Rawls Lab Primer Stock Database
Comments
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
$
%
123
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
ABCDEFGHIJKLMNOPQRSTUVW
1
Primer NameNucleotide Sequence (5'-->3')Description
2
SJ_gtyping_001Ldlr_sa16375_F1AGGAATCAACTGGTGCAGGA
3
SJ_gtyping_002Ldlr_sa16375_R1
AAAAATTTTGAATGTAGGAATCGGTA
4
5
SJ_gtyping_003Dgat2_sa13945_F1AAACCTGTCCCATTCATCATCAPCR failed
6
SJ_gtyping_004Dgat2_sa13945_R1ACAACACGCACCCTAGATGAPCR failed
7
8
SJ_gtyping_005
Srebf1_sa18770_F1
AATTTTGTCATTAAAAGGCTTTAGCAPCR failed
9
SJ_gtyping_006
Srebf1_sa18770_R1
TAAAGCAATGTATTAACCGTTGACPCR failed
10
11
SJ_gtyping_007
Cyp7a1a_sa19734_F1
TCTGAATGGCAAAGTGATGG
12
SJ_gtyping_008
Cyp7a1a_sa19734_R1
AGTCTTGGCAAGTTTCTCACG
13
14
SJ_gtyping_009
Creb313_sa18218_F1
CCCAATTTTTGGCGTTTTTPCR failed
15
SJ_gtyping_010
Creb313_sa18218_R1
TGCCACCTATAAGTGCGTTGPCR failed
16
17
SJ_gtyping_011
Slc27a4_sa13961_F1
GCTTAGCGAAGGGTCAGTTG
18
SJ_gtyping_012
Slc27a4_sa13961_R1
CAGCCATGCGGTAATACCTA
19
20
SJ_gtyping_013
Creb313_sa18218_F2
TCCATTGATTCCCTCTGACA
21
SJ_gtyping_014
Creb313_sa18218_R2
TGCACCCTTATTTGTCACCT
22
23
SJ_gtyping_015
Sema3bl_sa21309_F1
TTCTGGGATTTGCTAATCTGTT
24
SJ_gtyping_016
Sema3bl_sa21309_R1
TTTCTCAAAAGCAATGCAAGA
25
26
SJ_gtyping_017Pcks1_sa9109_FCCGTGGCTTCTTCCGTAG
27
SJ_gtyping_018Pcsk1_sa9109_RGGACACCATGAATGGGAGAA
28
29
SJ_gtyping_019Sspn_sa2992_F1TCACCAACAGACTCTGAGATGC
30
SJ_gtyping_020Sspn_sa2992_R1TCAGTGCATGGAAATCCTCA
31
32
SJ_gtyping_021Mtif3_sa8213_F1TACCACTGCCAACAAAACCA
33
SJ_gtyping_022Mtif3_sa8213_R1GTGCTTCACACCCAAATCCT
34
35
SJ_gtyping_023Nrp2a_sa13721_F1GGTACAGATAAATGGAAAACACCAPCR failed
36
SJ_gtyping_024Nrp2a_sa13721_R1GCAACTGTCTCACCTTGTGGPCR failed
37
38
SJ_gtyping_025
Map2k5_sa3631_F1
ATCTCACTGTCTCCCCCACA PCR failed
39
SJ_gtyping_026
Map2k5_sa3631_R1
CACTGGTATGAAGCCTTTTCCPCR failed
40
41
SJ_gtyping_027
Slc27a2_sa23199_F1
CTTTAGGGTCAGCGTGATCTG
42
SJ_gtyping_028
Slc27a2_sa23199_R1
CCCAACACTGGTCATGGTC
43
44
SJ_gtyping_029Dgat_sa13945_F2GGAACAAGCATTCCTGTAACATT
45
SJ_gtyping_030Dgat_sa13945_R2GCGTATTGAATAAGGCAGCAG
46
47
SJ_gtyping_031sspn_sa2992_F2ACCAACAGACTCTGAGATGCAC
48
SJ_gtyping_032sspn_sa2992_R2GCATATCAGTGCATGGAAATCCT
49
50
SJ_gtyping_033
map2k5_sa3631_F2
AGATCTCACTGTCTCCCCCAC
51
SJ_gtyping_034
map2k5_sa3631_R2
CTGGTATGAAGCCTTTTCCCTG
52
53
SJ_gtyping_035nrp2a_sa13721_F2AAGGGAACTAAATTCGGTGCG
54
SJ_gtyping_036nrp2a_sa13721_R2TGTGGGTCTTACCTTGTGGTTT
55
56
SJ_gtyping_037
srebf1_sa18770_F2
ATGGGGACGGGGTAAAAAG
57
SJ_gtyping_038
srebf1_sa18770_R2
CAGACAGAGTGTGGGGAAGC
58
59
SJ_gtyping_039
sema3ab_sa23237_F1
TGATTTTCTTTCAGACACATCAAC
60
SJ_gtyping_040
sema3ab_sa23237_R1
ACTTACCGTGCCAGGTCTTG
61
62
SJ_gtyping_041Neto1l_sa11404_F1TGATCTACTACTTCTGCGTCCTG
63
SJ_gtyping_042
Neto1l_sa11404_R1
CCGTGGTTGCTTGATTTGAACA
64
65
SJ_gtyping_043col5a1_sa6663_F1CATGTGTGTGTGTTGAAACAGG
66
SJ_gtyping_044col5a1_sa6663_R1AACAAAAATGGCAGGCAGAT
67
68
SJ_gtyping_045
col5a2_sa13820_F1
CCCTCAGAGGATGAGTTGAGC
69
SJ_gtyping_046
col5a2_sa13820_R1
TGAAGGTTTATTCTGGTGCAGTCT
70
71
SJ_gtyping_047
Sema3c_sa15161_F1
ACAAGTTTCTGTTTGTGTCTGTGG
72
SJ_gtyping_048
Sema3c_sa15161_R1
TGCAGACAACCGCAAAATGAG
73
74
SJ_gtyping_049
col5a1_sa23852_F1
TTTGTCATTTAAGGGGAGAGGC
75
SJ_gtyping_050
col5a1_sa23852_R1
TCTCTCTAGGTTTACCTTGGGTCC
76
77
SJ_gtyping_051
SDCCAG8_sa15931_F2
ACGCTAGTGGCCCAGAAATC
78
SJ_gtyping_052
SDCCAG8_sa15931_R2
CACCACTCTTTTCGTGCTGC
79
80
SJ_gtyping_053Alpk1_sa20845_F1GACTGTTTGCGAGGCATTAAC
81
SJ_gtyping_054Alpk1_sa20845_R1TTGATTCCTTGGATCGACAA
82
83
SJ_gtyping_055Sh2b1_sa13668_F1GATGATCGGTTGGTCTGAGATTG
84
SJ_gtyping_056
Sh2b1_sa13668_R1
TGGAGCTCACAGAACTCGGTC
85
86
SJ_gtyping_057Prkd1_sa6481_F1CCGATAGAGCTGGACAAGATCC
87
SJ_gtyping_058Prkd1_sa6481_R1GAATCAGAAGGGATTTAGATGAGGC
88
89
SJ_gtyping_059Cebpa_sa18352_F1GCGATCGAGGGAAATCCAAG
90
SJ_gtyping_060
Cepba_sa18352_R1
CATGGCTTTGACAAACGAGC
91
92
SJ_gtyping_061Furinb_sa14482_F1TGTCTCGTCTTCTGCAGGTC
93
SJ_gtyping_062
Furinb_sa14482_R1
GTGCAATCCTTTCAGCCTCC
94
95
SJ_gtyping_063
Sema3ab_sa23237_F2
AGCATGATAATTGTGTTTTAGGTCC
96
SJ_gtyping_064
Sema3ab_sa23237_R2
GATGTACATTAGCTCTGAATGGC
97
98
SJ_gtyping_065rlna_sa15534_F1TGCCACTGACTCAAATCTCCC
99
SJ_gtyping_066rlna_sa15534_R1GCAGAAAGAAGTAGACACACAC
100
Loading...
 
 
 
SJ gtyping primers