21780.2268-0.01760.3070.22510.11690.91570.90651.00840.83611.28440.52060.25340.10120.05060.05660.20180.50740.49920.16010.01070.19860.39560.61432.18713.25531.56071.6172.76961.83960.14660.04270.04270.04270.0426-0.04560.04260.08350.14870.14850.18870.8761.58131.0531.82111.74930.67841.28370.42821.14530.92151.32741.13011.94831.39110.48181.2530000000000000000000
79
78Meechl MLBP CG 2B
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4169156
GGGUUACUAACGUAAUCCAACAAGUAUUGCCGUAAUCUAAUGAUUACGCAAUACAAAAGAUAAACUUCGGUUUAUCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................1.434
medium
93.80.1021.1920.647-0.28720.07260.07230.111300.11120.56733.46422.03620.67420.97790.102400.10230.20430.40690.0531-0.0991.44981.38050.62591.96051.55350.0941-0.05480.0939000.28090.46590.46380.03660-0.20380.18470.09221.04965.06893.63242.08491.37090.24130.08040.08030.2404000.160.079900.6354-0.12580.02160.47131.81251.92890.52931.47840.22090.43990.29240.50740.35780.35950.14360.74380.24440.28270.56220000000000000000000
80
79Zazaenan
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4171431
GGACCGCAGAAGCGGUCCACAAACCUAUGCCGUACUCAGAAGAGUACGCAUAGGAAAACCUUGGCUUCGGCCAAGGAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.231weak81.500.9150.457-2.5145-1.241600.44270.440800.65681.50951.70421.24040.41180.81681.21040.40180.40020.398600.39711.177101.54530.76670.38190000000000-1.211600.7580.75231.48233.39914.071.00730.3346000.33350000.332400.6604-1.1829000.98091.29100.64140.31970.318600.31760.316600.31560.62730.62341.23142.10960000000000000000000
81
80Beinus
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4171758
GGAGGGCCGUCGCCCUCCAAAACCUUAAGCCGCUCUGUACUCAGAGCGCUUAAGAAAACUCUCGCUUCGGCGAGAGAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................1.263
medium
90.80.0720.8380.455-0.2355-0.72160.081800.24480.48720.16210.96350.95430.39610.86380.431.50180.11540.03840.23020.30590.04470.98150.9350.72291.2450.2921-0.056800.14570000.3630.433700.0722000.01460.57373.8611.5611.14070.93270.33080.03310.09910.1320.06590-0.0634000.1316000.32951.29341.15061.0750.50340.56310.06250.1872000.06240.21781.58380.51720.42421.07890000000000000000000
82
81MLBP-CG_2B_a
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4181619
GGUACUCGAAAGAGUGCCCAAAGCGGUCGCCGCAAUCGAAAGAUUGCGCGACUGGAAGCUAUUUCUUCGGAAAUAGAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................1.28
medium
92.30.0350.5050.270.10490.11170.1169-0.12220.03890.07780.01670.05830.96180.24940.2787-0.04210.13350.1333-0.08020.0340.26560.18940.99371.31371.13421.23770.4050.14350.17910.0716000.03580.35650.3906-0.0090.035500.03550.035400.14160.59810.35060.38420.02480.03490.06970-0.1596-0.0449-0.04480.03480.03480.02470.10420.05210.44491.0971.28290.79420.48780.14890.22440.0660.39420.29480.09820.13071.08370.48220.19340.46270000000000000000000
83
82
Adapted 98% Zanna s BooYah III (version 1) - Jieux - SHAPE Profile - Most Likely Base Pair C/G - variation 2B
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4183530
GGGCGCCGAAAGGUGCCCAAUAAGGGCGGCCGGCUGUGAGAGCGGCCGCCGUCCAAAAGGACUCCUUCGGGAGUCCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................2.224
medium
90.80.0380.4230.231-0.0529-0.03770.00330.0429-0.023200.00160.03970.47190.23830.1410.0250.02790.03910.13280.0526-0.06630.11760.65191.010.76310.82950.2626-0.00570.045-0.02820.0300.0150.47740.10590.08930.03440.12620.16140.17880.3791.27080.54880.48970.45790.0723-0.01380.0430.0154-0.01380.01430.01420.02850.05030.29120.40970.05650.0850.74180.86670.94810.25350.21880.10860.08190.16350.12250.0680.10820.31090.14770.37690.1870000000000000000000
84
83Pulling Hair 4 (C/G most likely bp v.2b)
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4187641
GGCUAUCGAAAGAUAGCCAACAAGCUCAGCCGUCUACGAAAGUAGGCGCUGAGCAAAAGAGCAUCUUCGGAUGCUCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.835weak86.200.5650.2820.87410.24880.0860.2476-0.07940.0824-0.16160.08520.36850.52940.04070.122-0.079800.08120.081100.24310.96010.79380.7831.24240.77050.23060000.03840.11510.45840.22030.22780.15170000.07580.22680.36630.44920.447200.0745000000-0.0055-0.5288-0.03691.15070.59372.1971.22091.22311.20830.7330.26580.1990.06630.63450.32770.78040.6520.35350.76550.38130000000000000000000
85
84Pulling Hair 6 (C/G most likely bp v.2b)
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4187646
GGCUAUCGAAAGAUAGCCAACAAGCUCGGCCGACUACGAAAGUAGUCGCUGAGCAAAAGACGUUCUUCGGAACGUCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.704weak90.80.0510.5640.3080.1878-0.02480-0.25990.07460.0745-0.1610.06240.81150.07370.11050.03680.147-0.12380.0734-0.12350.1466-0.12340.69121.13290.97650.9641.11070.20780.06920-0.3174-0.15850.17280.44720.27440.1370.068500.06840.06840.06830.17050.62010.47160.536-0.0910.20050.06680.10010.033300.06660.066600.0998-0.2213-0.31660.10751.99560.89871.19391.6075-9.00E-040.1840.24470.18320.42570.18210.12131.58130.32710.17810.26030000000000000000000
86
85Nice
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4187681
GGUAUUCGAAAGAAUACCAAAAAGCUAAGCCGACAUCGAAAGAUGUCGCUUAGCAAAAGAUGAUCUUCGGAUCAUCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.431weak89.20.0090.5890.299-0.7936-0.06160.27140.13550.13530.270.13480.33590.33470.26710.3990.1328-0.332600.132600.26460.52641.93580.76841.26450.93940.56050.24850.124100.1239000.30890.43060.1229-0.331500.122700.12260.12240.60840.24280.12120.12110-0.33040000-0.208400.6011-2.43811.20230.63821.26030.64971.61870.88510.22080.87550.1093-0.09570.43440.11970.43070.58870.47930.63510.63110000000000000000000
87
86SHAPE Profile - var2B - 3th
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4195460
GGGUCAGGAAACUGACCCAGAAAGACGUGCCGUAUCGGAAACGAUACGCACGUCAAAAGCGUAGCUUCGGCUACGCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................1.087
medium
95.40.0630.6980.3810.8251-0.01790.10350.22460.22410.0746-0.08410.26041.0310.47640.32870.0730.07290.07290.21820.29010.1810.541.27941.8831.88181.64890.87810.26580.066400.06640.13260.13240.46120.5895-0.1212-0.1210.0655-0.0554-0.12070.13060.00990.71250.26670.64110.25580.063900.0639-0.12030.1276000-0.1201-0.11230.0710.5781.43211.59040.93920.870.1196-0.05910.11930.11924.00E-040.35590.35471.01810.43590.69250.57380000000000000000000
88
87spmlbpc/gv2b
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4203083
GGGCAGGGAAACCUGCCCAAGAAGCAUGGCCGCUCUCGAAAGAGAGCGCCAUGCAAGAGGCACUCUUCGGAGUGCCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.08weak63.100.9750.487-1.6288000-3.028800.741700.736300.7309000-2.9398000.725604.83381.36232.00251.31741.300300000.6460.64180.6377000-2.22221.25150.62190.6180000-2.776600.6142000000.6105000.606801.1991.18481.17090.582101.15070.57210.56881.12491.65932.1645-2.16344.62032.01220000000000000000000
89
88Likely CG var 2B
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4218781
GGGAUGCGAAAGCAUCCCGAAAAGUAUCGCCGCAUGCGAAAGCAUGCGCGAUACAAAAGCUUUGCUUCGGCAAAGCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.435weak89.200.6190.311.2462000-0.5175000.25140.995800.112100.2471000002.05722.70791.84890.68861.3585000.22590000.33770.11240000.22440.223900.22340.22290.66421.09490.05420000.217500000000.64840.43041.48411.25610.83050.20721.02530.20460.20420.20380.40600.60530.80060.79421.17730000000000000000000
90
89Var 2B 1
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4241998
GGGCAUCGAAAGAUGCCCGAAAAGCUACGCCGCUAUGGAAACAUAGCGCGUAGCAAAAGCUUCAGUUCGCUGAAGCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.538weak87.700.7070.3543.1552-0.0966-0.096-0.3183000.12730.77211.41360.32510.5390.21510.42840.21380.4257-0.1039003.48491.41470.68510.39860.3970000000.78770.78150.19500.19460000.26620.7680.57270.75790.1891000000000-0.12460.18840.93321.38041.00220.76911.2460.35470.74160.34980.34860.1740.34670.34561.69840.33850.83921.17770000000000000000000
91
90CG V2B 2
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4246451
GGGCUACGAAAGUAGCCCAUAAAGUAUGGCCGCAUAGGAAACUAUGCGCCAUACAAAAGUUGUUCUUCGGAACAACAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.429weak89.200.680.34-1.55650.2300.315300.626700.31230.62081.67860.75720-0.20090.10150.30110001.62891.88871.43211.13272.2152-0.123300000.27540.27460.273900.273100000.14552.12690.26520.78920.262400.26170000.26100.260300.25970.12970.64410.87560.36270.99970.49740.984900.73330.2438000.48530.72270.47950.23920.71240000000000000000000
92
91Salt
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4253202
GGGCACGGAAACGUGCCCACCAAGCUACGCCGCAUGCGAAAGCAUGCGCGUAGCAACAGCGAGCCUUCGGGCUCGCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.181weak64.601.2090.605-0.9982003.028901.4919001.469900001.44870001.4280001.40792.73870000001.350800000001.33281.3153001.298301.28160-1.0199-1.009600000002.49921.2342001.219101.204503.70113.29595.20730.09951.00995.71355.40480000000000000000000
93
92mlbp var 2 Bases
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4257888
GGGUAUCGAAAGAUACCCAAGAAGCCAGGCCGUGCUCGAAAGAGCACGCCUGGCAAAAGGGAUACUUCGGUAUCCCAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................0.738weak76.90.0790.9370.5081.0760.1856000.00840.092400.36840.73140.190500.27160.45050.26960.08980-0.26710.00450.5331.40141.72161.52581.00690.16750-0.26490000.74830.08310.1659000.3949000.16450.65370.16320.48710.80530.160800.32060.160-0.263600-0.26290.95110.10711.09061.68491.50870.74871.25681.2681.43510.42870.70940.42380.56192.39951.41930.93731.9691.42340000000000000000000
94
93Fiskers Variation 2B D1
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4259528
GGUCAUCGAAAGAUGACCAUAAAGCAUGGCCGACAUGGAAACAUGUCGCCAUGCAAAACUGAAGGUUCGCCUGCAGAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................1.979
medium
93.80.0550.6090.3321.29870.2112-0.1633-0.1143-0.03450.06940.17290.18970.6270.32810.2549-0.00810.19030.01480.16260.1623-0.00770.23791.90131.78950.99471.02870.7330.05030.07540.07530.02510.10030.06270.6350.32270.07440-0.01980.0496-0.06430.04950.27350.72650.24840.4654-0.15310.0728-0.02010.02420.024200.024200.00410.02420.00410.02830.20871.33391.04630.88760.75130.11940.20720.28690.76430.30650.35160.24810.84980.33430.54321.06210000000000000000000
95
94Fiskers Variation 2B D2
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4259531
GGUGUACGAAAGUACACCAUAAAGCUAGGCCGUCGACGAAAGUUGACGCCUAGCAAAACUGAUGGUUCGCCAGCAGAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................3.555
medium
93.80.0340.3840.2090.3628-0.05440.01390.01390.03410.03060.04420.06160.5870.30260.41510.14020.01970.01330.07980.06310.03610.11251.28691.1480.83820.52160.4363-0.0020.0254-0.00770-0.00170.0750.34120.30070.05040.0157-0.00710.02280.01260.03140.06120.42320.24840.39940.08090.0310.00430.00530.01760.02380.04330.0186-0.02660.03710.01050.06030.03821.07570.5540.48720.40240.03050.10660.13470.17930.04510.1060.12690.5390.20980.390.69980000000000000000000
96
95Fiskers Variation 2B D3
SHAPE Profile - Most Likely Base Pair C/G - Variation 2B
4259534
GGUAGUCGAAAGACUACCAUAAAGCUCAGCCGACUACGAAAGUAGUCGCUGAGCAAAAGUGAAGGUUCGCCUGCACAAAAGAAACAACAACAACAAC
..(((((....))))).......((((((..((((((....)))))).))))))....(((((((....))))))).....................1.341
medium
90.80.040.460.25-0.0780.1441-0.04730.0770.057500.05740.14820.66890.15050.20230.15030.0796-0.01010.01810.16880.00770.18591.66721.11820.95790.66930.5458-0.03960.07970.02660.02660.02660.10610.11920.1850.0131000.0396-0.0528-0.03960.15810.20950.39230.77850.01190.0518-0.0140.06360.0259-0.131400.051700.0258-0.0140.10320.33430.81630.74410.70020.74140.4820.14810.25460.61440.12550.16580.06840.4590.12070.56390.70290000000000000000000
97
96Low Energy
GGG/UCC Wobble Closing Base Pairs - Hexaloop RE
4163119
GGAAAAACAAUUCUCAAUUGGGAAAAAGUCCAAUUGCGAAUUAAAAAAUCAAUGCGUUAAGGGAAAAAAUCCUUAACACAUUGCAAAAAACUUGAAUUCGUUCGGGUAAAAGAAACAACAACAACAAC
........((((((((((((((......)))))))))))))).......((((((((((((((......))))))))))))))......(((((((....))))))).....................
2.165
medium
91.70.0961.3550.7251.00531.65731.35631.11761.38380.75051.07990.67040.20070.33340-0.0493-0.14770.13320000000.26573.08962.87582.08131.27960.96721.00621.47472.89700.112900.11280.1126000.2248-0.09810.11230.01410.01410.58262.3953.45292.351.85521.14011.07871.1631-0.19480.0968-0.09730.096700.09660.09570.0964-0.09710000.28832.16233.87533.82062.20780.67470.58691.8920.73490.1630.1628-0.09690.081300.08130.06540.0405-0.1836-0.09640.242200.46571.5252.15951.14371.76022.3051
98
97JR_GGG-UCCHexa_Sub1
GGG/UCC Wobble Closing Base Pairs - Hexaloop RE
4165712
GGAAAAACCAGAUUUUGAUGGGAAGAAAUCCAUCAACAUCUGAAAGAAUCACAACAACAUGGGAAAAAAUCCAUGUUAUUGUGCAACAACAGUUACUUCGGUAACUGAAAAGAAACAACAACAACAAC
........((((((((((((((......)))))))))))))).......((((((((((((((......))))))))))))))......(((((((....))))))).....................
0.954weak90.601.0140.5071.07841.93711.14890.76011.49750.373000.3716000.370200-0.44650.146100000.36750.50744.19421.37881.80451.33290.98980.98010.6491000000000.323500.322500.32142.20063.04791.20452.35233.40830.34360.2816000000-0.220800.56010000.27932.98044.65032.76332.92641.20461.4250.70751.16540.23250.232000.231500.23090.68800.00850.45550.227201.12351.1110.66220.43950.655
99
98Meechl GGG UCC WCBP HexRe
GGG/UCC Wobble Closing Base Pairs - Hexaloop RE
4169262
GGAAAAACGAACAUCAUAAGGGUAAAAUUCCUUAUGCUGUUCAAAUAAUCAUGUCGUUAUGGGAAAAAAUCCAUAACAACAUGCAAAAAGUAUGAGUUCGCUUAUACAAAAGAAACAACAACAACAAC
........((((((((((((((......)))))))))))))).......((((((((((((((......))))))))))))))......(((((((....))))))).....................
1.077
medium
93.800.8240.412-0.3522.05771.01841.80010.59640.98430.19650.39140000.3899000.1946000000.19422.03221.31092.10831.35630.71820.71311.75150.6957000000000.1736-0.2444000.17330.1732.03411.83050.82521.62350.40140.32160.160500000-0.08290000.160-0.08282.03473.03532.08051.75211.01170.57481.41660.87860.0190.0190.1395-0.34120000.277800.138700.27670.27592.48862.04250.39380.79940.3882
100
99Xereria
GGG/UCC Wobble Closing Base Pairs - Hexaloop RE
4173229
GGAAAAGCGUAGAUGAGUCGGGCAAAUAUCCGACUCCUCUACAAAAUAUCGGAGCGUAGUGGGAAAAAAUCCACUACACUCCGCAAAAAUGGGACCUUCGGGUCCCAAAAAGAAACAACAACAACAAC
........((((((((((((((......)))))))))))))).......((((((((((((((......))))))))))))))......(((((((....))))))).....................
0.427weak85.400.5710.2850.0938-0.374300.9330.46430.46220.91591.3553000000.4497000.44770.44570000.44380.441800.43980.8720.86450.43040.4285000000000000.426702.69881.02740.40930.40761.2080.7989000000000000000.79261.9432.64810.37690.37550.37410.74260.369900.368600000000.36720000.7291.791.06261.3970.6937
Loading...
Main menu