R72 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79E1E2E3E4E5E6E7E8E9
2
1First link in long chainBall & Chain by Krobar2725455
GGAAAUAAGGAGCACCAGGAGGACCACGGAAAAGAAAAGAAGAAACGAGGACCGCCAGGAGCACCAAAGUAUCUCUUCGGAGAUACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
3.127
medium
94.70.0560.8950.4750.44212.0561.85551.9612.07021.02221.55280.2925-0.04690.26620.8610.34140.1660.36730.07480.1660.12820.1901-0.01710.16090.17320.37551.12750.0680.09750.05960.0380.30610.81072.05791.61612.01711.03041.94911.97561.6131.04140.75421.77561.35290.4780.26820.61030.61290.33950.1144-0.02430.16830.01650.09190.59620.16770.00870.5430.18140.05620.16370.0744-0.01210.39290.113-0.0790.26310.09820.1390.74260.55150.84880.14350.08330.0233-0.0012-0.06210.07110.37860.76690.16870.15660.39380.50560.50060.42230.42110.40460.31210.32920.19240.143
3
2Symmetric asymmetry 3Ball & Chain by Krobar2732667
GGAAAUAAGCAGUGGUGGCGACAACAGCGAUAAAUAAAUAAUAAAGCAGUGGUGGCGACAACAGCAAAGUCCUACUUCGGUAGGACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.372
medium
93.30.0640.9810.5220.95471.56161.22992.42792.2331.42781.18261.24070.55270.40891.06021.40220.38520.69110.74250.04530.5625-0.00120.07460.5670.27570.29340.7660.50170.09030.53330.1606-0.00120.46620.84870.8961.17460.97531.18031.17431.05451.10240.87460.75251.29631.26240.77010.99490.62920.85540.30080.20320.58190.80350.20080.55720.33270.13380.28760.10880.0290.45260.38410.18780.62660.46090.23940.4030.24010.11840.53030.48820.44150.05840.05970.0582-0.0349-0.00320.06380.00160.60090.16910.32440.30550.42530.3360.30370.33730.31780.26740.24520.22860.1521
4
3HandcuffsBall & Chain by Krobar2803002
GGAAAGAAGCACGAGGAGCAGCACCACGGAAAGAAAAGAAAGAAACGAGGAGCAGCACCACGAGCAAAGCAUAACUUCGGUUAUGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
3.334
medium
94.70.0850.9430.5141.03470.7191.39141.79240.7151.5241.23351.54850.18240.13720.35470.03960.31340.23310.11270.22620.59480.50360.31490.22160.11830.09410.52930.14880.1480.1336-0.14230.22220.77191.84241.9051.29631.68771.99821.60891.81240.50452.11461.73011.27290.46090.72970.78770.69340.3262-0.0175-0.01410.22080.0950.10350.60150.26120.27480.2310.16920.04390.27140.1150.13980.17820.05180.1760.37060.25580.13320.58820.58440.74690.2921-0.00710.08480.0464-0.062-0.04170.18110.76160.16110.08990.20420.52750.35460.34740.36060.26460.33150.30780.30720.1333
5
4Boostless B&CBall & Chain by Krobar2725439
GGAAAUAAGCAUCAGUAACAGCAUGACCUAAAUAAAUAAAUAAAUGGACAAGCAGUAACAGAAGCAAAGUGCCACUUCGGUGGCACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
1.993
medium
86.70.0731.1410.6070.60351.0762.11812.32032.33382.11570.92881.0660.66930.5511.60580.62390.01740.9730.56611.28231.07850.99390.33830.5446-0.10280.34440.52640.54120.09440.72350.0447-0.13510.86710.69491.23831.51791.06310.9891.5311.35920.7280.73051.08031.58910.33090.6370.92940.6404-0.02560.14120.21450.42450.27130.21290.430.14490.15550.28860.33220.77250.83690.69480.28860.55910.74840.82190.70910.4850.0930.75830.81180.89980.48260.23170.28870.1306-0.12680.07780.06181.14140.2520.19290.23911.18380.79430.85820.86670.76610.74170.56140.52160.4971
6
5
Shackled Deception - Brourd - Lab Ball & Chain R1 - Sub 1 Revised (Flipped some pairs still no 1-1 mismatches)
Ball & Chain by Krobar2725777
GGAAAUAAGCACCAGGAGCAGGACCAGCGAAAUAAAAUAAAUAAAGCAGGACCAGCACCAGGAGCAAAGACUGACUUCGGUCAGUCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
3.14
medium
94.70.0730.9070.490.31251.4882.06971.4451.50411.11.34450.74670.08590.10620.95880.0816-0.0030.24210.20030.07290.73230.0495-0.28390.2649-0.0410.10631.44930.0303-0.01540.29730.0348-0.13090.92911.0631.23711.69381.13971.74931.49161.68681.61091.00981.13710.86971.31770.70010.92411.06331.2140.1039-0.07640.13440.04320.15740.76610.12830.02360.25590.0820.11770.35360.1068-0.00680.04470.00970.09290.0720.02740.11390.58590.81380.88410.23060.20380.15880.0018-0.00860.14360.0240.82590.24070.14520.40960.47870.41290.41820.33560.36570.3170.30440.2430.1449
7
6Mod of ViennaUCTBall & Chain by Krobar2741099
GGAAAAGAGGAGGAGAGGAGGAGGGAGCAAUAAAAUAAAACAAACGCGCCGUCGUCGUCGCCGCCAAACCCAUCCUUCGGGAUGGGAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
2.989
medium
90.70.0750.9890.5320.62191.9721.24761.62931.53480.95320.98960.76010.28270.15370.29970.28340.27946.00E-040.46760.46010.04260.35270.20980.27950.33230.08620.21330.2403-0.2350.96970.36450.29511.03312.64711.89241.73571.94481.65591.78491.2041.6390.92230.92680.98850.61791.30710.9090.26980.55740.05010.03150.16620.08180.04131.6630.28740.23041.61090.21770.12011.23620.4809-0.01880.1786-0.0795-0.1066-0.1471-0.2161-0.0770.3290.49820.41070.1827-0.00860.0328-0.06420.02350.08310.20160.56190.1630.19010.16830.46840.43310.39460.36730.34960.31350.34230.23130.2366
8
7B&C 2Ball & Chain by Krobar2822228
GGAAAGAACCGGUGCUGGCGUCGGUGCCGAAACAAACAAACAAUAGGGACGGAGGCGAGGACGGGAAAGUGUGACUUCGGUCACACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
6.239good920.0690.8290.4490.83931.43811.45020.89420.55510.96591.44910.74030.0340.07280.20791.33140.65730.67340.17370.06930.45280.31280.12180.59640.13990.10270.42411.28190.36460.59750.1359-0.19440.32020.82480.97470.57880.43941.12861.26050.76860.56291.23281.17750.96190.29570.80961.42720.81170.47940.19480.23760.47040.20280.07430.16890.41930.23190.16260.13140.08280.47560.16880.25950.49120.25090.0560.04690.24490.4220.90540.53680.47040.11060.0351-0.02190.0270.02240.07390.35740.54950.12260.36290.32260.22260.20.18240.14960.11320.14210.16210.1250.0475
9
8JR_Ball_Rnd1_Sub2Ball & Chain by Krobar2717496
GGAAAACAGCCACAUCCCUAGACCUAGCACAACAACAACAACACAGCCAGAUCCAGAGACGUAGCACAGUCACUGUUCGCAGUGACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
5.254good77.30.0440.8920.4680.40421.18591.93531.58961.30040.78980.32090.78970.31710.11380.00750.06470.12150.49760.0817-0.09310.01120.06680.24910.36130.93020.19530.12450.85750.7531.39711.51781.42120.54840.31841.43120.72150.51771.48730.81370.50441.55330.91570.37321.21960.78040.37190.50880.28360.51310.2054-0.2089-0.01160.28180.63151.0270.39070.18210.02120.28130.61640.56560.7310.32940.33320.74720.76680.90610.61510.55070.65030.3090.67540.24630.0830.0437-0.0301-0.14670.00220.04270.80620.22880.42740.3240.31450.2160.21470.19530.17750.13090.12840.130.1202
10
9CeonananBall & Chain by Krobar2725496
GGAAAAGAGGAGGAGAAGAGGAAGGAGCAAUAAAAUAAAACAAACGCACCAUCAUCAUCACCGCCAAACCCUAGCUUCGGCUAGGGAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
2.271
medium
82.70.0610.9910.5260.6821.2161.59261.96551.83980.58650.46330.87720.3520.60570.31340.61340.64950.35210.59390.91531.00110.46510.45440.3811.31290.63620.54130.3460.83980.86180.38440.62390.92941.76261.44252.20931.2611.14721.84741.62291.62271.42371.14221.22210.50170.64660.68140.5670.29960.09390.0290.09960.07550.06130.36290.23530.02080.28670.32780.24020.62650.1440.10320.09080.0256-0.5229-0.8384-1.0108-0.38940.18210.55120.42830.06130.0802-0.01790.0570.02280.04550.22580.34990.0580.27340.32440.65950.51230.5930.43040.40470.33750.36230.29450.2203
11
10Symmetric asymmetry 2Ball & Chain by Krobar2732660
GGAAAUAAGCAGUAGUGGCGACGACAGCGAUAAAUAAAUAAUAAAGCAGUAGUGGCGACGACAGCAAAGUCGAUGUUCGCAUCGACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
5.321good94.70.0820.8980.490.87141.58012.22521.89831.90651.39741.33641.96390.21950.05840.40160.54220.43590.31170.10860.11810.3820.22980.03850.97610.01120.08420.12010.25620.36810.94260.09980.0480.37220.53060.8931.35020.9781.38461.15821.03211.32510.8580.81641.041.14960.68890.90230.79851.0470.19-0.01630.27780.12860.18270.22910.20830.03450.30.22960.01950.60990.1869-0.00210.16880.25010.31820.52570.20920.16440.38270.42880.86760.10170.03420.01780.05650.12020.03330.09220.89980.17670.32630.30050.32450.27840.26460.24360.2370.21420.1880.20970.1135
12
11Second Link--mod of BrourdBall & Chain by Krobar2763519
GGAAAUAAGCACCAGGAGCAGGACCAGCGAAACAAAACAAACAAAGCAGGACCAGCACCAGGAGCAAAGCCUGACUUCGGUCAGGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
1.612
medium
960.0510.7930.4220.08811.84131.89882.24661.51531.26071.08630.443500.14410.40470.08810.08780.22210.17250.13840.66210.0825-0.6737-0.03740-0.15480.48130.0407-0.15650.2780.1561-0.11250.36421.41281.49070.98530.25221.60511.73421.96181.3790.43671.16021.00871.28760.73820.90260.98271.22890.24050.17550.18990.07410.16370.76710.20050.17180.4309-0.03630.09180.23540.15050.00790.13430.05960.05140.15040.1184-0.18150.42110.71180.56370.25180.0393-0.03970-0.27140.10430.14221.02870.22210.09840.19540.85670.78210.65660.61370.51210.57030.43050.45890.1558
13
123rd Link--mod of HyphemaBall & Chain by Krobar2763598
GGAAAGAAGCGAUUUCGGCGGCUCAGGCGAAGAAGAAAGAAAGAAGCGUGUGCGGUGGAUAUGGCAAAGCAAGGCUUCGGCCUUGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
5.055good85.30.0840.9250.5040.64011.43931.25561.31470.84120.74331.17461.06540.17130.32740.73291.17740.67250.67550.25170.07290.44850.22090.05320.26050.13980.29860.34560.22440.28030.41970.12320.10270.56251.14370.26670.83940.6791.20981.00251.2971.44610.9980.68911.17341.29560.75910.65820.90870.94290.83410.26910.34670.5990.27170.36180.26670.15910.10450.08530.11520.24570.54961.00890.48220.82990.33270.57850.30410.3250.5650.48640.6650.34040.07630.07030.01040.07360.02330.00440.37380.14010.14420.0950.2890.25860.22830.22350.17750.18990.1970.18590.0948
14
13Chain this Ball 2Ball & Chain by Krobar2715758
GGAAAGAAGCGAUCUCGGCGGCUCAGGCGAAGAAGAAAGAAAGAAGCGUGCGCGGUGGAUAUGGCAAAGUAAGUCUUCGGACUUACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
8.267good85.30.0880.9650.5271.0861.11.50241.2840.79651.08431.09980.91910.17070.07960.27760.58010.28650.11530.06850.03860.59430.24380.05450.20750.53130.27870.26940.22470.32630.87360.30910.11530.83561.30240.53711.40241.11441.53531.2641.14751.22961.33970.92571.32761.42881.12320.72951.08350.99630.9110.12350.1450.62240.41750.22660.08940.23040.06910.19130.2120.07850.21550.37250.53830.83450.34770.7470.37650.19030.720.52930.75250.16140.12680.04050.00490.02020.03740.09560.60860.13490.29270.16390.21240.15620.15970.14660.12110.13010.12530.11930.0575
15
14Looking Glass 1Ball & Chain by Krobar2713673
GGAAAGAACGGAUGACGUAGCAGACGUGACAACAACAACAACAACUAGGUGUGGUAGGUGAUGCGAAAGACUACUUUCGAGUAGUCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
7.485good81.30.0561.1310.5940.6411.54641.22651.07020.60441.18341.58590.68470.15280.27940.58121.14560.58061.18090.92740.40330.7320.81621.20770.88190.30010.35930.65460.34760.36960.71431.08681.40761.05180.53521.37580.73740.26681.46620.76220.28061.22640.80120.52071.39141.10510.35231.42061.13080.66761.16950.48870.8810.71650.37191.0920.03590.45030.58740.63230.33520.630.3920.24090.64210.93480.32620.15625.00E-040.37890.61170.45480.54470.00950.06590.00370.05010.00940.14250.74691.0510.16150.19030.56650.24620.21030.19190.18070.12370.16150.17810.1230.0779
16
15Chain this BallBall & Chain by Krobar2715302
GGAAAGAAGCGAGCGCGGUGGCACAGGCGAAGAAGAAAGAAAGAAGCGUGCGCGACGGCACUGGCAAAGUAAUUCUUCGGAAUUACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
5.993good94.70.0981.0820.590.91511.29911.43031.37160.87880.83331.0751.27850.15630.05650.82280.5230.16280.3760.37080.08080.53180.58680.1830.87260.37630.19460.26750.23250.61371.06720.32230.15280.841.54521.10391.58341.68681.25121.82171.85871.30690.94961.36991.63841.42080.77071.2671.07290.92980.21290.18410.40960.31590.12240.00610.18560.13490.99720.37670.13550.47850.20030.32330.25380.18120.05960.44850.39010.310.62180.57940.86550.0990.0606-0.00490.08040.04250.05230.23240.76150.09770.13050.49570.3360.25590.23780.22290.18560.18440.19080.19930.0966
17
16Chartreuse & Blue Priosner IIBall & Chain by Krobar2822962
GGAAAUAAGCACCUGGUGCAGGUCCUGCGAAAUAAAAUAAAUAAAGCUGGUCCCGCUCCUGGCGCAAAGUGUCUCUUCGGAGACACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.347
medium
85.30.040.6650.3531.01161.82611.6881.37671.60461.12570.88741.02960.14790.18990.26870.07890.01240.156-0.0620.11070.22380.0551-0.23620.03390.05610.14410.06530.0239-0.02220.0301-0.02210.01260.70071.12771.22621.28860.84821.29640.79951.08090.81571.39260.90350.79510.62361.05340.72160.67410.91050.6731-0.02150.08140.02710.03420.08760.11430.0803-0.0063-0.00650.04020.03330.03340.0199-0.03960.0398-0.1501-0.69750.08810.12540.56560.6390.90340.32960.06390.02020.0342-0.04760.05850.24240.47550.11750.33770.34390.31410.27020.2320.19090.21870.18420.17230.15210.0797
18
17Looking glass 3Ball & Chain by Krobar2824714
GGAAAGGAGGAGGAGUGGAGGUGGGAGCGAAGAGAGAAGAGAAGAGCGCCGGCGUCGGCGCCGCCAGACGUAUGCUUCGGCAUACGAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.163
medium
82.70.0690.8510.460.77231.04820.86730.69230.37380.49290.63510.35530.42720.81660.27350.36130.68380.96140.56810.43060.45330.58990.31730.22040.53340.37350.19090.1141-1.7526-0.18050.23450.08630.26990.21740.76881.29070.70291.32171.0781.22641.35381.00451.2081.01421.32321.090.66050.68191.12170.20050.08660.07540.06440.0290.19270.70710.88521.30790.74890.17360.08580.0581-0.5219-0.266-0.1994-0.27380.36760.25680.21470.30030.85120.3913-0.0196-0.0146-0.00290.12480.02670.11180.35490.81650.11330.19260.62680.26170.210.19750.18450.12620.13390.15540.11820.1191
19
18Blue Prisoner 3Ball & Chain by Krobar2844661
GGAAAUAAGGAGCUCCUGGUGGUCCUCGGAAAAGAAAAGAAGAAACGUGGUCCUCCUGGUGCACCAAAGUAUGUCUUCGGACAUACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
6.822good86.70.0410.6960.3680.71021.31821.47951.42171.37381.00611.17720.66560.20550.25740.44180.13470.02590.0722-0.01030.02050.1949-0.02850.05060.0620.04520.04120.1095-0.0160.03640.0059-0.00270.23740.84671.73661.72280.96421.01641.0541.72851.57041.33771.07361.10611.51960.97670.75330.7910.7310.41940.13760.0775.00E-04-0.01010.03830.09250.06857.00E-04-0.00190.0576-0.02710.00740.0471-0.0070.08120.04210.08910.32130.06950.08340.38240.48920.5550.08230.04650.03980.00540.01440.01150.07230.50120.07560.1950.25570.20290.1790.16330.14190.1410.12580.13010.09390.0541
20
19Last TryBall & Chain by Krobar2858348
GGAAAUAAGGAGCACGAGCACGAGCGCCGAAUAAAUAAAUAAUAAGGAGCACGAGCACGAGCGCCAAACGACUGGUUCGCCAGUCGAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
3.593
medium
920.0460.7530.3991.37451.94541.60871.93152.04141.62161.64280.66550.21530.44150.72690.06040.14220.10370.06940.11880.59380.13860.01150.08830.06510.170.4210.0664-0.02240.36680.13950.24220.57471.05962.34450.68160.77920.9441.0950.74530.82660.95930.70710.57920.61530.7310.74240.38930.17140.10080.08040.05610.05350.01270.12720.08190.10490.40970.16530.00620.12810.11260.19330.45310.17710.16190.24920.01540.01570.48941.00060.72460.36820.15030.0455-0.04910.01580.05430.36640.53470.15640.5150.63320.43680.35060.30250.29850.31630.27960.24560.15980.1512
21
20Reversing Janet s design Ball & Chain by Krobar2879385
GGAAAUAAGAGUCGAGGACGUCGACGUCGAAGAAGAAGAAAGAAAGAGGUGGAGGUGCUGGAGUCAAAGCAGUUCUUCGGAACUGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
7.13good89.30.0721.0260.5490.82022.00241.7372.11221.89261.18740.90630.56810.53730.69920.24110.1420.01750.37490.14420.47433.0270.7810.33971.74960.27260.0255-0.11730.04540.0161.43120.16150.08480.80970.94670.5041.15141.36520.44670.92470.93211.34880.86851.19521.32220.9830.65441.26481.14221.01440.84070.85430.43330.53740.42380.15260.29560.43850.34060.23150.22260.23810.17040.10580.1160.33870.53080.64820.50130.22120.79220.54730.34260.09930.05070.03380.0192-0.01380.07170.02490.65640.15150.22350.31360.25490.25260.22750.22930.20670.17880.15010.13420.117
22
21ReenlaveBall & Chain by Krobar2713092
GGAAAUAAGGAGGAUAGUAAGGAGAAGGGAAAAUAAAACAAAAGACCAUCGCCAUAGUAACCACCAAAAGUACGCUUCGGCGUACUAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
2.884
medium
77.30.0971.0720.5850.10491.09722.00013.23052.05891.35811.21650.84430.27870.8650.35350.2610.76030.71950.92420.85651.20490.90591.15490.38720.13150.39430.380.87620.84590.3620.2570.20890.08971.35791.18371.63751.49991.21021.45651.36981.19211.25560.33480.83761.00730.87170.3790.90010.61410.10980.15020.2930.15260.10520.23620.13910.05850.5870.78051.07280.40041.0470.80120.48860.14310.10490.31370.03330.09860.0380.43980.48120.15910.09730.0755-0.0682-0.0775-0.02050.09610.28460.0840.10420.0720.57250.52120.54010.57230.47840.43870.41570.28380.1945
23
22wisdave Ball & ChainBall & Chain by Krobar2713191
GGAAAGAAGCGGUGGUGGUGGUGGUGCGGAAAGAAAAGAAAGAAACGGACGACGACGACGACGGCAAAGUAUAUAUUCGUAUAUACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
6.585good960.0830.9180.5010.59461.02590.91180.99510.75080.96361.13531.05120.44630.14850.38830.4810.10730.58890.53940.17190.42730.38470.12940.34330.32610.09210.32450.35240.23620.3026-0.64550.15840.71691.49141.02060.96521.70651.72051.37271.23531.00471.45921.35271.04340.34640.78750.98530.77460.31310.0790.1590.61270.30070.12420.64530.11310.10530.30330.20530.1240.7440.24770.10160.67610.2294-0.13490.10930.14680.24940.57590.52890.81860.15530.03880.0059-0.01530.04550.09640.46920.41040.13190.40460.44110.20370.1630.1610.14730.12450.13820.13420.14050.0885
24
23Mat - Ball & Chain D1Ball & Chain by Krobar2717261
GGAAAUAAGCGACGGUGAGGGAGUGGCGGAAAUAAAAUAAAUAAACGGCAGUCGCUGACGGUGGCAAAGCAAUACUUCGGUAUUGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
6.858good90.70.0871.0410.5641.00981.97991.96071.14211.64551.13111.04140.50530.06930.03610.23570.18490.08690.45251.14790.65850.97790.50750.28930.56620.67020.99210.76920.22250.51790.33580.07240.36081.27371.74681.54621.94451.23721.71381.43551.50491.57951.07051.36430.83961.44881.10261.09150.89440.32710.0340.33260.2690.05540.46520.27540.15660.04920.05960.04320.09520.33410.23780.10940.22840.36850.07370.26140.37550.27420.60.51870.62380.13030.01240.07130.0194-0.0760.00930.13440.55780.14680.26140.17470.27440.25090.22940.17640.19690.18190.15670.12870.0657
25
24Meechl s B&CBall & Chain by Krobar2719499
GGAAAUAAGCAGUACCAUGAGCAUGAUGGAAAAGAAAGAAAGAAACAACAAGCACAAGGAACAGCAAAGAGUGACUUCGGUCACUCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.002
medium
82.70.1141.2580.6860.99311.41832.62.06561.91391.8241.66941.48130.8110.48240.57981.15391.17280.960.015-0.02430.28250.04041.72251.73780.51150.21291.3650.46661.00340.5393-0.06410.45990.46661.18071.14461.0740.6951.39641.62291.38420.69941.38781.5411.06950.71031.32621.0991.45660.89890.70840.77670.84870.60040.71790.85740.39950.55140.71860.4330.58440.20810.17780.3610.44060.23220.13090.24550.1920.31460.3820.32110.51430.0722-0.01260.0359-0.02270.13790.01840.06920.35310.18290.14120.16420.52350.45310.52510.45230.42230.41460.35790.33120.2645
26
25KrobarThatBall & Chain by Krobar2723840
GGAAAGAAAAGUAGAUGUAGAUGAUGAUGACAAACGAAGAAGAGAAUGAUGAUGUAGAUGUAGUUAAAUGUGUGUUUCGACACACAAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
7.411good69.30.0371.3460.6910.12421.05161.07190.88660.78660.98721.49110.92241.04141.57321.33440.99920.93481.63981.450.8331.51940.76390.55821.59431.23650.52021.27451.52170.49311.49341.23090.49921.37680.74230.2551.05331.06220.31450.16190.50121.03540.7771.0631.10430.82050.76970.92171.04631.21.25630.78560.83581.03040.89620.75240.88040.90180.79670.74570.57030.90330.80960.84190.67090.42130.78950.40060.31210.38490.66880.4830.24870.05960.01270.00490.06030.00310.03650.31080.610.13250.13880.28530.24870.22540.22960.21480.17840.20080.22040.21540.1785
27
26Feeling pretty goodBall & Chain by Krobar2725195
GGAAAUAAGCACGACCAGCAGGACGACCGAAACAAAGAAACAUAAGGACGACCAGCAGGACGAGCAAAGCUCCUCUUCGGAGGAGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
2.099
medium
90.70.0640.7380.4010.75252.25931.75642.09672.05051.17980.95071.02310.36120.0180.58480.18740.31520.72630.14850.03740.5551-0.01870.12210.36820.03290.13630.0519000.26670.16960.07220.10090.10340.95160.63180.96790.79772.16211.11121.03921.05521.18040.64210.14320.57480.20310.47780.29260.17760.35290.31890.20410.14840.48570.08350.13120.18570.24750.05710.17790.10130.10470.00820.13780.01910.49350.27390.15230.62190.68150.61490.20230.07120.01240.12880.06430.02710.55450.98520.02650.25670.40870.75020.5670.48490.49620.44890.35160.31770.35240.2205
28
27B&C - 1Ball & Chain by Krobar2727530
GGAAAUAAGUGACGAUGACGGUGAUGGAUAAAAUUAAAUAAUAAUUCGAUGACGGUGAUGGUGACAAAGAUAUACUUCGGUAUAUCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
8.35good82.70.1031.1290.6160.87441.38071.83351.56761.85371.54331.44551.02540.69650.35661.08430.44080.20580.82450.94220.42321.01190.35330.1240.37830.42580.23950.97260.89510.160.2970.74961.48860.88811.2950.75790.77911.1561.251.45361.38910.74120.85521.25221.09461.13621.08130.70630.80390.79970.66360.22770.23090.57930.66460.36160.65540.25670.05880.2450.22190.39980.68170.41710.32410.21550.10240.67910.46840.30130.3980.44170.52510.11410.02440.0175-0.0132-0.01890.01580.25430.6240.08610.16420.38440.21710.20720.19720.17250.18030.17130.15240.1370.1074
29
280 GC Hmm Barcode restrictions....Ball & Chain by Krobar2741066
GGAAAUAAUAGGUGUAGGUGUAGAUGUGGAAUAAAUAAAAUAAAAUAGGUGUGGAUGUGGAUGUGAUAGUUAUAUUUCGGUGUGAUAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
8.432good85.30.0951.050.5720.5881.16230.87361.18241.48080.92671.34111.49850.80050.42210.57270.35060.19280.490.49580.29650.48160.44970.45290.71370.78640.41830.58390.55030.30970.24540.06270.19620.61811.22611.26241.22710.68390.73590.88651.49270.92591.27450.9861.02771.45081.01891.14040.88830.88561.11630.55540.27450.31540.30930.13540.38520.10730.13580.26130.4190.2640.080.09960.26660.64670.17660.15860.1120.2660.75870.51240.52520.29120.33430.40170.66580.15750.45250.21620.37240.08630.06350.16170.17040.16080.13390.13640.15660.13790.13730.14130.1155
30
29Ball & Chain D2Ball & Chain by Krobar2818342
GGAAAUAAGCGACGGUGGCGAGGUGGCGGAAAUAAAAUAAAUAAACGGCAGCUGGCGACGGUGGCAAAGCUUAGCUUCGGCUAAGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.911
medium
920.0820.9050.4940.59451.44911.75981.61631.26990.84771.08990.56450.120.06530.84540.36090.16030.44230.80820.13630.750.22640.12640.89410.06530.32191.14260.08670.37670.50860.11130.1850.81051.21551.57541.43851.37161.41151.35821.35351.2271.02181.35620.79441.33080.87340.77210.62390.36330.10320.18130.30820.12120.1590.20410.07780.04620.17640.14550.05230.44470.1590.09170.23930.66860.08880.21540.18580.17750.54380.52750.36650.19650.10270.05360.0217-0.00650.03970.04830.47320.1780.13010.08380.31910.27070.26350.24690.22120.21510.20380.22070.0989
31
30Mat - Ball & Chain D3Ball & Chain by Krobar2833352
GGAAAUAAGCGUCGGAGGCGAGGUGGCGGAAAUAAAAUAAAUAAACGGCAGCUGGCGUCGGAGGCAAAGCUUUGCUUCGGCGAAGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
6.919good90.70.0921.0160.5540.82781.51111.86011.46511.95811.03110.84350.68320.18140.19580.74950.09010.08570.34041.1850.19020.39270.0830.07170.79580.53960.67370.80410.2270.58250.57920.05450.46740.79121.45361.52721.93290.72640.85381.5171.31931.34261.32591.18171.12441.08231.14580.8811.22280.68420.18090.11710.34560.2260.19930.26880.1170.0710.09390.17310.12410.24450.12390.06730.28380.60640.19440.46650.40260.20310.55890.62240.57680.35560.24030.17280.09480.01850.05030.19920.61850.07850.09720.43690.25230.23320.22350.19640.20940.16480.14240.15290.0862
32
31UNKBall & Chain by Krobar2833656
GGAAAUCAUAGAUAGGGUAGUCAUAGGCAAUACAGAAUGAAUUAAGUGUAAGAAUGGUCGAUGUAAACUUACUGUUUCGACAGUGAAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
6.162good77.30.1091.1940.6511.14991.47641.43531.5221.20020.64510.69491.82361.13140.75891.74611.410.85540.51270.28860.70190.67160.48331.1410.61980.42650.17180.61810.43540.46720.78470.64730.15570.73521.1120.5820.5026-0.01980.28281.12991.72881.45960.63071.1081.31231.57581.31981.26030.99491.07140.91650.72970.44950.31380.46420.65140.6890.79850.65930.29720.34790.40450.14750.06020.21970.49680.50620.5330.67330.76690.69860.26960.22850.34410.16190.0938-0.00450.02720.13580.23680.54590.12410.19440.44270.31480.2670.24440.24080.23690.1740.23150.24130.2122
33
32Lab: Ball & ChainBall & Chain by Krobar2845741
GGAAAUAAAUGAUGAUGAUGAUGAUGAUGAAAAUAAAAUAAAAUAAUGAUGAUGAUGAUGAUGAUAAAGGGCGGGUUCGCCCGCCCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
2.235
medium
74.70.0861.540.8130.74681.51642.022.54432.36930.93361.87551.8181.21210.45481.53782.11360.70861.35070.65990.4721.56241.10750.24921.37131.6410.81991.78391.14160.32251.01131.61530.6461.45721.59880.64090.87392.2070.44550.43811.28260.57440.36021.18560.94261.07181.3770.84781.37070.80020.770.90020.39891.2881.1490.67921.0050.87980.73211.18650.78360.27851.23330.59980.81050.88460.07810.40411.25310.75740.51860.55930.67830.15420.13810.05170.08590.06860.03420.15330.30920.16660.215-0.02731.13491.01590.94811.04530.97180.73840.94680.72570.7078
34
33Red Ball & Chain w/extra redBall & Chain by Krobar2855603
GGAAAUAAGCGGUGGUGGUGGUGGUGGCGAAGAAGAAGAAAGAAAGCGACGACGACGACGACGGCAAAGGAGAUCUUCGGAUCUCCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.93
medium
920.0890.9940.5420.7631.0321.46231.25221.39331.21361.09370.75660.47590.18340.32670.6270.13130.53790.73610.14240.47830.36820.0570.38740.99420.1040.32550.7850.04790.04580.0895-0.03970.7480.88240.78191.3131.07810.99411.8431.37350.96671.24851.20261.05860.94991.14691.31640.80070.94710.18350.21760.66710.08820.08230.67130.1970.09150.80660.17890.11770.5120.26730.17970.77190.20470.03230.3960.21950.26970.75270.76950.81670.23320.0822-0.00740.01390.15120.04310.31930.70220.20620.15850.36620.3280.26840.25850.23340.24530.22590.21340.17260.1346
35
34Prison 2Ball & Chain by Krobar2856632
GGAAAUAAGCGCAGCUGAGGGUGAGGGCGAAAAGAAAAGAAGAAAGCGCUGACGCUGAGGUGGGCAAAGUAGCUGUUCGCAGCUACAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
5.549good93.30.0860.9470.5170.92641.54691.55531.23921.26131.10510.87540.84070.06250.18630.1315-0.0480.43880.29220.2270.43940.95980.36030.35530.46330.53780.37530.89530.31280.32730.29140.07560.1710.83381.84930.83210.64950.91181.05181.4771.15011.42471.13460.95341.1130.85310.90321.20810.87690.7020.60640.19270.14470.1520.15380.210.47720.27770.22130.19930.11940.22010.24510.53960.4540.20920.11010.42060.22550.27150.65390.71490.76150.19720.0930.0710.05030.0010.08630.24750.70270.19560.36740.25680.28580.26510.24340.20740.19430.18580.16590.14380.0796
36
35U-U Loops 2Ball & Chain by Krobar2858310
GGAAAUAAGCUGGUGCUGGUGGUCCUGCGAAUAAAUAAAUAAUAAGCUGGUCCUCCUGCUCCUGCAAACGACUCCUUCGGGAGUCGAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.383
medium
86.70.0220.510.2660.5031.29281.5531.24041.72761.29821.08490.8630.1631-0.02790.06870.03640.13650.73190.00420.0934-0.0096-0.01920.02460.02320.01090.0340.08930.03250.0217-0.04810.054-0.12890.21881.44081.32340.68320.72160.92360.47090.88270.49060.82160.78530.51960.26880.3930.47120.33960.36730.23580.06560.02260.02940.02030.00230.08760.0404-0.0057-0.0113-0.00460.00780.04690.03340.02670.0077-0.01140.01910.04910.1150.45670.7710.73090.24260.0832-0.0140.01740.01070.02330.02190.55670.20340.23060.2030.30210.22820.20060.14720.18610.15670.14110.12830.071
37
36Lowest energyBall & Chain by Krobar2869587
GGAAAAGCGCGGCGGCGGCGGCGGCGGCGAAAAGAAAAGAAAAGAGCGGCGGCGGCGGCGGCGGCAACGGCCGGCUUCGGCCGGCCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
2.669
medium
920.0610.8190.440.74980.59821.18171.23690.53250.45210.15150.37950.3860.12010.54220.509400.54520.18060.04510.39330.068-0.08020.34240.44240.18430.40440.3917-0.07770.14850.51570.09951.21661.55561.53771.0391.05391.73921.73641.35260.99980.90641.16541.46051.24760.88420.55240.68560.81140.40790.13530.36310.30980.05720.41190.25720.02230.34780.230.08190.29190.1291-0.11410.3660.3848-0.0226-0.02570.17740.18090.52270.47140.22780.17580.08520.05670.06090.0270.03220.08370.7870.22880.17390.23970.47860.3570.34020.32850.27840.30740.22180.23030.1945
38
37Not my wife 1Ball & Chain by Krobar2712848
GGAAAGAAGCGGAGGUGGCGCAGGAGGCAAAAGAAAGAAGAAGAAGCGUCGUGGGCGACGUCGGCAAAGCGAUGCUUCGGCAUCGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
3.676
medium
93.30.0830.9080.4960.27331.47171.31571.09270.4931.18711.20010.92960.21220.11380.19080.44090.40660.52790.41070.10480.49180.19760.21250.45180.17250.3840.40060.54840.28910.68850.70680.34871.14191.22841.06670.84691.45541.33741.01040.98650.99211.22710.72860.97611.01010.62310.9070.98030.79010.17990.14360.27730.08630.1140.56390.68550.51220.57290.28390.11310.19240.09770.07450.22060.03360.02210.34460.43780.22070.66930.69740.45610.18770.0522-0.05330.0493-0.00130.01020.07820.73180.2680.12910.23920.38340.32080.31140.26970.22580.25410.25640.22240.1211
39
38B&C1Ball & Chain by Krobar2712918
GGAAAUAGAUGAUGAUGGUGAUGAUGAUGAAAUAAAAUAUAAAUAAUGGUGAUGAUGAUGGUGAUAAGGUAUGUAUUCGUAUAUGCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
6.471good74.70.0721.2250.6490.71521.52381.15971.23131.50681.12780.57271.17821.21030.27331.01541.12710.40751.15880.83890.24080.53370.5390.15621.15080.91050.39470.97990.96850.3981.24061.20230.25170.45661.14431.04371.50461.18940.64211.18430.95331.17921.22510.8741.63170.81091.10570.82181.08840.93791.01220.83510.21950.64460.6180.13170.65230.58950.55980.82170.5380.63350.9670.23670.50570.39680.00190.57930.96570.86560.51810.11880.43980.34340.18250.55610.07230.15520.23130.8896-0.05760.21410.17680.4590.27280.27740.23890.22730.2370.21370.14950.20040.1975
40
39On the BallBall & Chain by Krobar2715120
GGAAAUAACAGGUGCAAGUGCAGGUACGAAAGAAAGAAAGAAGAACGAACGUGAACGUGGACGUGAAACUGACUCUUCGGAGUCAGAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
7.294good81.30.0971.2360.6660.83011.70921.98581.83862.06671.62131.52960.8650.55420.43320.84390.68660.70590.52680.7471.56141.23611.06460.83530.4840.20240.39540.71020.71511.00130.32030.15550.74541.35631.00930.73341.55741.02721.21740.62981.07511.3111.10960.9661.02461.10010.7811.05181.29290.63060.15790.41860.73070.57590.23720.33540.32210.75761.22980.94130.49780.46230.16650.32830.83060.23680.17070.17110.23540.53460.76360.7830.56990.1344-0.02240.06320.07820.048-0.0090.31070.63550.13870.13690.39490.29320.27330.25390.24420.25050.2180.20780.15830.1538
41
40treedBall & Chain by Krobar2716385
GGAAAGAAGUGAAGUAGUAGUAGUGGGUACAAGAAAGAAAGAAAGGCGCAGUAGUAGUAGUUGACAAAGGCUGGGUUCGCCCGGUCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
11.214strong73.30.0231.1450.5840.76321.01121.09940.9580.65790.97761.02881.1180.95140.48941.65130.96221.03461.39150.90631.09931.23460.92891.20951.25690.83541.14840.93340.2240.16350.53321.00520.76251.12550.12910.90680.78061.09281.1761.11121.01910.380.35961.04770.87140.82040.53271.02550.72980.27710.51420.23410.19220.44630.25820.54630.78860.61650.94210.93130.79530.97450.84890.6790.85670.52910.2190.52360.63150.22840.47790.47680.25570.09280.03440.0103-0.03910.0230.07220.15650.51430.10180.30160.31090.14150.12580.12850.10850.09230.11150.10710.10860.099
42
41Starry s Ball/Chain with G sBall & Chain by Krobar2718883
GGAAAGAAGCGUCAGCAGUGACAGAGGGGAAAGAAAGAAAAGAAACCGUCAGUGACAGCAGAGGCAAAGACGAUCUUCGGAUCGUCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.531
medium
90.70.1031.1320.6180.57691.25521.70091.55120.53531.29011.11690.32350.05820.2810.31810.35240.33060.47780.9620.22860.68951.28830.32460.43710.25840.18221.17582.24540.57890.21420.13690.34550.92691.6661.50781.06661.85791.83671.97241.19681.35121.64251.56561.04430.66870.8851.21371.10270.5730.04950.19920.38880.23190.01960.22460.54640.21810.31580.29720.22170.69820.28220.20540.34020.58440.31220.43210.51970.34510.62130.62720.67060.15050.06130.07610.04890.04030.04020.22570.61960.08250.3090.08290.45570.35840.33510.30230.2070.27630.25040.24520.1334
43
42Starry s Ball/Chain with U sBall & Chain by Krobar2718907
GGAAAUAAGCGUCAGCAGUGACAGAGGGGAAAUAAAUAAAAUAAACCGUCAGUGACAGCAGAGGCAAAGAGCAUCUUCGGAUGCUCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.739
medium
90.70.0681.0470.5571.18552.29942.65051.64412.12931.13741.20120.43270.04430.23110.85510.40980.25420.34731.12280.35450.8441.31980.33430.2820.19030.22951.37573.4320.58880.34240.18130.13190.75390.78671.39691.0050.6220.98921.48081.69471.49760.96631.01150.89641.05560.72940.98710.85360.35890.07080.13870.28040.26294.00E-040.29380.38410.17340.14450.27670.16660.81490.28630.0680.31840.4570.25490.57670.47310.32870.86060.44210.3205-0.06270.1231-0.05070.01120.05550.07440.29820.55920.10730.41650.13930.44170.40690.38380.30720.3240.2620.24760.27840.1286
44
43Starry s Ball/Chain IIIBall & Chain by Krobar2718969
GGAAAUAAGCGUCAGUGGCAGUGACAGGGAAAGAAAGAAAAGAAACCAGUGACAGCGACAGAGGCAAAGAUCCUCUUCGGAGGAUCAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.477
medium
82.70.1031.1290.6161.5151.02511.95661.24242.21751.0950.81820.64150.08310.19650.16010.17470.07320.51511.17880.30770.39930.03330.12770.82810.76840.40831.77831.00920.36790.18710.40930.7961.26961.22871.74840.59751.67391.76971.47041.16051.41791.62941.1911.15350.92421.26411.42661.05550.47330.0204-0.02590.18020.59420.15370.22060.17020.08910.69650.1020.07560.26880.6570.43210.32240.590.26940.56360.72260.49760.77750.71940.44180.21960.12630.0967-0.024-0.04780.05050.13860.53630.20250.10440.09840.45890.33140.36250.29260.36320.30410.23610.22820.0953
45
44
Heavy Lifting RNA - Brourd - Lab Ball & Chain R1 - Sub 2 Revised (Flipped some pairs UU 1-1 mismatches)
Ball & Chain by Krobar2725789
GGAAAUAUGCUCCUGGUGCUGGUCCUGCUAAAUAAAUAAAUAAAUGCUGGUCCUGCUCCUGGUGCUAACAGUCAGUUCGCUGACUGAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
4.707
medium
86.70.0280.5270.2771.2711.21921.13661.17971.02460.65260.74970.43830.0960.060.110.0109-0.01480.00690.03250.03520.23390.0280.0190.25880.09430.01460.0603-0.0049-0.0661-0.0766-0.08590.19080.37760.52411.38541.01480.68640.83851.03171.23150.94770.77240.75470.83611.12220.81920.68420.63020.73170.44330.01880.00150.06220.00350.01270.09120.02810.009-0.00440.046-0.041-0.0022-0.0065-0.03860.00680.0711-0.13520.0040.04310.25680.50270.31660.06850.06540.06270.0547-0.00780.0260.19290.79150.20890.29130.26840.25290.19060.14880.13410.14430.13520.12150.09310.0599
46
45-6.63kcal @ 67Ball & Chain by Krobar2731809
GGAAAUAAUAGUAGUAGUAGUAGUAGUGAAAUAAUAAUAAAUAAAUAGUAGUAGUAGUAGUAGUAAAGGAUAUUGUUCGUAAUAUUAAAAGAAACAACAACAACAAC
........((.((.((.((.((.((.((.................)).)).)).)).)).)).))...(((((((....))))))).....................
3.239
medium
85.30.1461.6050.8750.77573.23781.94572.90592.1011.1871.70590.74081.27341.05252.51670.82570.79161.97850.45840.77111.38330.90431.22661.15510.61651.29121.88560.49480.63290.98980.66880.91770.62320.81911.18050.85791.99811.18711.04140.77981.26251.01111.1181.05651.14211.02260.89211.17431.39340.82560.62291.25130.76120.45730.79480.6650.62361.03751.0940.75130.9930.93920.67140.54510.59591.05330.94430.80920.5640.50310.43130.33280.16770.34120.23710.03020.05550.04070.34990.18030.13930.360.36190.7650.9670.76270.83730.7080.59780.58040.55050.569
47
46Clean & SimpleSimplify by Tesla sDisciple2802704
GGAAAAGAAAGUGACAGACUCGAAGAAGAGUCAAGUGACCUGCGAAGAGCAGAGUCACAAAGUCACAAGGAUAUCUUCGGAUAUCCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.879
medium
960.0750.8680.4721.54311.70841.60961.15021.40211.42761.5491.56151.45981.59720.15880.0397-0.00760.1337-0.0230.72350.1891-0.0177-0.05520.075201.65112.49641.47792.25011.10751.33610.1269-0.04560.00510.0506-2.49471.52831.27550.11150.04450.044400.0038-0.04050-0.01820.02220.02590.20080.31430.28350.2669-0.0378-0.0587-0.01870.08771.32680.17250.0397-0.0396-0.03940.09810.92880.9721.35670.24220.18910.09770.11920.16390.63140.34740.03890.09910.1613-0.00270.61610.22830.49371.0950.22550.49090.520.55910.46510.41760.42410.39320.32990.35650.34660.3375
48
47
Simple Fly - Brourd - Lab Simplify R1 - Sub 1 (Follows general lab strategy 1)
Simplify by Tesla sDisciple2713859
GGAAAAUAAAGCUACAGACUCGAAUAAGAGUCAAGUGACCAUCGAAUAGAUGUGUCACAAAGUAGCAAGUCUGACUUCGGUCAGACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
1.785
medium
1000.0710.7770.4240.42881.61620.63791.4120.78632.21271.08941.08221.03270.58760.13-0.0352-0.10370.06430.09290.80670.08660.06150.0614001.20621.90831.65841.45321.4821.140.25780.0429-0.09510.1231-1.2761.23551.22960.11480.03820.07620.03810.0380-0.050900.07570.23780.55250.55980.85960.33620.21490.06770.0338-0.04250.68840.2677-0.0433-0.0965-0.02140.01060.60750.90841.09230.36810.22410.11160.0557-1.00E-040.59830.78090.3150.34170.11060.12710.16210.06790.23130.86640.40750.18670.17240.86440.69420.60740.52280.50090.5590.36820.44090.3961
49
48Fiskers simplify patchworkSimplify by Tesla sDisciple2725239
GGAAAUAAAAGCUACAGACUCGAAAUAGAGUCAAGUAACCUAGGAAAACUAGAGUUACAAAGUAGCAAGUAGGACUUCGGUCCUACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
1.572
medium
93.30.0830.9090.4960.26620.96631.92121.76551.84531.27272.23291.62591.33490.75490.11820.22120.01160.27510.25260.490.14330.18980.07920.14030.09320.98292.22342.24592.00341.24631.33360.13310.0919-0.1383-0.7622-13.46651.02751.13810.10670.02670.10450.01760.01760.0265-0.09120.05280.20540.3070.54731.12311.19881.08570.49740.04970.04370.06540.4820.63070.22790.0310.09280.06180.51690.96470.77520.3840.51260.25460.0816-0.06090.37130.56160.14760.13630.1211-0.07270.18470.08370.24420.81120.14360.16850.23320.77590.70250.5890.53080.49030.46130.48820.45990.3956
50
49Clean and SimpleSimplify by Tesla sDisciple2736175
GGAAAAUAAAGCACCAGCAUGGAAUAACGUGCAAGACUGGCAUGAAUAAUGCACAGUCAAAGGUGCAAGUGUUACUUCGGUGAUACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
6.014good97.30.0750.8220.4481.0761.48931.65121.32391.65391.97841.64881.6310.86121.00250.07620.0507-0.00530.03830.00580.5990.0771-0.02190.10280.05890.33791.72061.8542.031.21631.46850.86410.24850.07660.05540.01520.16981.08570.84850.03960.02470.0197-0.0097-0.00970.00760.00380.00170.0590.20920.6330.53761.32910.37980.10740.07720.01780.11351.32840.13270.0311-0.1679-0.06790.15280.71351.03680.52670.12680.10492.00E-040.004-0.17210.52480.83330.29030.23120.13090.21880.09640.25640.22330.75770.1370.09740.33910.28080.22350.23550.19550.1950.20110.18130.17120.1288
51
50mod of starry s hairdoSimplify by Tesla sDisciple2763641
GGAAAUAAAAGAGACAGUAGCGAGAAAGCUACAAGCUACCUGCGAGAAGCAGAGUAGCAAAGUCUCAAGCGUGUCUUCGGACACGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
1.805
medium
1000.0680.8060.4370.51361.28962.24621.32382.49680.89842.42251.85321.46860.77150.02620.0680.025700.11450.99350.21440.1917-0.21680.1272-0.04450.76641.61062.03441.25151.23081.3250.1852-0.01370.12330.03150.07631.19270.8167-0.06190.08330.0831000.0415-0.02060.041300.20510.47440.87820.83370.31650.1224-0.1011-0.164200.58030.24850.17640.0057-0.06430.10490.51530.8341.32760.24580.026400.0622-0.19540.23510.27460.22440.29610.26410.07890.0033-0.0660.211.19980.38660.24080.2650.90780.74250.61250.53980.7030.51960.60440.49130.4425
52
51Hairdos IIISimplify by Tesla sDisciple2732785
GGAAAUAAAAGAGACAGUAGCGAGAAAGCUACAAGCUACCUACGAGAAGUAGAGUAGCAAAGUCUCAAGAGUGUCUUCGGACACUCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
3.395
medium
97.30.0540.8540.4540.47382.73162.3912.16431.92422.24222.07471.2091.28260.71130.28750-0.01120.216-0.15191.32060.05720.11250.01680.0223-0.01111.19411.40221.40481.88261.27681.69690.19050.0329-0.08150.0040.20991.36930.8430.1283-0.0163-0.0324-0.069600.0425-0.03210.04750.07040.48650.53191.3630.9150.89650.13540.05920.00780.01321.0860.16030.0142-0.0412-0.12120.11950.75370.80031.02880.26380.00350.0149-0.02260.04780.770.69610.45260.18840.05610.05350.09680.04540.28190.88430.24990.1380.12140.52380.53170.4720.41270.39760.39560.37440.3060.2824
53
52Simply PerfectSimplify by Tesla sDisciple2732578
GGAAAAGAAAGUCUCAGUCUGGAAUAACAGACAAGCAUGGUACGAAAAGUACACAUGCAAAGAGACAAGCUGACGUUCGCGUCAGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.571
medium
1000.0740.8820.4781.22511.90532.59941.86371.10061.62911.5322.140.89210.71140.12320.12180.060800.00111.09760.1132-0.0612-0.0592-0.05910.1431.17072.26552.37021.78291.61641.97310.16330.1297-0.00470.07360.0681.16841.01360.3009-0.11420-0.0570-0.0569-0.02340.04320.12150.26020.91461.10070.6250.86130.11420.0285-0.04520.10940.87090.4050.0253-0.0285-0.08340.16030.74571.33510.62950.0923-0.06050.0171-0.01940.10370.45240.71030.0811-0.0470.07870.19490.25750.27630.41890.67490.26340.38710.23750.67260.59580.59650.54960.46040.43050.43960.46230.3325
54
53Mat - Simplify D2Simplify by Tesla sDisciple2818353
GGAAAAUAAAGCGACAGAUAGGAUAAACUAUCAAGUAUCGUACGAAAAGUACAGAUACAAAGUCGCAAGCAUCAGUUCGCUGAUGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.908
medium
1000.0670.8990.4832.48921.38731.98062.46851.86032.64171.39911.18740.94020.59810.09670.0483-0.05560.0407-0.08370.78020.07510.0919-0.063-0.1166-0.00831.8992.65941.23441.90511.57292.25180.354-0.06490.20090.0287-0.20221.11971.31610.179303.00E-040.02552.00E-040.0762-0.0757-0.05040.07590.37450.86461.31620.61210.59270.15650.07260.01240.09170.51180.07690.1259-0.00760.055-0.05680.96680.9051.34080.3840.0730.09090.0544-0.00730.47870.65180.27410.13640.0364-0.02640.0530.06730.38471.03320.23550.30980.43640.67310.56150.50730.52670.45050.47540.38960.32580.3032
55
54HybridSimplify by Tesla sDisciple2725802
GGAAAAGAAAGAUAAGGGCAGGUAACACUGCCAGGAGGUGGGCGAAAAGCCUAACCUCAAAUUAUCAAGUAUGCCUUCGGGCGUACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.779
medium
89.30.0570.7250.3910.66371.29522.52731.8841.28151.26821.79722.15681.39520.95550.24110.35030.40630.04760.19220.15010.0092-0.0427-0.2199-0.02170.06080.51720.49150.5420.43870.0760.5479-0.0249-0.03070.1118-0.8514-7.11980.07420.65030.16570.02890.04980.04520.01650.0660.0165-0.00890.05670.22520.88571.21721.08450.68970.13580.01680.04190.41951.47240.62180.0696-0.0423-0.0438-0.0661.32241.40971.4210.41370.24220.36020.19330.14290.71520.82890.43370.07350.08940.03480.14740.11720.15260.45550.14480.13670.14830.40790.30110.33650.32920.2740.23560.25440.26860.2269
56
55wisdave SimplifySimplify by Tesla sDisciple2713139
GGAAAAUAAAGUGUCAGUCUGGAAUAACAGACAAGUGUCCUAGGAAAACUAGAGACACAAAGACACAAGUACAUUUUCGAAUGUACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.849
medium
98.70.0780.8840.4811.2181.87083.12212.46091.56862.07571.66781.97271.72171.09320.23560.14070.1390.1083-0.1341.23890.1434-0.0467-0.0931-0.00260.05471.0861.89382.281.24881.32331.61890.32810.0389-0.05-0.1238-1.17120.84541.24430.053500.05020.02660.05310.053000.10170.38990.70140.73871.26540.62480.15220.07930.02260.11680.46790.11020.0252-0.1329-0.02990.08250.83230.89550.69450.19630.15660.11590.0777-0.16070.48520.53170.10810.14370.1273-0.0103-0.14480.17880.47710.89930.27350.13540.75420.64730.58010.60230.50720.42310.4480.38270.39280.3774
57
56Simple 1Simplify by Tesla sDisciple2831237
GGAAAGAGAACUGAGGCAUCUGACAAAAGAUGAACUGUCCUGUGACAAACAGAGACAGAAACUCAGAAGCACUCAUUCGUGAGUGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.697
medium
94.70.0750.820.4470.3771.74032.151.75080.44161.1310.56321.2151.11150.64910.32070.0530.10610.05230.15770.20880.15570.1549-0.00180.20470.15271.69772.86660.67831.78791.49552.06240.35940.22930.30450.03971.03761.16520.82130.17190-0.0664-0.0506-0.022-0.0504-0.02180.07110.07090.5060.9390.83980.160.52830.1166-0.065200.12410.70010.36380.1028-0.017400.11610.90831.13140.6480.27410.03560.08380.02090.29030.52920.9440.24340.1159-0.00950.1243-0.00960.09520.57850.60260.13310.47090.27760.62060.55910.53320.44720.28560.36350.30730.32750.3409
58
57Fiskers simplify patchwork 2Simplify by Tesla sDisciple2725289
GGAAAUAAAAGAUACAGACUCGAAAUAGAGUCAAGUAGCCUAGGAAAACUAGAGCUACAAAGUAUCAAGUCGUACUUCGGUACGACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
1.668
medium
960.050.9380.4940.64551.53712.04632.03852.71791.61791.84731.70252.19980.85410.08740.30.0504-0.18640.17740.42960-0.1846-0.19140-0.21321.49242.01842.29172.15231.59121.83060.26960.0733-0.0215-0.4798-12.5090.15630.83240.1530.06560.02130.0327-0.0879-4.00E-04-4.00E-04-0.08750.13420.62980.85350.9791.33090.92190.08990.01080.05370.05360.89120.2317-0.01720.02120.0126-0.05090.89381.02521.37770.18180.15810.33130.17470.21750.57150.3337-0.18590.04150.08230.1231-0.10270.12220.73691.36520.12630.30720.58080.81990.77930.66030.65090.66870.53950.5390.50950.5052
59
58UsraleisbeSimplify by Tesla sDisciple2715039
GGAAAGAAAAGGGAGAGGGUAGAAAAGUACCCAAGAAGGAGGCGAAAAGCCUACCUUCAAACUCCCAACUUGGGCUUCGGCCCAAGAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
1.699
medium
960.0340.8630.4480.95920.68462.45711.15261.51041.69731.84261.76211.79150.2915-0.026200.0790.10490.15491.00340.07510-0.0298-0.06521.72252.55222.13762.10891.33891.2921.52490.50430.17060.0105-0.0641-4.74490.78760.94430.30710.07540.0762-0.077100.0760.03660-0.00130.50711.06241.06880.8790.66550.02060.03210.032-0.02310.83540.2457-0.4518-0.1273-0.01220.17970.89521.08360.81660.39830.0341-0.04510.02640.01510.34870.38210.2317-0.09040.10030.075-0.0202-0.070.09150.73850.12220.21410.21250.84820.71580.82810.57670.57080.60150.59380.59030.4757
60
59Minimal Student - Brourd - Lab Simplify R1 - Sub 2 (A few more G-C)Simplify by Tesla sDisciple2716916
GGAAAAUAAAGUAGCAGACUGGAAUAACAGUCAAGUCACGAGCGAAUAGCUCAGUGACAAAGCUACAAGUCUCAGUUCGCUGAGACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.819
medium
94.70.0590.8220.440.77151.04252.45192.05861.67872.18681.53931.29181.32781.41940.01320.1431-0.010900.12390.46610.0597-0.01760.0386-0.01760.09721.66111.91362.64191.47761.36991.77760.14340.10940.05880.05870.01310.12330.88830.41430.07780.03110.01640.61360.20310.11240.02250.0112-0.03740.24380.59690.61990.660.29160.04060.0608-0.01240.09070.0350.20470.066-0.05740.12370.6850.78820.79490.3250.106-0.1342-0.04920.03840.5831.21520.2850.22190.18790.0262-0.07330.06290.10870.72430.27510.39960.35910.53380.50320.5210.46230.41850.42680.3570.35260.3089
61
60Simply Perfect 3Simplify by Tesla sDisciple2732586
GGAAAAUAAAGUCUCAGUCUGUAAAAUCAGACAAGCAUGGUACUAAAUGUACACAUGCAAAGAGACAAGGCGACGUUCGCGUCGCCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
1.214
medium
960.0650.720.3930.10571.5721.53191.34991.5561.89510.76191.49791.00660.45170.15620.177700.11530.22881.24550.10840000.15381.52231.16840.38420.47241.0470.83970.08810.17520.1741-0.08360.26440.74590.718900.080-0.1629000-0.1620.35571.24750.82240.65830.62460.18390.160.06840.06830.27040.78910.4530.12890.0643-0.344700.4080.73370.59870.35480.05900.05890.07780.62850.03040.33480.01310.2748-0.09770.10930.1630.53321.26760.25120.44520.19651.24781.03380.78620.73930.74390.67460.76710.58310.6014
62
61Meechl s SimplifySimplify by Tesla sDisciple2741147
GGAAAAUAAAGAUACAGUAGCGAAUAAGCUACAAGAUACAUCCGAAAAGGAUAGUAUCAAAGUAUCAAGCUGAUCUUCGGAUCAGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.471
medium
960.0540.890.4720.72472.10452.42192.28141.54441.9271.65981.98421.73620.80420.23990.36540.28370.0515-0.22441.38530.4975-0.0115-0.0886-0.066-0.02740.90252.08742.07131.59621.3031.47990.13350.0117-0.0263-0.0144-0.05521.47250.86970.03950.00550.03920.03370.10090.0385-0.02840.06680.0460.24710.99590.97520.85020.02510.02710.09470.03640.09141.25360.36350.05740.0542-0.1578-0.01120.75171.20331.38410.33020.19790.0109-0.01240.12620.50820.71970.51890.23590.00580.09070.11110.12640.05170.51690.19660.34360.32720.71880.690.64140.59850.48110.49540.48290.46420.4043
63
62Simple ExperimentSimplify by Tesla sDisciple2827192
GGAAAAUAAAGCCAUAGUCACGAAUAAGUGAUAAGUGCCCUGCGAAAAGCAGUGGCAUAAAGUGGCAAGCUGGACUUCGGUCCAGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.828
medium
960.0610.8710.4661.28652.10432.65311.552.01831.73491.51561.40981.08860.9935-0.1490.04180.07380.06380.63631.27310.3930.2628-0.0889-0.1003-0.15520.73512.67582.50321.65361.11752.39220.05730.04890.19360.19060.36350.50040.90310.37270.12010.04360.060800-0.09910.02170.01740.08620.6330.48320.70820.55050.1418-0.0274-0.07390.01950.0925-0.0884-0.4447-0.4657-0.14970.15780.75210.731.02880.42320.26750.17020.1422-0.18590.53560.85270.32790.19490.07130.0943-0.02380.08820.31021.01310.21290.41060.48440.67480.5530.5390.4310.46410.44220.38910.32150.2871
64
63Hairdos IISimplify by Tesla sDisciple2732773
GGAAAUAAAAGAGACAGUAGCGUAAUGGCUACAAGCUACCUACGUGUAGUAGAGUAGCAAAGUCUCAAGAUGGUCUUCGGACCAUCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
3.749
medium
94.70.0670.7840.4250.84762.31841.93911.68772.21361.44581.77031.46371.23130.88480.14660.12060.07010.0201-0.1081.0730.2992-0.0197-0.484-0.050.02340.84170.69440.85210.57990.25220.98470.02620.0351-0.0047-0.02460.20940.47690.94580.32930.05420.03650.00850.53590.0059-0.01410.01780.0221.05351.53141.62831.61210.99650.39040.09860.06680.06710.54010.41550.1404-0.00770.03210.10020.55380.83521.12520.12610.0573-0.0345-0.01530.05480.56520.35330.08430.09320.10350.0335-0.02510.02750.43930.98110.15250.10930.22070.39510.38030.3530.32870.33910.28080.27630.27840.2354
65
64Mat - Simplify - D1Simplify by Tesla sDisciple2717272
GGAAAAUAAAGCUACAGAUAGGAUAAACUAUCAAGUAUCGUACGAAAAGUACAGAUACAAAGUAGCAAGCAUUAGUUCGCUAAUGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
3.112
medium
97.30.0830.9120.4970.5731.28582.34531.89421.51361.67411.67481.31741.19110.87410.050.13780.31440.13350.00520.6904-0.1281-0.01370.28430.19740.21012.00012.33011.35751.43181.75571.73250.36050.0780.05010.03660.08950.4590.9620.47040.19930.13271.01460.1186-0.03350.04730.06050.10020.07010.36190.98321.14790.66090.40870.04230.02110.06130.2010.31510.36940.21120.1130.1470.970.93361.02320.13720.10740.07840.10.06110.48340.62420.15960.10970.05560.00180.08610.1390.13871.09120.21060.38930.22880.56140.47890.51150.45270.41330.39130.35120.35480.3116
66
65Simply voteSimplify by Tesla sDisciple2724993
GGAAAACAACGAUACAGAUACGUAAAAGUAUCAAGCUGCCAUGUAAAGCAUGAGUAGCAAAGUAUCAAGAUGUACUUCGGUACAUCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.603
medium
98.70.0660.7230.3940.67460.1681.67161.4335-1.88120.85110.53391.29810.51140.51710.15050.26050.13750.05790.05390.85870.32920.1593-0.29950.0868-0.0440.99091.05361.02921.00980.66711.14390.08830.01610.08510.07650.33281.18060.83770.16150.150.0641-0.030200.07490.03180.01150.33791.35291.27240.8080.51690.68820.1335-0.0152-0.00760.10761.10010.31360.18090.10070.0968-0.00120.75840.87531.31090.32760.17750.13370.03660.18770.67710.39990.2970.1830.13470.22050.20980.00420.2360.59710.28950.32620.36810.54740.39930.37980.35630.55740.28080.2350.290.1707
67
66Fiskers simplify patchwork 2Simplify by Tesla sDisciple2725295
GGAAAUAAAAGAUGCAGACUCGAAAUAGAGUCAAGUAGCCUAGGAAAACUAGAGCUACAAAGCAUCAAGUCGAUCUUCGGAUCGACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
1.542
medium
97.30.0790.8690.4740.42142.18511.99421.76232.03051.54332.06481.05511.36451.06760.38140.1015-0.26680.1075-0.25850.4083-0.0653-0.0325-0.3138001.06132.19211.64932.33140.96921.1763-0.0449-0.2050.0709-0.2891-8.5345-3.94030.64660.34850.40910.06280.43530.09230.03070.0461-0.0127-0.06820.19970.83920.92381.18991.11320.38290.03440.05150.05140.44250.36210.149-0.01120.10520.01971.02340.95730.90590.22060.08680.065-0.12420.04570.54850.93710.30240.15860.11590.05580.31050.11430.40240.89130.27110.15050.48730.7050.68330.6050.54490.54520.4890.49130.44110.3884
68
67stickman 1Simplify by Tesla sDisciple2728186
GGAAAAUAAAGAUACAGAUACGAAGAAGUAUCAAGCAUGCUACGAAAAGUAGACAUGCAAAGUAUCAAGUAAUAGUUCGCUAUUACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.889
medium
98.70.0750.9650.52-0.05271.63781.90372.21491.22121.97972.29322.48731.31410.6189-0.12950.1930.15120.18870.03870.60080.28640.1036-0.09960.07230.16821.91312.47261.17172.88161.65122.66050.33790.14380.07670.02780.33011.15841.0881-0.05310.125700.0752-0.07820-0.1040.0250.02350.27170.72751.07431.01860.53920.16090.0214-0.05040.09060.9420.02080.0228-0.04670.0808-0.08390.70050.73431.19850.51470.00490.11930.00460.0010.6510.70380.32050.03840.20830.25510.00220.29580.20060.57090.13080.23510.31170.59120.55350.54060.50420.41960.46210.4840.46520.3407
69
68stickman 3Simplify by Tesla sDisciple2728193
GGAAAAUAAAGAUACAGAUACGAAGAAGUAUCAAGCAUGCUACGAAAAGUAGACAUGCAAAGUAUCAAGUGGUAGUUCGCUACCACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.687
medium
1000.080.950.5151.06211.99842.50971.41082.19762.00741.50941.47631.0561.28110.1890.44640.26180-0.22570.77780.2263-0.13810.1190.09440.07961.39032.76021.57391.95681.54612.47140.16380.2070.16170.04290.1730.77791.18540.13410-0.0055-0.05890.0801-0.05880.0477-0.0320.04750.36580.69631.11780.78760.88190.19710.0299-0.0461-0.07050.77030.14430.12760.021200.04240.55680.86531.09750.3030.0580.04020.07490.18690.29220.86740.19650.01380.11850.13460.1617-0.00740.42270.74910.28610.36410.74620.66030.60420.68570.50160.53790.47940.46990.3930.3298
70
691 GC pair 2Simplify by Tesla sDisciple2751552
GGAAAUAAAAUGAGCAGUUUAGAAAUAUAGAUAAAUUUAAUUAGAAAAUGGUAUGGGUAAAGUUUAAAAUUAUUAUUCGUAAUAGUAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
1.858
medium
800.1431.5730.8580.31341.57542.28792.29881.80862.38623.04091.74421.27022.46760.70791.07871.17051.12480.17551.8991.46550.93070.76470.73790.71721.36292.23341.31742.22180.91321.83850.82740.78821.28891.55550.87440.9539-0.75370.45881.49671.47710.29981.37240.32640.53150.58150.67940.35910.57331.21771.10291.08740.7030.48380.80020.72640.61320.97040.10250.26130.290.50310.64180.85560.78090.5671-0.19970.52220.24770.43140.75880.2520.06030.3157-0.0325-0.00820.07930.03130.24180.16870.86480.48580.34751.4611.33921.32321.30421.15781.15081.21780.91950.8009
71
701942Simplify by Tesla sDisciple2763381
GGAAAAGAAACCUGGACCUACGAAAUAGUAGGAGGCAUCCAUCGAAAAGAUGUGAUGCAAACCAGGAACCUAUGCUUCGGCAUAGGAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.511
medium
1000.0660.8090.4370.57361.86141.64261.10411.15250.42171.67241.72261.19510.20230.1150.05910-0.00630.03610.97910.04690-0.016-0.10920.0621.67521.95492.1751.26721.41982.47150.18970.1509-0.0905-0.0188-0.49290.28040.94380.09580.08440.02810.08410.0560.05590.08350-0.05050.34230.96311.00180.92850.49810.15120.03120.09550.02130.61980.06580.0692-0.0994-0.099-0.10171.52891.21010.99410.2292-0.1349-0.00890.079-0.16460.30.38020.12850.29970.15270.07990.03360.17810.42170.80930.20130.18750.74540.63080.48940.4210.46230.34940.27320.38290.37440.3202
72
71rna1234AUSimplify by Tesla sDisciple2765188
GGAAAAGAAAUAAAUAUAAUAAGAAAAUAUUAAAAUAUAAUUAAGAAAUAAUAUAUAUAAAAUUUAAAAUUUAAAUUCGUUUAAAUAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
0.676weak680.1261.390.758-1.2965.78283.76882.310702.138901.03110.99540.32841.8036-0.62013.89781.00290.24842.905400.65533.4588-0.04183.69410.72033.75730.41151.55690.16350.8576-0.3920.69820.5143-0.75931.08661.92631.80541.327300.77811.00131.79930.74230.2902-0.06650.9590.24810.1971-0.75680.76240.92250.07450.35750.52650.0560.83660.0396-0.87980.3662-0.21561.06890.723-0.10050.68841.0609-0.13580.23780.22390.7651.39950.4410.54080.16390.3150.4140.50830.20190.39820.69270.0956-0.1679-0.26732.3924.38533.49282.86351.32472.66191.25042.16162.0936
73
72StimplifySimplify by Tesla sDisciple2823017
GGAAAAUAAAGCUGCAGACUCGAAUAAGAGUCAAGUGACCAUCGAUAAGAUGUGUCACAAAGCAGCAAGAGAGACUUCGGUCUCUCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.131
medium
920.0810.8880.4851.03971.84852.23320.97441.85152.02951.26741.23431.50190.66390.11050-0.0240.067-0.09091.03360.1286-0.1807-0.02590-0.08980.56612.67232.39931.07541.39041.3776-0.2135-0.0863000.0022-0.40090.99921.10930.05010.11910.07921.70060.1846-0.08230.03690.03680.08560.3470.78240.95610.52060.4320.12980.16140.09650.12640.38670.2176-0.08050.0930.21530.54311.01871.25270.33020.10970.05620.1087-0.04980.60790.56650.45770.19370.19950.02070.22510.14560.49320.77870.38490.20240.40950.89480.75760.62880.48180.50110.5320.49280.42830.4045
74
73Simplified Design w/more GCSimplify by Tesla sDisciple2855990
GGAAAAUAAGGUGUCAGCAGCGAAGAAGCUGCAAGCUCGCAGCGAAAAGCUGACGAGCAAAGACACAGGCAGAUCUUCGGAUCUGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.41
medium
98.70.0420.7310.3871.18371.46080.75931.37481.49291.711.53731.42620.45491.05530.11240.0553-0.073500.10140.94180.03550-0.066-0.02010.04550.98352.16621.64991.6531.18751.49150.04210.09660.00950.0961-0.09840.74130.59750.095800.02980.0892-0.02380.1036-0.00900.01140.42060.72310.98960.67220.50340.10380.02590-0.08230.73770.2711-0.02720.02190.02450.14330.74850.49950.67120.18850.14880.03110.04410.01540.38680.37270.19090.06350.0970.0210.03360.14610.40221.16460.2220.32640.57560.59210.43450.53940.45550.38680.40520.34780.36010.2101
75
74ComplicatedSimplify by Tesla sDisciple2858531
GGAAAAUAAAGCAUCAGACGGGAAAUACCGUCAAGUCACCUGGGAAAACCAGCGUGACAAAGAUGCAAGGGACUGUUCGCAGUCCCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
1.78
medium
1000.0650.840.4520.86171.37352.17851.90442.00921.81191.47981.7331.42710.7820.04130.07340.04870.28780.14050.55880.0670.0924-0.4034-0.09490.09171.54451.46962.09161.35461.12392.0890.14120.1203-0.1706-0.5769-9.97320.37431.37630.05750-0.0255-0.0527-0.012700.05450.05440.13550.66330.78311.02331.09790.84010.16810.0990.07590.01330.38230.09670.0557-0.4397-0.11060.02790.58270.86690.78960.10850.12160.03980.04810.06760.49310.5510.18770.25980.21030.22580.14360.05290.1760.83340.24650.50710.4150.67350.61860.61760.5360.45860.42660.38650.39520.3302
76
75Looking Glass 2Simplify by Tesla sDisciple2861414
GGAAAGGGAGCUGAGGCCUCUGACAAAAGAGGAACUGUCCUGUGACAAACAGAGACAGAAACUCAGAAGCAGUCAUUCGUGACUGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.529
medium
960.0570.770.4140.91310.97581.91771.66050.34740.27260.42021.73910.76940.9237-0.02050.29210.123900.33460.2370.04730.1413-0.06930.09390.27892.08122.35320.721.78091.22521.84460.40170.1231-0.0362-0.0360.43340.75610.42340.05740-0.00870.0286000.02860.02850.22180.56660.51420.80970.56810.52990.14590.0997-0.04670.07020.91340.05480.07140.02380.07110.35140.97431.49480.46230.1031-0.1067-0.00120.22730.30370.6141.0370.49080.15420.07460.07440.04820.02950.48670.79280.15240.4960.71710.54480.39830.41370.37730.21190.24270.28870.36230.2596
77
76SimplicitySimplify by Tesla sDisciple2714039
GGAAAGAAAAGAAUCAGAUACGAAGAAGUAUCAAGUAUCCAACGAAAAGUUGAGAUACAAAGAUUCAAGCUAAGCUUCGGCUUAGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
3.03
medium
960.0961.070.5830.61451.71181.94881.31530.88921.53141.99762.21781.17870.9690.09110.39720.33910.16960.12071.00550.31380.41240.40460.07590.09911.24592.21661.6212.62361.722.42480.22720.04440.12630.0124-0.03020.45241.31880.92580.12780.27761.79430.07960.0515-0.02360.0514-0.12170.23210.59670.99960.68631.01220.84110.0701-0.02110.09120.31670.47840.07630.04220.19020.26731.13781.02130.76490.33880.33490.2840.20760.07810.74120.55940.19450.08250.050.0961-0.03760.12660.57330.96460.270.24690.31030.630.57960.55510.45620.40870.44380.49450.44150.3945
78
77steve s simplify 3Simplify by Tesla sDisciple2714072
GGAAAGAAAACUAUGACGUACGAAAAGGUACGAACAUGCGUGCGAAAAGCACAGCAUGAAACAUAGAAGCACACGUUCGCGUGUGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.124
medium
960.0750.9020.4881.68691.52990.20041.02081.67091.11842.3041.40011.16880.5645-0.1838-1.2396-0.22780.12330.70370.68330.05830.0581-0.01730.11560.27713.02652.42031.75861.01880.65250.75650.27180.07750.1541-0.02680.8890.88660.65220.02680.13650.06810.01130.01130.0340.0791-0.0370.03380.33420.65311.11440.81340.55350.14880.03960.06920.10121.12520.13990.0693-0.0143-0.01430.261.38621.08820.71240.18690.22870.26690.10330.21690.38920.47050.15620.0750.14140.1075-0.0018-0.00180.66131.15840.36750.32880.52410.83270.66520.60560.58830.50580.41540.48210.43810.4066
79
78JR_Simp_Rnd1_Sub1Simplify by Tesla sDisciple2714192
GGAAAACAAACAAUGAGUUACACACACGUAACAACUUGACUAGACACACUAGAUCAAGAAACAUUGAACAUCAUCUUCGGAUGAUGAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.716
medium
94.70.0770.8510.4641.05461.98892.01432.00151.69190.95290.63591.19981.41371.3830.24270.19260.47290.09280.57051.58620.25140.21390.20590.07830.04651.7950.71091.64420.40170.67640.53940.22250.08670.20080.01320.07830.74390.65890.2225-0.0465-0.0451-0.08990.19050.08210.08160.03880.09680.55051.24020.49380.73310.70460.43310.26890.12170.12120.70940.32940.18760.1382-0.01860.14070.84111.39950.93960.54520.28860.26580.16780.38910.89460.51830.2081-0.1405-0.01380.1747-0.05590.03640.47870.9770.32020.22380.27490.65190.50880.48550.46470.43120.32040.32680.35460.3633
80
79Fractions Simplify by Tesla sDisciple2718823
GGAAAAAAAACUCUGACUUCCAAAAAAGGAAGAACACUCCUUCAAAAAGAAGAGAGUGAAACAGAGAAACACAUCUUCGGAUGUGUAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.079
medium
960.0830.9170.50.66381.8715-0.16040.54452.03661.72051.57982.00941.44740.63360.2023-0.0160.10430.10391.00310.3957-0.0235-0.0347-0.01150.22590.07182.07682.02161.50810.78671.00150.92540.11520.069-0.056-0.0180.26350.32281.05690.30850.25750.20420.04080.040700.08120-0.02121.05591.08571.09281.05791.07430.51880.08620.0430.09650.52830.31160.09320.0537-0.01620.37540.65591.34550.98430.1191-0.0150.10670.053300.87780.78340.45280.11280.10150.1281-0.00210.05550.18920.9370.27070.20180.04490.92620.79380.6870.59950.61450.53110.50590.51950.4227
81
80Brourd ModSimplify by Tesla sDisciple2718935
GGAAAAUAAAGCUACAGUCUCGAAGAAGAGACAAGUGACCAUCGAAUAGAUGUGUCGCAAAGUAGCAACUCUGUCUUCGGACAGAGAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
3.143
medium
1000.0640.860.4620.20681.81162.04741.14531.94222.65642.01071.76261.4691.05050.08350.1558-0.05680.156-0.04261.30.26070.0578-0.0159-0.12020.11480.84522.69151.17511.75831.36331.21130.06330.04440.05870.0857-1.2020.90520.88950.23810.0640.0322-0.01640.0787-0.11550.01810.03630.00950.18790.69860.69671.24430.46830.15650.08430.07890.05950.72930.341-0.113-0.6418-0.1560.05730.6130.91581.12310.31970.14720.01990.06630.12150.50960.45670.19070.0120.08550.0731-0.08580.06060.1560.84120.24690.23520.23630.5860.45310.46570.35770.40480.38040.34310.30870.2568
82
81ArchimedesSimplify by Tesla sDisciple2724689
GGAAAAGAAGCUGACAGUCUGGAAGAACAGACAAGUCAGGUAGGAAUACUACACUGACAAAGUCAGAAACGUCUGUUCGCAGACGUAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
3.117
medium
98.70.0830.9090.4961.20321.41842.20951.29151.37440.74331.66721.20441.11390.54260.14480.24880.13770.09610.29361.13280.18210.1108-0.1529-0.05770.11751.81922.22770.95181.27111.32291.1090.28480.0969-0.00310.0285-1.85030.92781.1530.1290.0085-1.1695-0.41070.02030.08150.00980.02030.08760.58931.22321.12241.95210.53610.16170.12240.05990.1241.29960.2408-0.1294-0.0739-0.05820.09251.03761.01351.19990.57620.2286-0.05580.16790.45340.65280.92910.44130.18090.13330.10940.0690.0170.16750.60410.2180.38970.40880.57330.43040.42270.42690.31250.24920.30350.28490.2642
83
82SimplicitySimplify by Tesla sDisciple2725402
GGAAAUAAAAGAUGCAGCUGCGAGAAAGCAGCAAGCUACCUCGGAAAACGAGAGUAGCAAAGCAUCAAGUAGAACUUCGGUUCUACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.234
medium
98.70.0430.8210.4321.75061.93422.35261.60222.37211.94922.30281.42420.55810.70470.3168-0.2282-0.0252-0.0250.03740.7888-0.07470.2108-0.118500.04570.96571.11052.20952.01240.94541.7169-0.04420.04250.0124-0.0299-0.14921.14170.82140.11490.0382-0.06300.0381-0.03140.03800.07580.61510.99941.27641.26890.85240.12570.06270.0470.04020.93560.3871000.0890.14760.4980.78651.3645-0.01840.05310.0530.0113-0.11180.68740.65610.3630.0556-0.05150.04550.06370.28410.26240.35980.16270.07130.40130.77990.69390.66870.54680.57590.53250.50640.43430.3104
84
83IngediriSimplify by Tesla sDisciple2726511
GGAAAAUAAAGGUGGACGGGUGAAAAGACCCGAAGGUAGGACGGAAAACGUCACUAUCAAACCACCCAGCUGGCCUUCGGGCCAGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.897
medium
94.70.0580.80.4290.66051.17751.80491.691.98572.14391.4121.37850.79970.3179-0.00510.03060.03550.1160.12850.56470.02710.039100.11670.52671.83441.80111.52330.70440.52181.33580.51180.1496-0.01670.03850.61230.82830.57030.22310.05580.0922-0.01820.07330.0731-0.0183-0.10310.18090.48591.18311.07341.27030.29450.2533-0.02260.04-0.0161.12780.16390.16920.0121-0.08450.08641.11741.1770.81160.19690.058-0.00740.0326-0.21260.18690.27940.17460.1421-0.03950.0630.03150.05470.60410.36490.37810.5130.26990.51710.42670.47330.40620.38920.38470.3280.31660.308
85
84Simply BoostedSimplify by Tesla sDisciple2730748
GGAAAAUAACGAUGCAGAUGCGAUAAAGUAUCAAGCUGCCAGUCAAAGGCUGUGUAGCAAAGCAUCAAGAUCAUCUUCGGAUGAUCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
5.683good920.0890.9830.5361.00081.95252.24081.81271.77871.84161.37261.77920.69220.43450.16160.26290.17170.09210.1550.45110.42730.41510.18830.0283-0.0390.55152.10371.60671.92991.43331.7761.20870.59980.39110.76990.39210.36190.77010.61580.15080.13290.11790.43640.06570.06260.34011.08871.34661.07061.0840.79630.41930.2210.0955-0.21280.19970.50050.50760.43770.59280.21810.10630.4720.5870.66660.1280.01710.03560.0570.09870.64150.46370.1460.06220.04520.05450.00240.0920.25760.73130.21130.31090.39060.33210.30460.29610.25710.23790.24350.20140.21540.1414
86
85SimplifySimplify by Tesla sDisciple2750035
GGAAAGAAAAGCAUGACAUACGAAUAAGUAUGAACUAUCGAUGGAAAACAUCAGAUAGAAACAUGCAAGCAGACGUUCGCGUUUGCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
4.618
medium
93.30.0931.0260.561.14162.07812.20851.4010.93641.60451.90471.49411.03831.2120.184-0.05510.08640.19260.51760.68850.09280.22140.2205-0.02260.15811.18712.14192.52961.70731.62.16330.22960.05540.19960.040.16641.0662.08570.54720.13330.12421.72340.1445-0.0570.0416-0.0050.12620.22510.54930.7980.90560.95880.76840.09540.08320.11260.19510.6910.1590.35680.17480.31271.09831.06080.79010.05790.10460.01630.03680.08610.57450.63440.22770.08860.0103-0.00570.11330.23840.28870.68080.17310.39260.34850.45070.39370.37930.31540.23680.28930.30060.26610.2214
87
86BeariSimplify by Tesla sDisciple2751402
GGAAAAGAAAAUGGGACGGAGGAAAAGCUCCGAAGGGAUAAGCAAAACGCUUCAUCCCAAACCCAUACGUAGGGCUUCGGCCCUACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.796
medium
93.30.0190.8550.4370.03731.22121.26421.01720.71621.03631.03841.79531.69021.39080.7655-0.004000.11120.53030.01310.04660.0901-0.12541.42933.92862.70091.64760.95310.6720.70860.0580.029-0.0947-0.05960.87871.00690.41880.06430.06160.00880.02340.0669-0.0263-0.11270.16110.06791.44991.67031.91660.57590.38270.0183-0.0475-0.0372-6.00E-040.68590.09340.009-0.1825-0.1222-0.03390.83981.0730.55940.01940.0531-0.01610.07050.02130.51210.51660.40390.18840.0979-0.0525-0.13670.02270.52020.84170.09510.24410.58910.55260.46050.41380.38870.3480.32390.37820.43550.3885
88
871 GC pairSimplify by Tesla sDisciple2751544
GGAAAUAAAAUAAACAAUUUAGAAAUAUAAAUAAAUUUAAUUAGAAAAUAAUAUAAAUAAAGUUUAAAAUUAUUAUUCGUAAUAAUAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
0.828weak69.30.1641.8030.9841.36840.75574.00611.42893.73071.1922.20162.96220.954602.60462.22121.3425-0.1652-0.48762.0979001.33381.96160.69921.12512.09811.91330.91010.2180.86332.19320.63941.77260.6920.8910.95741.51171.8081.3301.51211.81030.15640.40280.68250.54630.10880.63851.7960.77671.47381.23420.68841.15620.9581.41680.78741.03780.68440.66850.90640.99990.79261.25981.1014-0.46151.04921.01231.16550.38330.62810.45490.0642-0.1123-0.2852-0.2806-0.18891.09610.2670.71480.5210.59743.94883.77614.23022.9023.43482.43692.7052.74451.9749
89
88rna1234GCSimplify by Tesla sDisciple2765192
GGAAAAGAAACCGCCAGGCGGAGAAAACCGCCAACCCGCCCGCAGAAAGCGGAGCGGGAAAGGCGGAACGCCGCCUUCGGGUGGCGAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
-0.066weak98.700.5630.281-1.68780.60490.99581.18271.11890.88551.04622.02740.930.4089-0.0339-0.8296-0.21150.0769-0.08210.25260.0504-0.0542-0.4093-1.4163-10.50720.02961.42551.37050.76620.67880.57990.0085-0.546-0.2647-0.04070.06270.80130.29470.1145-0.01930.0176-0.10840-0.02770.0175-0.02770.00451.03382.12071.51761.27951.17660.0266-0.0473-0.1401-0.3361.00150.2311-3.258-2.2134-2.3608-0.83230.25240.54770.39060.04160.0329-4.6071-0.3658-0.20560.15040.55420.14430.1640.0189-0.0639-0.04260.00950.27820.60670.29140.26940.22650.91160.6040.50810.42720.26370.40480.40550.29790.2305
90
89Simply DoneSimplify by Tesla sDisciple2811077
GGAAAUAAAAGUCUGAGACAGGAUAAACUGUCAAGACAGCUAGGAAAACUAGACUGUCAAACAGACAAGUACGUAUUCGUACGUACAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.593
medium
98.70.0430.8260.4351.10152.0621.60831.61811.951.5411.92441.2781.18841.02040.02670.0904-0.0273-0.13590.26880.9110.215300.0316-0.16190.31141.59052.61581.03321.70161.62741.4831-0.0467-0.01830.0049-0.0462-1.69451.10340.6287-0.10070.0433-0.0372-0.02890.0256-0.0208-0.02080.03020.23130.3551.01450.68461.07540.45380.0928-0.00360.01990.12971.28910.13320.11230.0408-0.06970.09240.58860.89210.67010.1284-0.0038-0.01480.0659-0.0040.45820.67310.25990.08490.12010.11960.25390.07440.51850.47770.35060.53940.57460.58380.57230.46610.49980.50460.42060.38940.33930.2905
91
90CB3 Simplify A1Simplify by Tesla sDisciple2828167
GGAAAAUAAAGCUACAGUCCCUGAAUUGGGACAAGGAUCAGCCGAUAAGGCUAGAUCCGAAGUAGCAAGAUAGUCUUCGGACUAUCAAAAGAAACAACAACAACAAC
..........(((((.(((((......)))))..(((((((((.....)))).)))))...)))))..(((((((....))))))).....................
2.853
medium
97.30.0430.6890.3661.21731.58611.82421.21362.02192.30311.14451.63041.02240.81960.0635-0.01380.0948-0.0350.03130.59720.15160.0303-0.038-0.06820.03760.38471.54481.84771.37911.37110.104900-0.713-0.1090.14781.06020.28140.06490.064700.04310.0645-0.01370-0.0488-0.02720.20580.73890.820.26740.18520.0358-0.0266-0.08610.10180.55670.06070.04150.03790.0035-0.07990.57320.90161.09040.24410.08470.10080.05020.19960.60020.60590.22150.06360.09370.20160.00810.09240.37660.99570.29430.22890.6980.54420.44930.4360.36150.35950.34230.30220.29860.2463
92
91Red crawling snail
An Arm and a Leg 1.0 by kcabral28
2714037
GGAAAUAAUAGACACUGGCGAAAGCACAGGUGAGCGAAAGCCACAGUCAAAUAAAUAAAUAAAUAUAAGUAGCACUUCGGUGCUACAAAAGAAACAACAACAACAAC
..........(((.(((((....)).)))(((.((....))))).)))....................(((((((....))))))).....................
3.665
medium
960.0841.0630.5730.13111.87221.35631.39140.7591.41881.06191.52630.98720.98450.22020.13410.29450.84940.22130.09930.15950.07870.19540.37971.64850.46010.58020.09530.02580.95520.29120.26030.70050.6020.23510.43061.65250.13250.10370.29640.6410.42570.40120.20.03470.04610.14380.40621.58990.27670.22110.42630.91281.3781.00481.08851.02490.86340.98971.11631.05840.99781.47460.79061.32850.93821.04631.06281.19150.90110.99660.9360.3440.04180.10370.0838-0.06460.04450.08440.50820.14960.25440.32030.4590.46080.36760.36040.27660.34810.30830.36160.2773
93
92Clear Complexion
An Arm and a Leg 1.0 by kcabral28
2794452
GGAAAAGAAAGCCAGACCGGAAACGAGUCGUCACGGAAACGGACAGGCAAAGAAAAGAAAGAAAGAAAGCAUCUGUUCGCAGAUGCAAAAGAAACAACAACAACAAC
..........(((.(((((....)).)))(((.((....))))).)))....................(((((((....))))))).....................
4.953
medium
93.30.0441.0880.5661.76671.3291.77541.28080.95991.2571.46581.44830.98610.84710.04160.05750.03470.20322.77680.38090.04420.10020.17440.47320.89681.23060.2299-0.1110.28560.70421.18410.55890.32531.05070.43030.67410.38330.06340.11190.34480.86611.49550.30420.010.0570.18290.22010.67030.26230.00830.0146-0.01480.85771.1541.10271.29911.74611.35121.00850.99440.93251.38771.25030.64721.10551.11681.06990.52440.84351.0880.80540.6650.05950.0728-0.01380.02610.01240.05260.23591.00690.17910.30140.28110.4440.33930.33070.30110.25120.25880.26850.26540.2206
94
93
The Cost to Puzzle - Brourd - Lab An Arm and a Leg 1.0 R1 - Sub 1 *Stable U bulges)
An Arm and a Leg 1.0 by kcabral28
2717258
GGAAAAUAAAGGCAGUCCCGAAAGGUGACGAGUGCGAAAGCCUCAGCCAAAUAAAAUAAAUAAAUAAACAGUCUGUUCGCAGACUGAAAAGAAACAACAACAACAAC
..........(((.(((((....)).)))(((.((....))))).)))....................(((((((....))))))).....................
3.709
medium
960.0510.9380.4951.43561.59641.70362.06382.34890.76071.43240.86590.55070.19060.09590.03270.12490.39690.19960.2201-0.076-0.03460.46310.40120.9160.28340.10430.08350.38160.82360.20360.1891-0.08280.21740.07940.28820.75639.00E-040.0234-0.08530.62150.49910.33230.10950.01440.09460.11770.07050.64350.43-0.00860.12360.54331.22841.85321.29561.01631.04261.24061.52950.91391.07691.33561.07291.38971.38361.16181.1870.76161.0610.69530.4205-0.02040.0513-0.00670.0163-0.02740.030.2010.94690.14850.43180.36910.51370.42090.38340.35770.37620.26060.30310.24430.2344
95
94Starry s Arm & Leg III
An Arm and a Leg 1.0 by kcabral28
2736585
GGAAAUAAAAGGCAGUCCGGAAACGAGACGACAGGGAAACCGUCAGCCAAAAUAAAGAAAUAAAGAAAGACUCUCUUCGGAGAGUCAAAAGAAACAACAACAACAAC
..........(((.(((((....)).)))(((.((....))))).)))....................(((((((....))))))).....................
2.833
medium
97.30.0870.9610.5240.48181.30082.08691.72640.91290.80740.74090.63610.36920.49150.19530.19390.07950.75170.46520.43150.09060.05040.39940.90261.35170.72540.28240.1630.31390.59820.35670.22030.10980.22610.38540.03710.37880.10320.10280.4721.13340.61230.35340.1960.04590.25980.12170.39230.9403-0.0794-0.01280.08820.79521.89270.73890.96210.59190.58770.53630.49611.31671.18971.05131.53411.05561.32951.14570.59081.13411.06930.77480.54870.16070.05240.19170.09230.04820.16320.20850.90620.17910.15760.31590.57860.46020.46120.40280.35440.35340.28860.240.2612
96
95Expensive
An Arm and a Leg 1.0 by kcabral28
2725382
GGAAAUACAAGGCACACCGGAAACGAGUGGAGUGCGAAAGCCUCAGCCAAACAAACAACAAACAACAAGUACUACUUCGGUAGUACAAAAGAAACAACAACAACAAC
..........(((.(((((....)).)))(((.((....))))).)))....................(((((((....))))))).....................
4.56
medium
98.70.0770.9320.5050.37491.3591.90341.39291.82681.67831.08090.71311.01540.23350.28390.1010.1140.06340.04280.14480.05930.05920.11620.84211.31370.8540.49170.12170.3381.67230.37870.0670.20470.15850.15260.13040.8806-0.0418-0.05720.23780.82370.35450.23290.0468-0.07460.06230.12610.21420.84920.0847-0.01060.18130.94961.5120.95350.61141.06411.32820.94570.60641.07961.08240.4161.3011.00580.72890.47420.86210.61930.53510.43310.72150.10710.07730.08120.0495-0.06850.09630.43590.99430.19990.28590.57050.36210.30450.28820.24640.25120.25010.20340.22080.1997
97
96Crawling green snail variation
An Arm and a Leg 1.0 by kcabral28
2732651
GGAAAUAAAAGUCAGUCCGGAAACGAGACCUGACGGAAACGCAGAGACAAAAUAAAAAUAAAAUAAAAGUAGUGCUUCGGCACUACAAAAGAAACAACAACAACAAC
..........(((.(((((....)).)))(((.((....))))).)))....................(((((((....))))))).....................
2.726
medium
89.30.0611.0780.5690.6071.11711.78350.98731.23971.64471.6227-0.03871.21241.5391-0.06680.161-0.06660.1069-0.0792-0.0256-0.1314-0.06550.10591.0871.51690.79820.63510.02580.22651.05210.1490.25340.22870.613700.07580.1214-0.29620.44680.45790.75641.05820.39160.40830.45230.44340.30890.8380.5881.10880.93720.1540.99971.08161.07941.09130.89491.0691.291.05891.15521.25581.02221.23921.131.05731.21871.03450.98270.54640.6070.68360.31630.1422-0.16570.0611-0.14840.13410.2690.58720.25960.16360.54950.62230.51580.50270.47320.49440.45910.42810.45760.3546
98
97Dennis Round 1.1
An Arm and a Leg 1.0 by kcabral28
2822712
GGAAAAGAAAGGCAGUCCCGAAAGGUGACGAGUGCGAAAGCCUCAGCCAAAGAAAGAAAGAAAGAAAAGUGUGUCUUCGGACACACAAAAGAAACAACAACAACAAC
..........(((.(((((....)).)))(((.((....))))).)))....................(((((((....))))))).....................
3.618
medium
94.70.0870.9610.5240.08132.11132.25911.64191.21150.56341.74311.42231.03130.44260.13550.0943-0.06070.53620.24450.12930.06450.02430.44360.31981.00050.4240.14740.0380.16440.73840.15780.17630.06850.07370.20630.42780.66440.13060.06520.33290.96140.35170.28420.19150.07160.12760.03250.07090.74910.17610.06790.22290.85121.16891.15781.09471.29951.23720.64321.2561.45391.02020.49361.0391.53381.03070.9341.29341.14090.96560.60110.92920.32710.1125-0.01920.032-0.0191-0.08570.09270.60080.16530.16710.14880.49010.41940.40850.34570.34940.26540.30920.29340.2412
99
98follow wilf
An Arm and a Leg 1.0 by kcabral28
2753937
GGAAAAUAAAGGCACUCCCGAAAGGUGAGGACACGGAAACGGUCAGCCAAAUAAUAAGAAUAAAGAAAGCAAGUCUUCGGACUUGCAAAAGAAACAACAACAACAAC
..........(((.(((((....)).)))(((.((....))))).)))....................(((((((....))))))).....................
2.748
medium
93.30.1011.1450.6230.43271.56371.96332.59032.38141.85421.20090.63490.98350.66510.16670.21720.39280.177500.28120.13990.14240.20680.410.46590.70930.06350.12810.43830.73560.17830.02020.32030.46290.25670.261.40630.15230.08750.70691.1980.80820.3821-0.01530.25910.39230.24480.42221.06080.1338-0.12060.25660.83721.83590.90261.15451.37351.6041.35331.13960.85781.72131.60091.45741.18081.07480.94410.69221.08870.95451.01330.88650.18140.09610.07840.08520.00250.10150.14350.70460.17910.19410.10290.68310.63660.61510.63180.59480.50910.48470.39760.3547
100
99A Hand and a Foot
An Arm and a Leg 1.0 by kcabral28
2841308
GGAAAAUAAAGCCAGUCUCGAAAGACGACGCAUGCGAAAGCUGCAGGCAAAUAAAAUAAAUAAAUAAACAGACAGUUCGCUGUCUGAAAAGAAACAACAACAACAAC
..........(((.(((((....)).)))(((.((....))))).)))....................(((((((....))))))).....................
5.378good920.0831.0970.590.72021.39421.90891.40622.02271.35770.81610.69340.27980.50790.14560.10980.09711.75940.01240.03070.1531.0971.28071.85841.21890.67050.58290.17680.1650.34230.84820.45390.42290.06240.10830.70711.01320.16040.03220.11240.45550.36090.29540.23350.03380.14140.15380.17260.38430.32640.18120.11150.33711.8331.70990.66960.70040.89291.07331.32811.30061.03331.22091.27341.29161.34550.96971.1960.90561.01220.7330.68830.12120.03410.04820.01170.03070.08270.19430.78910.11280.31980.25170.37160.29860.30340.26840.28440.24540.21650.17430.1443
Loading...
Main menu