R94 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79X80X81X82X83X84X85X86X87X88
2
1JR_3BranchJunction_Sub1Three Branch Junction - AAAUAAA5542046
GGAAGAAGAAUAACAAAUAAAGAAAUAAACAGGGUGUUUAUUUCAAAUAAACUUAUUUGUGGGACAAAUAAGAAAUAAAGUUAUUCAACUGUAUCUUCGGAUACAGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.758
medium
93.70.0570.6350.3460.45881.00540.79760.43761.11630.87560.52870.0810.02350.02080.11730.07030.05720.10380.08030.51530.68160.56710.20420.15850.25760.06760.022500.02250.02250.0450.02250.0450.07670.63420.77722.67111.90751.10490.0883-0.0058-0.00580.02030.0881-0.013-0.00580.02020.12110.19830.28060.46860.8870.62490.48240.250.03130.03840.03840.01920.00620.01920.05750.30520.80170.57650.61772.43390.9510.11070.14560.11480.15790.0880.15760.19170.19140.49610.68371.07310.54680.58720.34980.60490.1210.19520.10560.34760.18380.11270.14771.09160.5549
3
2JR_3BranchJunction_Sub2Three Branch Junction - AAAUAAA5542048
GGAAGAAGAGUGACAAAUAAACGAGUGAGCAGGGUGUUUAUUUGAAAUAAACUUAUUUGUGGGACGAGUGAGAAAUAAAGUUAUUCAAGUGCUACUUCGGUAGCACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
4.561
medium
68.40.1121.2290.6710.38230.46170.17430.24660.18680.3130.11950.34710.13570.15950.04820.69340.69640.29140.72240.38351.00530.5210.65170.77890.23390.21190.67470.8990.99660.25291.2331.02340.28710.57430.08960.3630.77040.86141.02330.610.95650.2760.7661.25841.21961.02350.29521.79852.57391.05141.2020.70960.9030.72160.53520.57450.64160.52120.66060.26460.27950.50650.6640.26480.21750.35570.89790.47550.34680.73860.98541.27920.18180.65950.83082.00721.47820.80591.58920.89771.50291.02811.50380.82590.79560.45591.35131.40590.48370.33690.54390.8011
4
3JR_3BranchJunction_Sub3Three Branch Junction - AAAUAAA5542054
GGAAGAAGAGCGACAAAUAAACGAGCGAGCAGGGUGUUUGUUUGAAAUAAACUUGUUUGUGGGACGAGCGAGAAAUAAAGUUGUUCAAGUGCAAGUUCGCUUGCACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.758
medium
84.20.0840.9270.5060.21610.63540.14450.26020.1980.32690.19640.16260.37740.053900.22670.26740.20290.46640.31650.7310.49760.51480.66310.30480.15210.60320.62680.09950.12420.51780.5870.38920.3390.04840.24120.53841.0770.23430.060.24050.62540.12780.45950.57390.51690.18110.71420.90690.70340.97260.63471.06130.37260.20650.79250.28320.04050.26190.10040.28080.51780.47330.17680.14950.35150.98120.17170.07680.24730.49070.41520.15071.25840.42321.22221.66811.38462.31250.67291.12291.84161.87070.34980.10290.24550.28530.24360.27310.81941.26131.5145
5
4Three Branch Junction AAAUAAA - AU closing one stem Three Branch Junction - AAAUAAA5543246
GGAAAAAGUUGGCAAAAUAAAGCAUGCUACAAAAUGUAGUAUGCAAAUAAAGGACUAUGUAAAACAUAGUCCAAAUAAAUGCCAACAAGCAAUAGUUCGCUAUUGCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.581
medium
83.20.080.8750.4770.38810.70161.15430.63570.37940.62690.62160.37100.12350.123300.1230.12280.22550.66661.30920.11880.11860.1184000-0.080200000.11820.46991.83231.15821.89131.18510.8518-0.079900.1063000.106200.1060.10590.31621.24310.84060.30550.40510.20200.021100000.100700.42050.39790.98140.77670.86340.19140.09560.095400.19040.11030.18940.1094-0.23950.55870.46261.54940.360.62460.35520.70340.09691.05750.25760.51150.42970.25310.58580.62421.1848
6
5Three Branch Junction AAAUAAA - AU closing two stemsThree Branch Junction - AAAUAAA5543257
GGUAAAAGUUGGACAAAUAAAUCAUGCUACAAAAUGUAGCAUGAAAAUAAAUGCCUAUGUAAAACAUAGGCAAAAUAAAGUCCAACAAGCUUAUGUUCGCAUAAGCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
7.624good92.60.0330.5320.2820.90541.15531.09530.95880.79430.68160.96890.34170.53440.05750.0670.06410.03270.07670.25380.42430.6260.30180.20610.13450.30480.0185-0.0061-0.0046-0.00460.00620.02460.01380.03380.44351.32131.37372.03461.27330.65920.08610.07770.02770.03330.04720.0120.00190.01570.18680.2430.66751.07860.48660.41570.37280.32640.08380.005900.00527.00E-04000.06340.80.7250.51440.54360.55140.03130.0150.010.0050.02160.0150.02950.21180.30890.4241.01760.38770.40610.24870.34740.08090.15230.02390.01210.10190.04740.18910.70480.5465
7
6Three Branch Junction AAAUAAA - AU closing three stemsThree Branch Junction - AAAUAAA5543263
GGUAAAAGUUCGCAAAAUAAAUGGUGCUACAAAAUGUAGCACCAAAAUAAAUGCCUAUGUAAAACAUAGGCAAAAUAAAUGCGAACAACGUUAUCUUCGGAUAACGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.773
medium
93.70.0240.6030.3141.22421.68910.89171.32890.8790.76260.59980.16510.38810-0.0341000.13790.26590.51041.28250.54950.69680.25280.41450.024400.0244000.0730.00740.09720.53771.44191.73062.40951.25441.35520.26160000000.06420.08990.3870.7991.32450.53940.34980.44540.46270.060300.02010-0.033900.00320.04020.97860.73730.57340.65920.6129-0.00820.057100.0022-0.01690.0190.04020.15190.40030.61741.090.76010.53450.37870.42990.04180.08910.07120.0730.24790.17670.11540.6390.3136
8
7britboy1Three Branch Junction - AAAUAAA5544985
GGAACAAGGCCCGGAAAUAAAGGGCCCGGCAAAAUGCCGGGCCCAAAUAAAGGGCCCGGUAAAACCGGGCCCAAAUAAACCGGGCCAAGCCCGGGUUCGCCCGGGCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.022
medium
87.40.0190.3980.2080.31960.80071.11330.62380.36750.40950.27830.074400.02990000.00520.01541.5860.43420.33940.19090.11910000.02380000.02380.04760.24531.05480.47561.9970.76170.55860.08840.04420000.0221000.02210.37350.75020.9020.44420.42390.0635000000.0212000.02120.83690.74550.86960.47770.40430.060600000.06120.04030.06040.30180.6360.6890.31350.17590.23370.21360.01940.0388000.038800.0870.54770.4963
9
8britboy2Three Branch Junction - AAAUAAA5545004
GGAACAAGUUUUUGAAAUAAAGGAGGAGGCAAAAUGUUUUUUUCAAAUAAAGUUUUUUGUAAAACGGAGGACAAAUAAACGGAGGCAAGAUUAUUUUCGAAUAAUCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.439
medium
75.80.181.9781.079-0.1101-0.01390.42130.30960.41640.82351.21460.80080.39821.17530.77521.144500.56780.93410.26270.6270.97870.36070.2503001.40780-0.1084000.697100.81470.68080.95311.26450.32810.65042.40380.31260.31130.61720.6120.60691.77630.29490.5851.71350.84681.6550.54750.32851.59450.94040.2610.51830.514600.25641.01131.96781.20941.77782.50262.8422.431.14390.20740.41240.61340.60830.09520.99711.75160.77021.50852.10573.89892.34772.55862.11730.3511.27630.42171.20050.98342.92462.61791.57613.0371.1308
10
9HighlandThree Branch Junction - AAAUAAA5548349
GGAGAAAGUUGGCAAAAUAAAGCAUGCUACAAAAUGUAGUAUGCAAAUAAAGGACUAUGUAAAACAUAGUCCAAAUAAAUGCCAACAAGUAAUCGUUCGCGAUUACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.611good92.60.0180.4090.2130.22160.5860.27310.60640.86790.44750.5390.09770.03060.03670.09960.02030.04270.14390.26870.33790.45940.16480.1130.09130.16650.01780.007800.00590.00590.00590.00780.01440.32531.12881.1091.48741.09940.85820.00950.00550.01090.01220.02180.00550.01090.00340.02510.17250.44690.50130.25580.20360.20190.09550.01180.0053-0.00410.01060.001200.01590.09790.69330.55930.49510.33890.44610.07320.010200.0010.0020.02040.00710.05140.23960.48660.74860.3970.34060.24840.20190.05060.14260.05360.2110.09470.10440.17010.58830.8939
11
10MorningThree Branch Junction - AAAUAAA5548361
GGAAGAAGAUCUACAAAUAAACUAGCGAUCAGGGUGAUUGUUAGAAAUAAACUUGUAUGUGGGACGUACGAGAAAUAAAGUAGAUCAAGUACAUCUUCGGAUGUACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.487
medium
89.50.0610.6670.3640.25280.81990.78250.59360.78250.78310.38930.05350.13350.02670.00220.014400.02880.22680.59370.71930.37670.32940.25110.1540.03910.02560.0512000.02560.076800.01330.68470.55321.50121.29180.81210.22510.23330.19740.08040.19680.19540.00840.12760.31760.34160.71770.70880.27810.38990.34350.1210.042300.19890.41520.15340.24030.11880.68851.12680.63230.79891.42380.32180.08110.41340.21110.18050.08010.26950.18490.58020.80050.80341.4110.5510.67310.53230.98880.3140.12660.01810.18930.37360.04180.33581.15851.1248
12
11AranesaThree Branch Junction - AAAUAAA5552712
GGAAAAGCCCGUAGAAAUAAACAUGAUUACAAACUGUGAUUAUGAAAUAAACCUCCGGGUAAAACCCGGAGGAAAUAAACUACGGGAACACCCUGUUCGCAGGGUGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
7.014good94.70.0270.4170.2220.43351.18571.01880.81890.490.3980.36220.0271-0.01110.02580.09720.22010.030.14940.11380.42960.92790.3570.23660.17820.11560.01530.00580.00580.0115-0.00130.03180.03470.06620.12221.31251.62291.13250.51820.53970.04810.00530.01930.04910.04590.03310.0320.00530.08520.22390.59420.9740.15730.17480.22820.04630.00510-0.00850000.00260.03170.6140.5060.6160.62860.43560.12830.005607.00E-040.02530.00560.00560.06290.28580.42050.81330.42430.25790.21220.15670.1880.11720.0671-0.003300.00940.1070.41090.4625
13
12UsradiesThree Branch Junction - AAAUAAA5553573
GGAAAAGGCACGAGAAAUAAACUGAUGAUCAAUAUGAUUAUUAGAAAUAAACCCUCGGGUAAAACCCGAGGGAAAUAAACUCGUGCAACACGGUGUUCGCACCGUGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.942
medium
94.70.0010.4430.2220.3271.91350.83790.61980.36360.1830.44710.07570000.030300.06810.15080.6131.15240.24110.14620.29120.1453000.0065-0.045100000.0581.2272.33381.32861.63020.37290.02640.08270.026300.02630.039400.03940.15730.1830.50631.36290.33240.22740.25180.10060000000.01260.16310.76950.51760.6111.03590.40860.02390.0239000-0.022500.01480.27520.61491.06990.27980.18530.29880.09185.00E-040.06885.00E-040.103-0.03345.00E-040.15980.66720.5497
14
133Branch1 M1Three Branch Junction - AAAUAAA5574863
GGAAUAAGCUAUGCAAAUAAAGCUAGAUGCAAAAUGCAUCUAGCAAAUAAAGCAUGUCGUAAAACGACAUGCAAAUAAAGCAUAGCAAGCUGCAGUUCGCUGCAGCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.407
medium
88.40.0390.5560.2970.70741.78321.00491.7171.19011.04490.89180.0938000.0468000.04680.14020.67130.28150.27540.31990.27320.090900-0.03200000.04541.39361.65440.60441.70750.93640.87220.44930.1223000000.04080.04070.08140.50130.92420.43560.35470.35290.23450.03910.07810.03900.077900.0070.07780.56610.85780.4170.6760.410800.074600.00540.07450.14870.07430.07420.22190.62330.80170.40050.43350.49770.42410.141100.01370.11540.1084-0.06340.16050.74370.6536
15
143Branch1 M3Three Branch Junction - AAAUAAA5574913
GGAAUAAGCUAUGCAAAUAAAGCAUAUAGCAAAAUGCUGUAUGCAAAUAAAGCAUGCUGUAAAACAGUAUGCAAAUAAAGCAUAGCAAGGUACUGUUCGCAGUACCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.394
medium
86.30.0650.7180.3920.72491.44280.66741.36371.05630.48310.93530.69560.05350.05340.02670.080.053300.84310.15770.47010.5330.3610.20570.256200.065300.06520.20380.40540.10120.12630.42680.89230.51661.83241.0860.74770.69430.23070.02310.115100-0.0370.0460.0460.13771.13730.35950.27630.4447-0.06610.3170.044200.088300.044100.1980.11690.39971.59960.97620.5831.16780.34660.20330.08120.08120.16190.16160.08070.32140.57790.92680.97330.42550.49730.45960.52750.03770.03870.2250.26160.11190.29720.53480.9990.8076
16
15salish99_AAAuAAA_02Three Branch Junction - AAAUAAA5580634
GGGAAAACAACAUCAAAUAAAGAAGAUUUCAGAUUGAAAUCUUCAAAUAAAGAAUCUCGUGAUACGAGAUUCAAAUAAAGAUGUUGAACCUCAUCUUCGGAUGAGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.99
medium
93.70.0430.6240.333-0.22030.41881.07890.80520.77890.64340.35850.10950.046600.05550.046500.06970.21990.56280.62980.56470.13470.20220.29090.00720.02240.022400-0.02310.04470.06690.09630.57483.92533.44241.22270.47970.10110.03870.0290.04290.00970.038700.01930.11030.28670.65090.44240.43940.29350.27020.33390.044-0.01510.09250.0370.07730.05540.10470.21130.55012.47432.58311.44110.34920.06760.0180.0330.01650.13190.09880.00140.11510.29470.61790.61340.35220.2720.2550.26910.09480.09840.01730.06510.11070.12740.38961.2560.5097
17
16AAAUAAA Sub 1Three Branch Junction - AAAUAAA5584013
GGAAGAAGCAUGCCAAAUAAAGUUCAGUUCAAAAUGAGCUGAGCAAAUAAAGUCCAUUGUAAAACAGUGGACAAAUAAAGGCAUGCAAGGAGUCCUUCGGGACUCCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.025
medium
91.60.0450.5410.2930.13770.77761.04020.57031.37890.79020.80070.15590.10380.051900.071-0.03250.10340.15480.22460.71280.22120.25280.15140.30150.05020.01770.017700.017600.05010.34880.64211.86751.33622.18671.39120.14670.13410.13380.0446-0.032400.04450.04450.08890.08880.22140.52750.49130.13070.17380.22740.172800.0970.04310.043100.0430.0430.08590.76530.69480.57320.27950.92370.12290.0410.1227-0.06460.04090.04080.08160.04080.20330.17050.85630.55620.44140.39260.27380.23390.0390.13610.05830.16160.11610.35270.98710.383
18
173BranchJunc-IIThree Branch Junction - AAAUAAA5602881
GGAAUAAGGAUUGGAAAUAAACGAUUGAACAAAAUGUUCAAUCGAAAUAAAGCAACUUGUAAAACAAGUUGCAAAUAAACCAAUCCAAGUUAUAGUUCGCUAUAACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.036
medium
86.30.0020.4390.2210.51931.04890.83460.89920.51430.89890.2614000.04870.04870000.16320.49910.76310.06420.190.18950.1890.0944000.04720000.09420.34391.57310.40182.05851.31590.78530.15010.1070.128200.04270.04270000.01170.50830.93040.30190.12460.04150.371700.04130.04130-0.06180-0.03090.22620.5510.64720.32220.8360.4353-0.022200000.0790.07890.03940.11810.43860.59740.30880.26920.27560.15290.250.03800.1210.151400.20760.37010.9686
19
18AAAUAAA 2Three Branch Junction - AAAUAAA5602983
GGAAGAAGUAUAUCAAAUAAAGUAUAUAGCAAAAUGCUAUAUACAAAUAAAGUAUAUCGUAAAACGAUAUACAAAUAAAGAUAUACAAGUAGGACUUCGGUCCUACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.184
medium
85.30.0520.7020.3770.39591.43650.47570.1121.35040.76771.94270.44560.29580.147600.2940.07340.21960.29170.7220.28760.14350.14330.42720.142100000.14190.141600.0490.56091.91150.2722.02091.07740.77140.256200000.12790.1277000.69540.59690.74380.49250.15360.48750.2721000000.121100.12090.59940.59450.47250.70190.23320.11640.2321000-0.091600.02440.36910.79710.13580.56320.35660.11180.44430.33170.54870.32770.54220.32390.10780.42860.75621.6559
20
19tbjaaauaaa-2Three Branch Junction - AAAUAAA5617668
GGAAAACGAUCCUCAAAUAAAGGUACAUCCAUUUUGGAUGUACCAAAUAAAGUGCAUAGUUUUACUAUGCACAAAUAAAGAGGAUCAACACCUAGUUCGCUAGGUGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.673good91.60.0210.4230.2220.34731.23311.06910.78310.78990.30620.21650.0350.10790.04040.04710.00360.0410.0320.29910.310.48750.46110.20730.15370.23470.1181-0.0110.006500.03190.0140.00650.00650.01951.85781.47381.40580.90090.26580.0060.02390.03080.01790.02980.02090.01490.02380.06890.20860.43430.47270.21210.17260.11050.140203.00E-04-0.0110.01190.017700.02030.66630.96691.29910.79761.08490.29110.09140.03220.01610.00540.00540.02690.00540.0830.17130.38340.66070.38220.25080.20510.24590.05130.03080.02070.02530.08220.18520.27230.62850.3568
21
20tbjaaauaaa-3Three Branch Junction - AAAUAAA5617670
GGAAAACGAUCGUCAAAUAAACGUACAUGCAUUUUGCAUGUACGAAAUAAAGAGCAUAGUUUUACUAUGCUCAAAUAAAGACGAUCAACACCUUGUUCGCAAGGUGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.362good91.60.0140.4050.2090.50280.97370.72280.80840.76130.22470.23870.02760.01380.00690.00790.02170.00790.03540.14530.42430.55240.17160.19540.16310.02779.00E-040.0210.00760.00670.00170.00670.00670.00760.03531.47281.34571.16230.80710.56590.04390.006200.006200.00660.00930.00930.02170.12120.35530.53310.31810.52740.22010.22840.0365.00E-04-0.0058-0.005300.01223.00E-040.54490.78890.95530.90881.25270.33910.03590.01120.00560.00560.0220.01060.01640.05550.36680.26570.61110.30240.2160.16290.20210.03410.04250.0050.04290.04710.09710.32850.61910.4096
22
21Mat - Three Branch Junction - AAAUAAA -D1Three Branch Junction - AAAUAAA5622679
GGUAAAAGCGAUACAAAUAAAGUAGUUAUCAAAAUGAUAACUACAAAUAAAGUACUAUGUAAAACAUAGUACAAAUAAAGUAUCGCAAGGAUUGCUUCGGCAAUCCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
5.451good94.70.0090.390.21.05281.30421.08071.29860.69970.49310.66170.0373000.00930.02050.0186-0.00170.12080.33470.38980.1630.18470.11870.23660.00170-0.0037-0.00940.009100.02730.00910.22541.68721.3092.13131.29510.59610.09920.098208.00E-040-0.00740.00168.00E-040.04250.33780.26160.76720.29050.26250.17510.22940.0480.00840.0079-0.00680.01630.00840.00790.09861.00050.70810.48980.47860.49770.0254-0.00730.00756.00E-040.0150.045300.03430.12390.30240.53740.30610.20950.19050.33540.05830.01460.05820.02180.01450.05090.0580.59390.2188
23
22AAAUAAA! :PThree Branch Junction - AAAUAAA5626209
GGAAGAAGAUCUACAAAUAAACUAGCGAUCAGGGUGAUUGUUAGAAAUAAACUUGUAUGUGGGACGUACGAGAAAUAAAGUAGAUCAAGUACAGCUUCGGCUGUACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.554good90.50.0440.5210.2830.56551.01630.70940.48591.04270.84160.46180.10540.31980.25670.02790.08210.04650.06930.24790.52090.33640.12820.23940.23460.1040.00630.0057-0.00340.011400.02630.01880.01880.10790.48570.411.40241.27540.42010.03850.06650.02790.0070.02110.02790.02450.02090.0490.19820.42480.53810.3850.2310.38510.11120.01990.04040.07410.04370.04710.07720.06370.48971.27980.92090.6151.18330.70740.90210.11010.0451-0.00340.00610.03340.06410.16730.44570.70711.04120.47970.56750.22750.3680.35980.36760.09070.09680.23920.11970.27710.94021.033
24
23AAAUAAA! :PThree Branch Junction - AAAUAAA5626241
GGAAGAAGCAUGCCAAAUAAAGUUCAGUUCAAAAUGAGCUGAGCAAAUAAAGUCCAUUGUAAAACAGUGGACAAAUAAAGGCAUGCAAGACGCUCUUCGGAGCGUCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
4.231
medium
86.30.030.6790.3540.28831.04130.73090.61491.18410.5840.85190.0211-0.01540.04230.02680.0396-0.15210.01790.44960.66541.00070.64450.40990.17970.57450.2610.1314000.25930.42610.46861.07140.67511.97252.05462.42881.38830.5560.1520.18340.33190.57860.18180.56330.46150.29260.60870.88310.88770.83060.610.33370.28680.4799-0.01540.05990.015-0.015200.0299-0.00760.08950.99380.95240.48390.43790.88640.01230.01420.028300.01420.0707-0.01980.02640.36690.67450.75660.63440.50550.40330.15930.0520.01340.15870.09340.01170.02670.21190.79930.6989
25
24AAAUAAA! :PThree Branch Junction - AAAUAAA5626257
GGAAUAAGCUAUGCAAAUAAAGCAUAUAGCAAAAUGCUGUAUGCAAAUAAAGCAUGCUGUAAAACAGUAUGCAAAUAAAGCAUAGCAAGGUAGGCUUCGGCCUACCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.304
medium
81.10.0450.4940.270.70252.04950.73291.01520.29830.96080.66640.18990.094800.18920.0945000.09430.21910.8360.18530.27690.0922-0.06280.092100.09200000.18340.54621.25250.35611.84440.8991.07510.16820.08400.083900.083800.08370.33320.08320.82270.76880.11810.08090.08080.08070.0806000.16090000.24060.63590.47380.85840.38810.61570.0290000.15330.0766000.60730.45270.44990.14960.22380.07450.38210.14780.07380.22080.25670.25580.0730.57950.36040.2156
26
25FrostbiteThree Branch Junction - AAAUAAA5628220
GGAAGAAGAUAUACAAAUAAAGAUAUAUGCAAAAUGCAUAUAUCAAAUAAAGAUAUACGUAAAACGUAUAUCAAAUAAAGUAUAUCAAGCUGGACUUCGGUCCAGCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.078
medium
87.400.490.2450.6330.90670.48410.12920.88470.65750.2185000.217900.0142000.43250.32290.32150.32010.31870.21180.105800.1056000.105500-0.04720.47621.44290.81071.97181.06850.95860000000.04790.047900.19190.37940.6580.37410.0934-8.00E-04000000.1861000.23190.96090.45470.3620.53890.089700-0.0939-0.848-0.29890-0.09050.17550.77670.34521.09150.582-0.09580.25090.49830.57670.08230.24610.08190.40730.16260.16220.56330.4797
27
26britboy2Three Branch Junction - Sequence Mutation 15545024
GGAAUAACGGAGGCAAAUAAACUUUUUUUGAAAAUCGAGGAGGGAAAUAAACGGUGGGCUAAAAGUUUAUUGAAAGAAAGUUUUUGAAGUGAGGGUUCGCUUUUACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.157
medium
72.60.1341.4760.8050.74440.73690.36660.72590.71870.7117000.35410.70140.3490.34730-0.33490.34570.3441.01770.3377000-0.3334-0.16630.66910.66301.62051.27370.3170.62860.31290.92690.91520.3038000000.302500.30130.28321.03310.70930.29042.52331.58140.80990.5359000.5320.52810.524301.12320.60040.34241.48720.73610.96840.0781.1868-0.1631.16770.464101.1420.22770.67671.81241.92271.46530.46042.21352.33711.17630.38031.87190.41042.30352.06592.96730.73222.12550.92741.6686
28
27britboy3Three Branch Junction - Sequence Mutation 15545028
GGAAUAACCCGCCCAAAUAAAGGGCGGCGGAAAAUCCGCCGCCCAAAUAAAGGGCGGGCUAAAAGCCCGCCCAAAGAAAGGGCGGGAAGGGCGGGUUCGCCCGCCCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.342
medium
90.500.5710.2850.6310.98450.680.72250.240.47690.355900000000.35420.70160.11670.11660.23240.1160.115800000000.0579-0.02781.93791.21581.4091.29690.73670.10510.10490.10480000000.2091.88310.47030.23160.30010.398000-0.0850.099400.29680.09880.09870.50241.15591.04440.09480.18910.2826000.09410000.14090.91461.5781.28442.23121.34670.66550.083200.083100.083000.12430.69770.082
29
28PillboxThree Branch Junction - Sequence Mutation 15548377
GGAGAAACUCUGACAAAUAAAGAUAGGCUGAAAAUCAGUCUAUCAAAUAAAGAUCGUUCUAAAAGAGCGAUCAAAGAAAGUCAGAGAAGACUCACUUCGGUGAGUCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.596
medium
93.70.0270.4130.220.24810.57990.4790.37180.65530.37250.26120.10980.027400.02740.05480.02740.09580.36760.36010.35820.22260.16850.16040.0972-0.00950.02670000.02670.034300.29192.0441.39120.96090.84420.38570.02450.12240.02990-0.0190-0.01900.10310.2070.58470.34850.4110.10030.17130.14240.02370000.04740.07110.09470.14170.84040.67470.45950.29750.20540.045600000.02280.04560.04550.25690.49890.51740.69520.52980.3060.65240.19440.15090.08610.02410.0670.17150.17110.46970.4035
30
29JR_TBJ_Mutation1_Sub3Three Branch Junction - Sequence Mutation 15550596
GGAAGAACUACCAGAAAUAAACAAUCCUUGAGGGUCAAGGAUUGAAAUAAACAUGGAUCUGGGAGAUCCAUGAAAGAAACUGGUAGAACCAAAUCUUCGGAUUUGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
4.534
medium
92.60.0480.6410.3440.46360.730.71680.40070.50220.95690.37160.03790.05680.018900.037900.17940.27720.50960.30970.2540.27920.25190.12840.018300.036600.0183-0.0079-0.01580.03660.20080.43560.46991.85372.30780.6570.03370.050500.01680-0.00790.016800.0420.36050.7860.77790.60840.45940.3130.2080.09650.0165.00E-040.04780.20670.06350.04760.08731.63470.89530.951.58260.26470.10280.0880.02150.02930.04390.07990.05850.29781.03610.86170.96841.00571.01070.51740.40850.43150.13050.21730.36640.1840.22540.78231.55751.1761
31
30Three Branch Junction with 3 GU sThree Branch Junction - Sequence Mutation 15551865
GGAAAAAGCUACGUAAAUAAAGCUCAUUAGAAAAUCUAAUGAGUAAAUAAAGCCUAUGCUAAAAGCAUAGGUAAAGAAAGCGUAGCAAGAUAUAGUUCGCUAUAUCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.6
medium
88.40.0390.6370.3380.20791.71281.11460.68710.46810.36210.4946-0.03230.08980.04490.044800.04480.31240.59750.52810.66340.3140.0220.1940.2791000000000.68061.94591.08881.00751.3010.66410.0195-0.01260.0390.0390000.0390.19440.50191.53080.95120.30210.33260.23030.36630.03660.036600-0.02760-0.03210.07311.22451.1310.49430.25040.79470.069-0.0320.03450.053-0.04790.03450.03940.27640.88151.01740.64731.26530.75410.46220.81870.21980.06280.12310.06250.12410.27950.18420.9470.4221
32
31Three Branch Junction with 3 AU sThree Branch Junction - Sequence Mutation 15551869
GGAAAAAGCUACGAAAAUAAAUCUCAUUAGAAAAUCUAAUGAGAAAAUAAAACCUAUGCUAAAAGCAUAGGUAAAGAAAUCGUAGCAAGUAUAUGUUCGCAUAUACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.281
medium
88.40.040.5940.3170.48051.62810.6790.57740.76180.28450.33050.04720.07070.07060.02350.00530.02880.10440.18730.46510.51750.18420.20250.22860.1006000-0.03630-0.0363000.26821.82280.49851.00271.11050.54890.02110.0211-0.03610.04220000.00610.16820.37650.90880.49230.53820.16680.36330.5210.08010000.040.040.0040.07980.78980.87780.82920.5190.4090.0379-0.0359000.03990.41780.45040.48510.58971.19410.68081.32930.75960.47920.74880.20370.37150.20010.16790.23430.30.26330.63591.2049
33
32Three Branch Junction with 1 AU sThree Branch Junction - Sequence Mutation 15551871
GGAAAAAGCUACGCAAAUAAAUCUCAUUAGAAAAUCUAAUGAGAAAAUAAAGUCUAUGCUAAAAGCAUAGACAAAGAAAGCGUAGCAAGUUAUACUUCGGUAUAACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
5.807good93.70.0210.4760.2480.4121.93531.27960.89460.76410.57820.470.02090.02090.018700-0.00490.03130.35030.38710.42180.10620.2550.1120.14230.03050.00250-0.015300000.51672.06621.32241.24471.16380.74770.03980.01840.01380.0046000.01840.03670.13280.23880.87840.61340.31870.27820.16020.29040.05280.01760.01760.01870.017600.01760.09650.8720.89880.73370.45070.46030.03340.01810.00830.008300.00910.03340.13390.46320.73320.67040.98230.720.53830.47980.02750.0390.06240.08550.03890.02350.13570.48520.9609
34
33GeceesenThree Branch Junction - Sequence Mutation 15556872
GGAAAAGCCACUGCAAAUAAACUAUUUAUGAAUGUCAUGAAUGGAAAUAAACCGGAGGCUCAAAGCCUCCGGAAAGAAAGCAGUGGAACCCGAGCUUCGGCUCGGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.505good89.50.0490.6460.3480.21991.28551.07550.90330.46080.49480.35620.00450.004500.02950.0250.03110.09480.20760.16060.31230.21910.3640.17020.04930.29180.09320.21950.06340.15190.19650.18450.0490.44592.49371.20350.88752.02070.5250.00970.26870.13010.2020.26650.20620.02160.03750.16540.13770.59730.42960.18740.31580.22250.1090.078-0.005700.00840.008400.04180.14990.92540.76070.85750.45280.35830.01820.22220.01590.02030.03170.02380.01580.37831.1330.6990.84441.01431.50480.60071.13080.69050.12150.17750.26810.05610.0210.2110.43210.753
35
343Branch 2 M1Three Branch Junction - Sequence Mutation 15574969
GGAAAACGCAUAGCAAAUAAAGAUAGCUAGAAAAUCUAGCUAUCAAAUAAAGUACGUACUAAAAGUACGUACAAAGAAAGCUAUGCAACCUAUGGUUCGCCAUAGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.934
medium
91.60.0510.5640.3080.81791.34621.27640.94041.00680.56610.44960.03310.06610.0660.0330.0330.06590.13150.35980.43190.35060.35380.13730.11380.064000000.095900.03190.58612.1371.38751.56421.40.8010.0340.02860.05710.08560000.0570.02850.2040.8420.20070.17220.1810.22180.3630.0551-0.023100.02750-0.023100.17861.38811.010.67150.53590.44170.12970.08050.0776-0.02310.13180.05160.07730.19530.6010.58320.6190.64470.7850.70550.56620.16830.26430.09650.23830.07140.07130.20220.41250.4454
36
35salish99_SM1_02Three Branch Junction - Sequence Mutation 15580655
GGGAAAACACCAUGAAAUAAAGAAGGUUUGAGAUUCAAACCUUCAAAUAAACAACCUCCUGAUAGGAGGUUGAAAGAAACAUGGUGAACCAACUCUUCGGAGUUGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.17
medium
91.60.040.4420.2410.10810.16690.45881.29310.49010.46410.16190.05810.0404000.04040-0.00520.32150.15490.27950.09680.11940.03980.03980.03970.03970.03970.039700.039600.03960.15810.31491.1431.79060.66950.22380.01450.03730000000.07450.14860.84460.41520.3270.08610.37420.10810.0133000.03600000.42941.69491.23080.79820.18580.06760.21240.06730.10080.09480.09460.06690.17760.47440.59160.7160.65450.65730.45320.20560.11950.06310.09450.12580.07160.03140.57621.19470.7428
37
363 Branch2 Mut2 M3Three Branch Junction - Sequence Mutation 15583934
GGAAAACGGACACCAAAUAAAGGAUCAUGGAAAAUCCAUGAUCCAAAUAAAGCAUGUGCUAAAAGCACAUGCAAAGAAAGGUGUCCAACCAUUGGUUCGCCAAUGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.274
medium
88.40.0040.6170.3112.11181.58920.76070.98580.83530.2774000.138400000.13820.27530.81651.07260.53240.52850.13190.1317000000.131400.06561.73031.81221.76811.14021.12261.29520.688900000000-3.00E-040.95920.46470.44520.44250.60340.054800000000.21860.76880.64220.7940.57770.41770.10430.1041-0.08580.10380000.10370.61680.40890.9180.89841.0760.86990.76540.28470.18930.18880.37560.28060.09260.23250.96360.9018
38
37TBJSM - 1Three Branch Junction - Sequence Mutation 15590802
GGAAAACGUAUAUCAAAUAAAGAUAUAUCGAAAAUCGAUAUAUCAAAUAAAGUAUAUGCUAAAAGCAUAUACAAAGAAAGAUAUACAACGAAAGCUUCGGUUUUUGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.875
medium
84.20.070.7710.420.12411.34130.70841.24640.68910.34290.59520.08490.084800.0847000.02670.42070.44350.33270.1660.165600.2718-0.05780.572500-0.05780.0817000.08161.43961.64171.5681.33030.29890.074600.074600.07450.07440.22260.25870.55020.72630.79020.86441.11740.24360.62110.68360.17050.0785-0.057600-0.1150.15640.89221.56741.02491.1970.38680.311500.12440.86040000.12270.07441.08421.06830.99511.4060.48430.62140.56060.22260.63650.35620.32870.21640.38010.37810.85410.3718
39
38Mutation 2Three Branch Junction - Sequence Mutation 15603002
GGAAUAAGUAUAGCAAAUAAAGUAUAUGAGAAAAUCUCAUAUACAAAUAAAGUAUAUCCUAAAAGGAUAUACAAAGAAAGCUAUACAACACAUACUUCGGUAUGUGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.695
medium
86.30.0630.7210.3920.65540.94160.69231.91851.27360.80611.38380.23290.09830.0982-0.06240.09800.14680.63050.67270.38240.09550.19040.09510.28420.094600-0.03010.094400-0.06220.14132.71941.68241.43231.13310.50870000-0.06210000.16920.21080.75120.39410.43220.16440.08210.408200000000.48660.99971.37321.08220.61320.1530.0764-0.12390.0906000-0.0618-0.06180.67981.18880.45471.3041.76721.01140.95880.13670.47540.13560.27010.4030.33430.34231.17630.8422
40
39Mat - Three Branch Junction - SM - D2Three Branch Junction - Sequence Mutation 15622708
GGUAAAAGCAAUGCAAAUAAAGAUAGUAUGAAAAUCAUACUAUCAAAUAAAGUGCUUACUAAAAGUAAGUACAAAGAAAGCAUUGCAACGUCAUCUUCGGAUGACGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.111good92.60.0350.5110.2731.11791.31541.23121.44830.86750.7470.86370.09530.0370.02240.019400.00970.04480.23970.33380.34780.15310.16470.15760.1260.00950.01230.02840.02170.03120.02170.03110.01420.64042.41381.39011.28841.5260.61140.0881-0.00670.001800.03070.02890.027100.04390.17340.76050.33130.30830.19890.22950.14870.04090.02450.0408-0.00670.00820.00820.0490.11851.32581.28930.84760.53140.63710.02290.02480.03810.01620.0390.0390.05420.22820.45510.61710.6330.88680.73620.39260.6840.1420.01470.12090.08490.04290.09180.08550.6410.2164
41
40Athos - Jieux - Three Branch Junction - Sequence Mutation 1Three Branch Junction - Sequence Mutation 15627501
GGAAUAAGACAUACAAAUAAAGUAUUAAGGAAAAUCCUUAAUACAAAUAAAGUACUAUCUAAAAGAUAGUACAAAGAAAGUAUGUCAAGGGUUUCUUCGGAAACCCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.645
medium
93.70.0320.4550.2430.27631.00481.26651.40050.87090.62710.24850.06490.03240.014000.06480.06470.25790.19950.12830.16660.13420.12750.09550.01590.04770.031800.0318000.03180.29081.88361.11121.50271.11370.83720.0865000.0288000.028800.03220.08960.66930.43880.29020.29450.32370.02790.055800.027900.002600.02790.05570.82550.81620.96640.32460.2660.05320.02660.05310.0265-0.025300.08080.15870.66890.73930.5530.93880.64070.52390.74080.04940.04930.02470.02460.1230.02460.11050.66910.2666
42
41JR_TBJ_Mutation2_Sub3Three Branch Junction - Sequence Mutation 25550609
GGAAGAACAGGUAGAAAUAAACUUAGGAUCGUUUUGAUCCUAAGAAAUAAACUAGGUAGUUUUGCUACCUAGAAACAAACUACCUGAACCUUUACUUCGGUAAAGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.736good91.60.0390.7220.380.37780.59590.520.31430.92590.66140.50360.02700.01130.0440.07360.00430.04260.38810.18790.41950.12090.18720.18260.02770.05790.04970.01660.011000.0110.0110.01511.42651.26971.24891.24880.36220.0510.3450.01010.16440.01640.05370.05050.01010.12410.30421.32590.46770.49090.26420.23170.20220.02890.02890.00960.00270.03250.03670.05761.04491.7974.64740.6991.47661.91120.01750.06740.03890.03570.02660.04970.01730.06520.64910.78511.23230.93310.87291.07440.43390.20480.25870.19140.03850.02380.06641.31341.58980.7827
43
42Three Branch Junction - Mutation 2 - 3AU sThree Branch Junction - Sequence Mutation 25551880
GGAAAAAGUAUCGAAAAUAAAUCUGCAUACGAAAUGUAUGCAGAAAAUAAAUCCUAAUGUAAAGCAUUAGGAAAACAAAUCGAUACAACAUAUGCUUCGGCAUAUGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.956
medium
77.90.031.0710.5510.20721.21021.18731.16820.89740.1281.00960.1260.12580.0303000.37470.49621.15960.42471.19360.35630.11860.3540.35230000000001.26921.42991.49370.82051.130800000.1075000001.2160.99080.10410.5170.30890.5112000000000.80881.09540.49450.14980.9257-0.092300.09710.76820.10310.09490.37760.79371.23551.68122.37240.96151.88831.55011.93970.6880.30451.22591.42014.3151.95660.842.2041.292
44
43Three Branch Junction - Mutation 2 - 1AUThree Branch Junction - Sequence Mutation 25551896
GGAAGAAGUAUCGCAAAUAAAGCUGCAUACGAAAUGUAUGCAGCAAAUAAAUCCUAAUGUAAAGCAUUAGGAAAACAAAGCGAUACAAGUAUAGCUUCGGCUAUACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.625good90.50.0310.5490.290.48550.91610.75850.4780.93830.70010.95290.05910.03190.004300.01160.03450.06030.24750.54640.37690.14090.14750.10940.11760.00840.00840000.0196-0.01120.02940.03780.80331.651.56340.89571.07470.340.0307-0.005600.00770.03070.00210.00770.05570.1570.81660.48440.27680.44390.64420.3316-0.0056-0.00390.0220.00910.04390.03660.02190.20761.39280.9160.33040.39290.70320.04980.00820.04280.001300.01380.03580.22030.50610.58310.86530.5520.5360.41350.770.02590.02680.09150.1760.17790.09640.19480.89151.4625
45
44salish99_SM2_01Three Branch Junction - Sequence Mutation 25580664
GGGAAAACACCAUGAAAUAAAGAAGGUUUCGGAUUGAAACCUUCAAAUAAACAACCUCGUGAUGCGAGGUUGAAACAAACAUGGUGAACCACCUCUUCGGAGGUGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.986
medium
87.40.0510.6170.3340.32030.17510.39571.05530.64460.06780.06770.067700.06760000.09490.40260.53290.4890.26350.13150.13130.0911-0.0400.06550000.13070.065300.61511.22092.5581.88340.68120.13730.17680.05890.117600-0.0399000.3220.89620.24810.41790.51140.05680.16990.0566000000.05660.39380.94392.93061.05031.00670.434100.10260.11380.05110000.41770.55480.79821.47451.1140.5960.9180.18780.09380.14740.37890.27790.32910.22970.64310.76560.6693
46
453 Branch3 Mut2 M1Three Branch Junction - Sequence Mutation 25583942
GGAAUAAGGAUACCAAAUAAAGCUAGAUCCGUAAUGGAUUUAGCAAAUAAAGAUGCAUGUAAAGCAUGCAUCAAACAAAGGUAUCCAAGGUAGCGUUCGCGCUACCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.61
medium
78.90.0190.6620.341.29271.51920.6841.50820.46970.67220.4113000.102700000.40840.60750.7020.10010.1-0.06760.23120.09950000.198400000.68770.68131.71070.68490.3743000.09340000.09330-0.06740.09320.64670.02490.11670.457300.09130.47670.5399000.08990.0226-0.06710.7112.32311.6960.91190.65720.98550.0809000.080800.40170.39950.95710.62471.00121.96071.1941.6560.70860.52590.41880.20710.61610.408500.1359-0.06361.13610.6616
47
463 Branch3 Mut2 M3Three Branch Junction - Sequence Mutation 25583960
GGAAUAAGCUAUGCAAAUAAAGCAUGUACCGUAAUGGUAUAUGCAAAUAAAGAUGCAUGUAAAGCAUGCAUCAAACAAAGCAUAGCAAGGUCAAGUUCGCUUGACCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.811
medium
88.40.0140.4120.2130.44370.8650.60251.20230.74750.61830.26860.2660.00330.0173-0.01400.03120.19480.22820.1240.12380.18030.03860.09240.03080.0154-0.0056-0.007000000.04610.59490.84051.53380.77340.34130.1160.0145-0.027900.01450.014500.00720.0290.12290.51740.17210.10040.11470.15680.08530.01450.01423.00E-040.01420.01420.01420.04260.3531.3570.88150.29960.43990.71040.012900.026200.01280.04010.01340.06680.27890.65950.91070.46050.65220.39240.42780.13760.11090.11190.45970.55810.19640.09420.95850.3755
48
473 Branch3 Mut2 M2Three Branch Junction - Sequence Mutation 25583987
GGAAUAAGCUAUGCAAAUAAAGCAUGUACCGUAAUGGUAUAUGCAAAUAAAGCAUCUGGUAAAGCCAGAUGCAAACAAAGCAUAGCAAGGUGCCGUUCGCGGUACCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.077good88.40.0260.550.2880.34941.1140.60581.47070.81030.9920.77540.022-0.01490.01460.011000.01460.24150.18570.21060.07950.11970.06520.04350-0.01490.0109-0.00740.01090.00690.032600.01080.66230.92111.51270.79920.4010.01580.09170.31231.43990.46670.33910.05390.00980.02450.09310.73750.29960.24740.11450.11510.239100.00960.0096-0.0074-0.01480.03080.02130.17362.03152.35450.97040.59421.59920.0514000.03540.01710.01830.02560.03960.29690.62161.51440.69190.59310.3311.11120.07190.01580.03170.05540.04350.05190.09080.86590.4007
49
48TBJSM - 2Three Branch Junction - Sequence Mutation 25590811
GGAAAACGUGUGUCAAAUAAAGAGGUUUACGAAAUGUGGAUUUCAAAUAAAGUAUAGAGUAAAGCUUUGUACAAACAAAGAUAUACAAGGAUUGCUUCGGCGAUUCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.233
medium
77.90.1131.2410.6770.65520.72950.94080.74040.75240.2501-0.02110.24930.06230.38140.3390.46860.2930.25211.01751.0171.13630.89520.91170.78280.26430.42180.05420.18850.81930.18490.26660.18310.21190.29210.83311.62071.74410.62140.95450.93450.1970.37870.63630.68410.44580.440.13710.4090.74591.67021.14531.00230.90550.58411.48960.70680.46040.79130.64820.37040.95871.70831.64821.15661.65031.08320.8070.59320.26990.20190.06720.13420.06710.66441.76650.87191.07211.54321.12380.32730.62330.53470.39880.35652.22920.70661.42990.81920.5420.3511.23660.4455
50
49Flower BoxThree Branch Junction - Sequence Mutation 25591708
GGAGAAAGUCUGACAAAUAAAGAUAGGCUCGAAAUGAGUCUAUCAAAUAAAGAUCGUUGUAAAGCAGCGAUCAAACAAAGUCAGACAAGAUGCACUUCGGUGCAUCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.174
medium
75.80.0330.5120.2730.31810.47440.1420.87990.90040.28990.54750.0456000000.01370.0910.22680.28440.07160.04510.17980.0449000000.04490-0.0159-0.01590.49051.27051.58570.48950.44420.08450.042200.084400.04220000.10520.39660.08260.08340.08330.04160.083200.0416000000.28971.38870.65170.24040.19980.87590.50940.11740.27280.0390.27170.46930.23050.36310.850.98761.47860.58370.98560.72441.13060.26290.24170.24090.39490.72940.60460.30440.95740.621
51
50Mutation 2 2Three Branch Junction - Sequence Mutation 25603023
GGAAUAAGAUAUACAAAUAAAGAUAUAUGCGAAAUGCAUAUAUCAAAUAAAGUAUAUCGUAAAGCGAUAUACAAACAAAGUAUAUCAAGUUUUCCUUCGGGAAAACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
4.192
medium
86.30.0270.5770.3020.31450.55610.62690.7390.4890.52740.31510.00520.00520.01750.035-0.00180-0.0070.20452.14840.25850.10080.08390.05030.08380.0213000.06690.021200.0045-0.01220.04240.80921.75662.00590.71691.03980.0397-0.04260.0457-0.04870.01830.01070.01070.00910.04560.09722.45060.22430.11680.1650.13080.10630.02390.01920.00230.01920.035900.04050.49411.13440.89170.60790.37270.4250.12420.35280.09490.02710.09470.0690.0810.13611.02461.5851.56960.73650.64810.43311.27640.08510.14540.18730.06630.26430.11990.42930.49090.749
52
51TBJ-SM2 2Three Branch Junction - Sequence Mutation 25606100
GGAAUAAGCAGCUGAAAUAAACAUCUCAUCGAUAUGGUGGGAUGAAAUAAAGUCCACUGUAUAGCAGUGGACAAACAAACAGCUGCAACCUGGAUUUCGAUCCAGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
14.112strong91.60.0450.5680.3070.46621.10050.74921.21550.9280.77310.91050.06370.04480.0190.03420.01550.00420.13770.35730.2180.34340.09430.11880.0980.04090.02990.03580.01360.04530.01360.04920.070.0520.05560.79541.08790.711.09660.30140.15520.06430.01070.00620.02190.03990.05820.02120.11830.23730.90660.37980.20410.22940.16450.22020.04110.01050.00850.01450.00650.0210.08160.36671.62762.53721.02341.011.0810.14890.09590.02190.01060.01550.04660.04370.10070.43410.53190.86580.58680.69460.53340.43060.11030.14460.0460.07780.13030.04210.09620.83710.7031
53
52tbjsm2-1Three Branch Junction - Sequence Mutation 25617700
GGAAGAACUAGCUGAAAUAAAGCUGCAGUCGUUUUGACUGCAGCAAAUAAAGCUCGAUGUUUUGCAUCGAGCAAACAAACAGCUAGAAACCAUCAUUCGUGAUGGUAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
9.376good89.50.031.120.5750.45360.76680.68330.59271.4260.67271.57561.45670.22440.16680.10250.12510.02270.27410.8860.77710.76720.34030.17960.28390.18610.01080.00290.01080.01080-0.00790.03810.364202.83313.57532.47350.57621.33033.8650.14270.0346-0.00620-0.00788.00E-040.06040.02750.31081.44510.45940.27720.34920.27260.27980.00820.04970.0086-0.0230.01640.02460.1974.41343.94393.40971.881.8720.90870.89960.18960.0163-0.07520.03810.0303-0.00920.03560.69430.84271.37291.09620.79270.68820.51320.04090.0310.0890.0580.13880.16141.00661.96651.6775
54
53tbjsm2-2Three Branch Junction - Sequence Mutation 25617704
GGAAGAAGAUCCACAAAUAAAGGACCUCUCGUUUUGAGAGGUCCAAAUAAAGGAGGUAGUUUUGCUACCUCCAAACAAAGUGGAUCAAACGAUCAUUCGUGAUCGUAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
12.348strong88.40.040.7570.3980.48260.87970.81710.54740.97020.83480.49870.04840.08830.02740.02930.01740.0440.03740.59571.00370.62720.47730.55260.42240.0930-0.001800.0021-0.003800.00240.150.49031.61971.46951.41020.83910.80080.99880.07050.01230.00520.00350.05440.03880.00350.04020.37540.73470.65150.69050.69040.66160.33260.0646-0.00430.010.00640.00830.01810.0181.38531.69262.1151.13950.67140.76530.05620.11630.2613-0.00270.02820.00620.01330.41251.02441.24481.24790.82160.95810.71891.00890.34940.07110.09930.17630.2140.04010.12111.07260.9425
55
54Mat - Three Branch Junction - SM2 - D3Three Branch Junction - Sequence Mutation 25622738
GGUAAAAGCGAAUCAAAUAAAGCUUGUAUCGAAAUGAUACAAGCAAAUAAAGUCAUAUGUAAAGCAUAUGACAAACAAAGAUUCGCAACCUUAGCUUCGGCUAAGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.168
medium
82.100.450.2251.72690.80080.91250.84180.52550.70860.701800.23320.11640.34750.5039001.07570.72860.556200.1111000000.1109000001.09231.1821.37060.47140.3648000000.10410000.10390.515900.20580.102700.102600000000.40811.00621.18770.29570.34830.2925-0.070600000000.3880.28980.5751.40981.11060.64210.63650.09080.18120.090500.09040.18030.01950.80130.7054
56
553 branch mutation 2 1stThree Branch Junction - Sequence Mutation 25627080
GGAAGAAGCUAUGCAAAUAAAGCAUAUACCGUAAUGGUAUAUGCAAAUAAAGCAUAUGGUAAAGCCAUAUGCAAACAAAGCAUAGCAAGUUGGUCUUCGGACCAACAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.49
medium
85.30.0570.6240.340.12330.88590.42130.29041.21610.75220.92830.28360.04420.03440.29420.26870.4370.30860.76210.37750.71490.2580.11710.12540.140.01170.0117-0.00630.09310.0930.09290.04640.01160.11670.65470.47170.77770.29580.13440.022400.02240.02240-0.01480000.28980.99630.34220.36990.1520.43170.47170.02140.0214-0.02960.02140.0066-0.00810.1380.26611.42611.32380.69360.46251.3901-0.01470.09840.11790.06380.06370.03920.11740.14150.62411.05760.42540.34360.30050.11250.83770.3981.2731.59490.22920.33350.37750.44470.81651.2317
57
56Jewel BoxThree Branch Junction - Sequence Mutation 35548387
GGAAGAACCAUGACAAAUAAAGAUGCGCAGGAAAUCUGUGUAUCAAAUAAAGAUCGUUCUAAAGGAGCGAUCAAAAAAAGUCAUGGAAGAGUCACUUCGGUGACUCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.871
medium
89.50.0260.4490.2370.56930.62510.86030.32860.98170.61820.74210-0.01090.07800.09090.06480.0130.11650.23230.1078-0.01140.05150.07710.0514-0.0210.02570.03040.025600.025600.02560.01281.17221.50581.28520.72031.55490.02350.002500.023500.04690.140400.02340.04920.18880.18820.13910.23330.11540.04610.0461000.02300.0460.0920.21781.341.08670.61760.08870.19670.13090.04360.043600.04350.06530.02260.1550.25911.27291.79740.43060.18390.24490.2030.08130.0812-0.02080.06080.01980.06080.21140.70960.4756
58
57JR_TBJ_Mutation3_Sub3Three Branch Junction - Sequence Mutation 35550629
GGAAGAAGUACCACAAAUAAAGAUAUGUAGGAAAUCUACAUAUCAAAUAAAGAUGGUACUAAAGGUACCAUCAAAAAAAGUGGUACAAGGUAUACUUCGGUAUACCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
9.501good92.60.0180.4340.2260.59420.94920.86450.56081.04920.76230.82760.09150.12970.01830-0.01450.01320.01740.18070.23850.19160.15230.1350.11870.04760.02060.08250.13950.01880.01520.00720.00618.00E-040.01251.27941.50311.33521.28720.87110.0850.01150.02010.00550.003800.02770.02010.04510.0890.43790.28760.18630.21130.12620.10950.0128-0.00180.00320.00320.00370.00190.00640.07731.37821.26820.27110.61060.61570.04570.0216-0.0054-0.00270.01830.0090.01950.19910.25311.10720.43940.49140.32940.33580.47460.01470.02860.01420.0430.03840.05010.15510.75620.402
59
58JR_TBJ_Mutation3_Sub2Three Branch Junction - Sequence Mutation 35550639
GGAAGAACAUGGUGAAAUAAACUAUACAUGGAAAUCAUGUAUAGAAAUAAACUACCAUCUAAAGGAUGGUAGAAAAAAACACCAUGAACGUAUACUUCGGUAUACGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
8.446good91.60.0170.3970.2070.57780.94750.6840.34870.96330.92870.50620.01520.008600.00380.01030.00580.04110.14620.14210.2320.21090.24560.19380.0490.00330.02020.0320.06130.00310.01830.04580.02140.08511.22541.09920.77020.89020.85070.18130.13640.01920.00520.0110.03535.00E-04-0.00240.02490.16330.58140.34560.21750.22340.31430.08460.00470.00470.00340.00380.00810.00435.00E-040.10511.04510.88960.610.14270.35630.05220.0094-0.010100.01640.0270.07660.47580.13460.72281.390.41830.37240.2610.1860.06920.04412.00E-040.02340.0170.01970.37910.90950.2496
60
59JR_TBJ_Mutation3_Sub1Three Branch Junction - Sequence Mutation 35550641
GGAAGAACAUGGUGAAAUAAACUAUACAUGGCCCUCAUGUAUAGAAAUAAACUACCAUCUCCCGGAUGGUAGAAAAAAACACCAUGAAGGAUUACUUCGGUAAUCCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
5.883good87.40.0440.4870.2660.35020.79230.74220.29360.99770.77930.50520.05090.04790.00620.14150.23450.04980.06770.15450.12120.24780.08840.15480.07040.02350.03150.06270.03360.07220.0830.00230.01270.0010.07761.82370.56490.42920.56740.51040.0400.0550.15380.04920.16220.13120.04370.11060.16630.50210.37550.22430.22780.24830.09570.01340.00550.05820.01540.03520.0070.02110.25923.46841.16090.32510.12880.75870.07240.01440.02010.03220.08680.02880.09130.36770.15670.84951.19630.5030.34280.26190.15840.1480.08480.11040.03740.10250.03920.580.81380.2891
61
60DionrequusThree Branch Junction - Sequence Mutation 35561333
GGAAUAACUCUCAGAAAUAAAGCCCAGGCGGGAUUCGCCUGGGCAAAUAAACUCGGGACUAAAGGUUUCGAGAAAAAAACUGAGAGAAGCCCUCCUUCGGGAGGGCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.429
medium
88.400.4750.2370.1741.88031.41782.10291.13070.51660.61470.30610000000.23880.13670.2021-0.09640.100700.1006-0.0329-0.03280000.20070.20010.09990.04990.54511.26593.21111.03440.18290.58950.18090-0.0656000000.09040.35960.26870.08950.35610.17760.17720000-0.1309000.08852.14691.01611.330.3311.14030.162500.162200000.24240.08071.03451.55750.38730.38520.53540.30460000.30340.075800.07570.45130.2996
62
61Three Branch Junction - Mutation 3 - StandardThree Branch Junction - Sequence Mutation 35565739
GGAAUAAGUUCACGAAAUAAAGGUAAUCAGGAAAUCUGAUUACCAAAUAAAGUUACUACUAAAGGUAGUAACAAAAAAACGUGAACAAACGACUCUUCGGAGUCGUAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.673
medium
86.30.0370.4820.2590.46350.91211.12381.08831.02530.85351.02850.1454-0.046600.024700.02010.04470.18040.160.15960.06860.13920.04410.05960.03970.01980.039700.0990.0198000.00990.98961.44431.17630.78191.01240.0550.03670.05500.01830.0183000.01830.00280.52680.18380.0930.09030.07220.14410.036000.0180.0180.0744-0.01550.46882.251.40760.6150.3680.72230.13220.0990.06590.06690.09050.06570.05750.36180.08240.78231.66270.330.1880.15620.12450.11660.11640.01560.12390.04640.13890.1770.9641.0476
63
62Three Branch Junction - Mutation 3 - 1AUThree Branch Junction - Sequence Mutation 35565753
GGAAUAAGUUCGCAAAAUAAAGGUAAUCAGGAAAUCUGAUUACCAAAUAAAGUCACUACUAAAGGUAGUGACAAAAAAAUGCGAACAAACGAGUCUUCGGACUCGUAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
0.913weak77.900.2150.1070.50730.38170.50540.12610.25140.37510.18710000000.06230.18640.12410.32140.01270.12310.06150.061500.061400000000.36660.5570.54130.09010.62530000000.05950000.17810.05930.05930.128400.0591000.0590000.0590.23510.52520.23270.46240.05780.11530.22990000-0.0977-0.09760.22920.11440.17120.48190.31050.11270.11260.17570.16790.00720.11870.05580.11140.2220.22140.60370.2734
64
63salish99_TBJm3_01Three Branch Junction - Sequence Mutation 35583431
GGGAAAACACCAUGAAAUAAAGAAGGUUUGGGAUUCAAACCUUCAAAUAAACAACCUCCUGAUGGGAGGUUGAAAAAAACAUGGUGAACCUGGUCUUCGGACCAGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.175
medium
89.50.0420.4920.2670.01420.22370.79860.95610.58370.49430.17980.08340.048-0.01840.03520.0240.024-0.03670.14910.11940.13010.14270.11870.12380.023700.02370.02370.10640.15330.094200.02350.05880.62981.4781.78621.150.88730.21580.02160.02160.107700.02790.02150.021500.06440.51480.19140.12740.12720.08470.06350.04230.042300.02110.042200.02110.10540.74042.66221.4580.41220.275100.0584-0.01830.09720.09710.02050.05820.48240.15370.82741.45150.50830.64060.28250.24520.14420.12650.10790.09010.12560.08980.55190.87930.6761
65
64salish99_TBJm3_02Three Branch Junction - Sequence Mutation 35583433
GGGAAAACACCGUCAAAUAAAGAAGGUUUGGGAAUCAAGCCUUCAAAUAAACUACCGCCUGAAGGGUGGUAGAAAAAAAGAUGGUGAACCUCGUCUUCGGACGAGGAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.282
medium
82.100.4590.2290.50680.20361.09271.08360.39190.19540.2920000.09720.1939000.28960.09640.47890.191100.09540000000-0.06900.09530.75431.31840.73251.17110.7136000.0891000.0890000.08890.44170.2640.36850.08740.0873000.0872000000.08710.51872.04260.4310.2490.41260.16470.09570.1770.17630.48630.4030.08050.80650.35621.66281.07351.05040.5270.55380.47680.29230.36350.22140.28850.43020.07160.53330.91270.8671
66
653Branch4 Mut3 M1 Three Branch Junction - Sequence Mutation 35584100
GGAAUAAGCACACGAAAUAAAGAUUCAUGGGAAAUCCAUGAAUCAAAUAAAGUAUGUACUAAAGGUACAUACAAAAAAACGUGUGCAAGACUACGUUCGCGUAGUCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
4.405
medium
85.30.0360.5720.3040.44511.29641.02711.33161.04610.86180.73120.0761-0.00460.019-0.068000.0570.37210.17320.24180.10080.0750.09360.044300.03740.05600.056000.01870.04661.23161.29571.51231.06442.52620.03350.01670.01670.0051.20570.14780.18470-0.01890.11440.39020.2430.19390.19340.09660.11250.03210.0482-0.01170.01600.0160.03210.34322.02521.3810.69350.25110.66970.1040.07420.04760.03580.01790.0210.04440.24790.30821.40341.60990.26820.25110.18780.08340.1110.18210.09890.09870.13980.08460.15980.94280.5659
67
663Branch4 Mut3 M2 Three Branch Junction - Sequence Mutation 35584105
GGAAUAAGCAGACGAAAUAAAGAUUCAUCGGAAAUCGAUGAAUCAAAUAAAGUAUGUGCUAAAGGCACAUACAAAAAAACGUCUGCAAGAGUCCGUUCGCGGACUCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
3.616
medium
93.70.0440.7730.4080.28121.52581.14391.76910.90170.86481.2044-0.02590.036500.07290.072800.07270.28980.39030.44220.24910.18710.24750.1412000.07050-0.0421000.05280.1231.10791.62472.67463.28861.01110.5473-0.05150-0.02570.03040.09110.004600.06520.12390.99820.42240.29850.35550.20460.60880.11580.02890.0289000.02890.05780.08661.93772.27161.34890.24031.22880.02610.130400.0790.1040.0520.15550.28430.68921.69192.43870.86550.72920.7450.39360.04630.13860.09230-0.0024-0.00480.36691.44330.8864
68
673Branch4 Mut3 M3Three Branch Junction - Sequence Mutation 35584121
GGAAUAAGCAGACGAAAUAAAGAUUAAUCGGAAAUCGAUUGAUCAAAUAAAGGAUUAGCUAAAGGCUAAUCCAAAAAAACGUCUGCAAGCAUGCGUUCGCGCGUGCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
2.028
medium
74.70.0610.6730.3670.36691.01831.07681.49351.01350.99960.84680.07050.140700.022100.070200.34940.09130.09110.0428000.138700.06930.0692000000.13821.08891.40160.890.97560.42030.06460.016500000000.06450.63930.191300.06370.12720000.0635000.03180.09510.18981.18241.46350.78420.30041.18190.23560.75780.17440.11610.34670.23040.22970.45640.17081.58681.44610.4340.43140.53530.05350.05340.1120.10650.05320.05320.29130.58610.80421.1261
69
68Mutation 3 3Three Branch Junction - Sequence Mutation 35603070
GGAAUAAGCUUACGAAAUAAAGCAAUAUUGGAAAUCAAUAUUGCAAAUAAAGCUUAUUCUAAAGGAAUAAGCAAAAAAACGUAAGCAAGCGUUGCUUCGGCAACGCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
1.9
medium
8000.1940.0970.10420.83090.67081.69820.37070.24620.0547000.0137-0.004600.02730.05460.027300.054500.05450.054400000-0.01820000.04080.43270.26950.21010.08050.18730000-0.0182000-0.01820.05350.02670.13340.0800.05330.026600-0.01820.10630.07970.05310.0530.07950.3690.28880.1310.05240.1907000.026100.05220.02610.07810.24130.05190.20690.46250.08450.17920.127700.05110.08380.12730.02540.02540.08891.94670.1480.1231
70
69tbjsm3-3Three Branch Junction - Sequence Mutation 35617900
GGAAGAAGCACAGCAAAUAAAGCUCACUGGGAAAUCCAGUGAGCAAAUAAAGUGAGCUCUAAAGGAGCUCACAAAAAAAGCUGUGCAAACCGACUUUCGAGUCGGUAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
5.169good92.60.0110.4460.2290.33310.90650.62820.52640.94980.64330.76350.04690.05520.03510.0117-0.00760-0.00760.16970.08370.17860.19730.11580.02720.09650.10390.011500.0155000000.25120.91411.65341.60381.28570.00620.0106000.01060.010600.01060.05630.18040.36780.32570.2750.19830.18740.18690.01320.0104000.0104-0.00750.01040.0651.36530.91120.65640.16360.31550.08880-0.00750.041800.00470.14750.16610.40211.11250.83460.53350.42560.17270.36050.01390.04170.07870.02780.06640.11990.12140.80151.1695
71
70Mat - Three Branch Junction - SM3 - D3Three Branch Junction - Sequence Mutation 35622763
GGUAAAAGCGUUACAAAUAAAGUAUGAUAGGAAAUCUAUCAUACAAAUAAAGCACUUACUAAAGGUAAGUGCAAAAAAAGUAACGCAAGGUGUGGUUCGCUACACCAAAAGAAACAACAACAACAAC
.......(((((((.......((((((((((...)))))))))).......(((((((((...))))))))).......)))))))..(((((((....))))))).....................
6.46good88.40.0150.4720.2430.83281.01321.02720.9260.66980.51380.58640.0330.016500.01650.02620.00820.07310.18550.21180.17270.05770.03840.1040.1160.00810.01040.004600.0127-0.00580.02430.00810.03241.14971.40591.36761.01170.97350.024-0.00250.00750.01490.05220.02980.00490.01490.05370.0750.3820.18050.14280.13940.0660.087900.008900.01460.0073-0.00430.0220.16581.89351.38420.8620.25130.94670.04740.07530.013500.00680.01350.00770.17850.2021.0760.74310.42750.42550.34480.56920.1020.10820.04770.0350.02540.01910.06780.46540.3865
72
71JR_TBJ_Mutation1_2_Sub1Three Branch Junction - Structure Mutation 15550666
GGAAGAAGUGGUACAAAAUAAAGUAACCAUGCAAAGCAUGGUUACAAAAUAAAGAUCCUACGAAACGUAGGAUCAAAAUAAAGUACCACAAGGAUAACUUCGGUUAUCCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.743
medium
93.90.0310.7280.3790.32570.81320.66410.1851.19740.57320.926100000000.40931.69881.0250.47040.29180.29060.48110.2875000000-0.0577000.47611.67442.07841.33070.17700000.08840000.08830.72831.16010.66550.9240.96540.48910.24570.32620.16271.20030.07990-0.057500.07980.07980.86691.46711.58620.16850.88320.07410.074-0.0404000.07380.22090.29331.01221.06860.64841.38410.49240.9490.6050.600.13310.132800.26470.1321
73
72JR_TBJ_Mutation1_2_Sub2Three Branch Junction - Structure Mutation 15550672
GGAAGAACACCAUGAAAAUAAACAUUGGUAGCAAAGCUACCAAUGAAAAUAAAGUAGGAUCGAAACGAUCCUACAAAAUAAACAUGGUGAACGAUAACUUCGGUUAUCGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.546
medium
88.801.0870.5430.19361.83450.90580.22581.32981.30590.17090.17030000001.18330.211900.63030.94360.52420.61090.30420.5034000000.20080.20030.19971.17894.42823.42021.1171-0.09150.17230.3429000.1711000-0.18251.67120.33271.94290.95870.63350.38091.23740.461100000000.15340.90873.04733.45530.81990.542500.80480.40020.13320-0.0910.26530.54661.47221.88020.98912.41630.64520.93211.03370.68260.3960.3595-0.09020.301300.1117
74
73JR_TBJ_Mutation1_2_Sub3Three Branch Junction - Structure Mutation 15550674
GGAAGAACACCAUGAAAAUAAACAUUGGUAGCUUUGCUACCAAUGAAAAUAAAGUAGGAUCGUUUCGAUCCUACAAAAUAAACAUGGUGAACCAUAACUUCGGUUAUGGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
5.764good94.90.0370.8370.4370.41780.90120.75170.23830.67440.87940.35840.07920.01840-0.0129-0.0052-0.00520.15230.69110.90690.26690.74041.09290.83840.63160.33460.048400.006600-0.0104000.05090.29351.77750.54210.65380.33830.03220.02980.0080.01610.03220.02180.048200.16591.13050.90790.69381.25160.77180.53790.53640.65010.04070.00730.01460.01460.014600.01460.12072.18464.19482.22870.63710.33440.56620.03770.9331.150.00380.08910.12350.11121.10221.90310.63591.82580.95311.52580.82580.56950.15540.15920.01120.11610.14820.1104
75
74SoatlareThree Branch Junction - Structure Mutation 15562042
GGAACAACCAUCGCAAAAUAAACAUUAUUUGCUAGGCGAAUGAUGAAAAUAAACCACUCCCGGAUCGGGAGUGGAAAAUAAAGCGAUGGAACCAGGGCUUCGGCCCUGGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.662
medium
91.80.0490.6320.340.40890.39620.30390.06660.02320.34470.51330.0855000.0854000.08530.42380.75490.4171.10871.01230.25920.63930.23900000.07960.2379000.55090.46920.92640.53640.90810.45120.1501-0.063300.0750000.03750.40981.02840.97830.65431.17740.97330.3460.75320.3408-0.06300000000.33921.00352.45571.11290.03180.03230.0322000000.25270.87390.86350.73271.14190.7730.76480.46760.28620.053400.1160.17360.11550
76
75DibeenThree Branch Junction - Structure Mutation 15562606
GGCAAAACUACUGGAAAAUAAACAUGGCCUGCCCAGCAGGUUAUGAAAAUAAACCGGACUCGAACCGAGUCCGGAAAAUAAACCAGUAGAACUCUAUCUUCGGAUAGAGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
4.513
medium
92.90.0380.6680.3530.75040.91040.65021.17080.76090.76890.37440.01040.0520.02080-0.012800.03110.64310.94330.30310.93470.53850.61210.61270.29060.02030.0193000.01930-0.012700.00660.13510.7510.54961.02620.09320000.01860.03730.08380.15790.03710.08580.82270.83430.7751.08590.64621.00770.73290.47830.03380-0.01270.03380.01690.47440.13410.08371.10852.14212.13490.35040.33850.10740.14310.62710.0152-0.01020.06750.01760.07791.07971.20930.48611.38231.39020.77760.64290.63810.53820.08560.12060.22710.24180.1402
77
76Three Branch Junction - Structure Mutation 1- 3UU s Three Branch Junction - Structure Mutation 15565802
GGAAUAAGAUCCGUAAAAUAAAUGCUAUCUGCAAAGCAGAUAGCUAAAAUAAAUCCUGAUCGAAACGAUCAGGUAAAAUAAAUCGGAUCAACUCUAGCUUCGGCUAGAGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
3.604
medium
90.80.060.6550.3570.17770.77730.30681.00760.83370.77110.35720.27670.57510.182500.0650.50380.51310.93570.76070.5960.84480.71240.66990.51070.50940.16550.30330.42850.10370.36860.0696-0.02610.01010.07960.20781.31510.6720.42430.81690.240.08790.10970.06580.210.0830.15240.10870.55840.44530.54220.52770.51350.16470.320.43170.77470.35340.0480000.040700.02030.43141.7991.50450.2020.23280.00620.019200.019200.00620.04440.40550.7140.4360.47370.84430.47920.35490.34290.59080.16080.053500.17810.20480.0934
78
773 Jct Mutation1 M1Three Branch Junction - Structure Mutation 15583900
GGAAAUAGGUAUGCAAAAUAAAGCUAUCUAGCAAAGCUAGAUAGCAAAAUAAAGCUAGAUCGAAACGAUCUAGCAAAAUAAAGCAUACCAAGGAUGCGUUCGCGCAUCCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
2.802
medium
92.90.030.5930.3110.54311.66330.72520.59151.35050.48180.22290.12340.0169000000.41730.8230.43260.65080.98410.51960.23230.38010.09610.03840.03840.038400000.03840.30561.45991.35310.92460.50410.107900000000.22670.49821.01750.62610.76730.36240.21460.25480.2540.033800000000.31281.83881.42420.27250.37460.031900.06370.03180.03180-0.0240.09450.81581.24890.6331.03010.63260.65070.56280.44250.14550.01030.0291-0.01880.17390.029
79
783 Jct Mutation1 M2Three Branch Junction - Structure Mutation 15583905
GGAAAUAGGUGUCCAAAAUAAAGCUAUCUAGCAAAGCUAGAUAGCAAAAUAAAGCAUGAUCGAAACGAUCGUGCAAAAUAAAGGAUACCAAGGAUUCGUUCGCGAAUCCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.288
medium
91.801.0090.5050.30190.3221.60050.79151.80120.13250.50920.25370000000.87731.3530.60981.08141.41381.61280.33430.33160.226800000000.22611.42582.97144.57451.84160.2896000000000.28850.47760.94290.56140.4340.36950.36760.302100.18200.181500.1811000.18061.41672.56272.15520.4940.16430.32710000.48740.16210.80150.160.98031.54180.76281.64041.19561.03081.4130.59490.0359000.13890.41420.1378
80
793 Jct Mutation1 M3Three Branch Junction - Structure Mutation 15583914
GGAAAUAGGUGUCCAAAAUAAACCUAUCUAGCAAAGCUAGAUAGGAAAAUAAAGCAUGAUCGAAACGAUCGUGCAAAAUAAAGGAUACCAAGGACUCGUUCGCGAGUCCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
2.326
medium
90.80.0450.5580.3011.27030.45660.60090.55211.52220.65960.25040.1499000000.0280.79280.99841.07031.17120.88720.60010.09220.046100000000.046000.41210.04580.182600.045600000000.09110.18180.06890.15850.29320.04510.22470.06790.13440.04480.08940.04470.13540.177800.04440.04440.39730.48240.39260.08710.13050.08690.04340.08670.129800.08650.25840.53451.73071.26921.20911.74781.3291.25171.08010.27910.11150.07420.14820.22160.25760.0735
81
80salish99_TBJ_SM1_02Three Branch Junction - Structure Mutation 15584846
GGGAAAACUCCACGAAAAUAAAGGAUAAUGGCGAUGCCAUUAUCCAAAAUAAACUCUAUCCGGAUCGGAUAGAGAAAAUAAACGUGGAGAACCUGAACUUCGGUUCAGGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
0.784weak82.700.5360.268000.67860.44960.66820.222100.22140000000.87490.21810.64831.06470.63330.26030.41730.41500000000002.01721.19050.1979000000000000.39360.2941.25210.60330.19010.56590000000000.74680.73921.4490.02190.4489-0.06880000-0.158100.53410.53021.21630.34591.19071.00650.49980.16620.1658-0.15780.17280.49190.32650.48640.4031
82
81Coin BoxThree Branch Junction - Structure Mutation 15592547
GGAUAAAGCAUGACAAAAUAAAGAUGCGCAGCAAAGCUGUGUAUCAAAAUAAAGAUGUGUCGAAACGACGCAUCAAAAUAAAGUCAUGCAACCUGUGCUUCGGCGCAGGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
3.041
medium
96.90.060.6820.3710.16830.58811.21681.72630.97910.54881.12230.02090.083000.04150.12420.08270.30880.47020.70880.64090.43710.70940.33390.46830.0780.03900.0389000-0.020600.54111.65751.69331.20860.28860.03610.036-0.02060.07200.036-0.020500.01540.65661.43240.79131.13920.57350.73920.39820.297400.11550.01650.0330.09880.03290.08220.08210.50871.93451.60720.87740.90690.2410.159900.060100.03950.06-0.02051.0491.14870.7911.14660.5210.620.47730.90780.13630.16310.14920.14890.16210.054
83
82Structure 1 3Three Branch Junction - Structure Mutation 15603079
GGAACAAGUAUAGCAAAAUAAAGCUUAAUAGCAAAGCUAUUAAGCAAAAUAAAGCAUAUACGAAACGUAUAUGCAAAAUAAAGCUAUACAAGUCUACCUUCGGGUAGACAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
2.488
medium
91.80.0540.9130.4830.14780.99881.0590.67150.58290.4140.81860.3260000.08140.16240.09130.80060.7541.66351.17880.6770.6710.37090.1841000000.07390000.21892.07291.81210.30910.34520.0690.068900.06880000.068801.01291.74751.06920.83670.5430.50750.5040.562600000.24920.21070.0620.0620.82713.1553.88160.76811.09660.0164000.10780.05390.05380.05380.06981.12481.66520.86671.65551.320.96480.35671.1510.65410.5650.51440.7284-0.07471.3251
84
83tbjstm1-2Three Branch Junction - Structure Mutation 15617911
GGAAAACGAGCAGCAAAAUAAAGAGGUGCAGCAAAGCUGCACCUCAAAAUAAAGCACAUCCGAAACGGAUGUGCAAAAUAAAGCUGCUCAAAGGAGCAUUCGUGCUCCUAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
3.378
medium
96.90.0620.9010.4810.45021.56031.65191.64271.50260.40440.25190.10060.100500-0.02230.07530.17520.59580.83831.37280.78640.64440.69890.27850.32350.046200.04610.02390.0921000.04600.83073.10282.0511.49190.10190.0413000.041300.02070.18540.08230.08220.62981.61091.15631.22660.98430.96690.64950.4610.03690.01470-0.00740.06610.08810.03670.10990.86042.54882.6030.30160.1790.06670.09990.03330.0333-0.00440.43390.17520.07651.08261.90390.65491.58021.3390.82070.78950.55830.11580.05790.02890.05780.11540.2015
85
84tbjstm1-3Three Branch Junction - Structure Mutation 15617916
GGAAAACGAGCAGCAAAAUAAAGAGGAGCUGCAAAGCAGCUCCUCAAAAUAAAGCUCAUCCGAAACGGAUGAGCAAAAUAAAGCUGCUCAAAGGUGCAUUCGUGCACCUAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.995
medium
92.90.0040.7920.3980.32381.36791.11261.47161.8589-0.05050.3720.105500.00460000.31450.83090.51530.91170.80060.4970.59150.39220.43690.097300000000.09710.53042.01580.37310.27880.18540.09260.09240-0.05010.09230.09220-0.050.09210.6391.56321.26561.33450.54780.45880.83810.20070.0834-0.04990-0.049800000.82482.85293.21890.4890.5228000.22340000.074401.02672.03580.65521.60361.03610.93780.66370.60810.06570.131200.13090.01580
86
85Mat - Three Branch Junction - ST M - D2Three Branch Junction - Structure Mutation 15622781
GGAAAAAGCGAAGCAAAAUAAAGCAUGAUAGCAAAGCUAUCAUGCAAAAUAAAGAUUGUACGAAACGUACAAUCAAAAUAAAGCUUCGCAAGCAAGGCUUCGGCUUUGCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.293
medium
86.700.6280.3140.58951.40160.81730.94120.79790.39680.80050.13040.13010.12990000.129700.5150.19980.33960.63140.0130.12580.49990.1248-0.112900000.1245000.61751.80641.53250.47190.23310000000-0.11260.23240.80431.35321.11041.09370.75760.21580.53560.31990.21270.1062000.1060000.73471.69142.33180.59050.875100000000.19390.86240.38130.56750.93360.55590.73370.5240.45170.0902000.26970.26870.1341
87
86JR_TBJ_Mutation2_2_Sub1Three Branch Junction - Structure Mutation 25550686
GGAAGAAGUACCACAAAUAAAAGUAUGGAUCCAAAGGAUCCAUACAAAUAAAAGUAGGUAGGAAACCUACCUACAAAUAAAAGUGGUACAAGGUAAUCUUCGGAUUACCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.687
medium
94.90.0090.9360.4730.56011.07761.01590.50441.15830.8181.12750.16070.320.15970000.55451.16922.70172.04230.9360.28641.0560.41990.55560.1386000000001.02522.82473.38230.426900000-0.07060000.12420.79841.62130.93610.89691.23260.34170.89981.10770.22090.2202000000.32880.97321.41282.75170.70650.33140.100200000.12990.19940.19880.78671.77481.93571.19280.83621.36890.7030.610.34690.08660.2589-0.06970.17220.3854
88
87Groovy Mutation 2aThree Branch Junction - Structure Mutation 25560723
GGAAAAGAUAAUUAAAAUAAAACAUUAGAACCAAAGGUUCUAAUGAAAUAAAAGAUUAUAGGAAACCUAUAAUCAAAUAAAAUAAUUAUAACAAUAUUUUCGAAUAUUGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.062
medium
78.601.6620.8310.60833.03012.20371.44002.77031.35930.31070.48630.66111.29861.27581.68421.52130.90150.59611.56530.57711.13621.11870.5551000000000.55091.08534.57662.92820000000.484800001.42582.56454.09981.30061.65260.817000-0.17860.406200-0.35550-0.17731.58942.6793.28861.25591.22870.51980.346300000.34460.16741.1812.72073.09420.91660.90523.1740.57262.3141.62192.60621.85291.38511.10973.2907
89
88BeisinisbiThree Branch Junction - Structure Mutation 25566569
GGAAUAACUCGAGGAAAUAAAACAUUAUGGCCAAAGGUUAUGAUGAAAUAAAACUCCGGUGGCAUCCACCGGAGAAAUAAAACCUCGAGAACCGACUCUUCGGAGUCGGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
3.391
medium
95.90.0240.4630.2430.2331.01270.91411.39831.00031.2150.6217-0.0301000.02390.023900.05660.37350.72180.64850.62390.25010.24040.17130.06850.08390-0.0150.02280.02280.02280.02280.00780.04550.15511.61451.83240.3740.21420.04920.06410.05550.0064-0.0150.1066000.08520.23350.87610.4330.31120.280.21160.24160.174-0.02990000000.41250.26360.71281.68030.82370.15470.04310.038600.01930000.05790.26910.7931.34330.71130.40750.41160.20020.22680.11780.19870.05420.03920.07520.09
90
89Three Branch Junction -Structure mutation 2 - 3 AU s clockwiseThree Branch Junction - Structure Mutation 25567811
GGAUAAAGUACGCAAAAUAAAAUGUCAUAUCCAAAGGAUAUGACAAAAUAAAAUCGUAAUGGAAACCAUUACGAAAAUAAAAUGCGUACAACGAUAAGUUCGCUUAUCGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.362
medium
86.70.0451.0420.5430.15341.44651.90842.32890.72480.480.94750000000.23610.00661.27382.56570.55340.76661.29090.63980.63420.42030000000.417900.72412.30381.37580.58490.850900.1919000000.19140.19091.40380.83270.98270.90.35820.35650.35471.39170.17360.014600.172300001.18652.13881.13371.89290.6255-0.110100.31140.045400.1550.30880.46021.50241.4722.30941.12091.64330.54370.53960.66840.156700.39741.04440.64690.2579
91
90Three Branch Junction -Structure mutation 2 - 3 AU s counter clockwiseThree Branch Junction - Structure Mutation 25567813
GGAUAAAGUACGCUAAAUAAAAAGUCAUAUCCAAAGGAUAUGACUAAAUAAAAACGUAAUGGAAACCAUUACGUAAAUAAAAAGCGUACAACGUUAAGUUCGCUUAACGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
0.77weak84.700.8260.4130.48851.90280.93912.71220.44920.44651.31520000000.43581.07341.47231.0280.81770.80860.402-0.211900.399800000000-0.21132.58960.74920.158700.35490.35320001.04441.029600.34161.01061.96650.32631.59560.632700.93680.3109000000.3096001.21772.35641.15941.42100000000.28310.2820.28091.64721.08180.80240.266501.30840.26080.25980.06140.2580.257100.2562
92
91Three Branch Junction -Structure mutation 2 - 3 UU s Three Branch Junction - Structure Mutation 25567820
GGAUAAAGUACGCUAAAUAAAAUGGCAUAUCCAAAGGAUAUGCCUAAAUAAAAUCGUACUGGAAACCAGUACGUAAAUAAAAUGCGUACAACGUAUAGUUCGCUAUACGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
8.436good92.90.0360.7680.4020.41380.73381.38941.07990.95160.6930.90240.06390.0138000.01820.03640.49280.95810.80620.91770.73570.61360.45790.77960.47880.053900.0103-0.01120.003900.01220.01620.09970.67011.69481.70660.55650.13930.01550.00450.00450.00340.01550.018900.02660.76171.21361.22841.27590.72570.78310.66440.51071.00350.16610.0207-0.00190.013800.0094-0.00880.03470.69121.56741.81811.41330.32430.09070.0443-0.00440.03160.00630.02090.13020.79911.23311.04621.70311.16281.07070.76210.75530.92990.55750.05590.03830.0350.03390.0252
93
923 Bran Mutation2 M1Three Branch Junction - Structure Mutation 25583872
GGAAUAAGGUAUGCAAAUAAAAGGUAGUAUCCAAAGGAUACUACCAAAUAAAACCUUGAUGGAAACCAUCAAGGAAAUAAAAGCAUACCAAGAGUCAGUUCGCUGACUCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
2.29
medium
95.90.0460.720.3830.21130.58640.92211.94490.81261.05570.5420.14420.07200000.0360.25121.54340.92970.77820.57610.43790.73360.13310.0665-0.03600000000.39692.49142.16910.211100.06170.06170000.061600.06160.05620.63981.66711.17160.64590.57510.36450.62380.2465000-0.035900.112800.22490.85272.11982.49791.20270.33110.05090.10170.10150.05070.10130.073700.15110.64911.02351.5980.94620.40010.58370.46390.50680.0920.09190.28470.18250.09120.0456
94
933 Bran Mutation2 M2Three Branch Junction - Structure Mutation 25583876
GGAAUAAGGUAUGCAAAUAAAAGGAUGUAUCCAAAGGAUAUAUCCAAAUAAAACCUUGAUGGAAACCAUCAAGGAAAUAAAAGCAUACCAAGACUUGGUUCGCCAAGUCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
2.37
medium
94.90.0490.7770.4130.41991.47671.07170.6810.74730.81460.1833-0.0382-0.038200000.36730.29261.71450.87880.55310.55510.55090.74970.136100000.06800.0679000.47221.80291.79560.63570.1521000-0.038100.1266000.08830.89751.40671.19450.99920.82040.6780.85960.34220.0570-0.0758000.056900.11370.73942.85042.43911.50650.25440.10160-0.11330.10150000.10130.95021.46651.79051.52740.99080.86510.6990.73650.13370.0890.05790.04440.17710.0443
95
943 Bran Mutation2 M3Three Branch Junction - Structure Mutation 25583880
GGAAUAAGGUAUGCAAAUAAAAGCAUGUAUCCAAAGGAUAUAUGCAAAUAAAACCAUGAUGGAAACCAUCGUGGAAAUAAAAGCAUACCAAGGCUAUGUUCGCAUAGCCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.66
medium
95.90.0490.6680.3590.21781.21890.73440.97910.70910.70790.30210.20090.10030.10020.10.0999000.44670.4441.39740.33180.28740.28630.28510.47210.18840.0941000.09390.0938000.09370.55791.1891.60980.26730.266300.0358000000.17690.12370.95791.53430.96721.06520.32970.57250.2730.2434000000.0811000.53741.82581.53231.93890.07450.07440.0743000000.05880.281.51931.55760.90730.58860.61790.81470.62020.06720.26780.26680.13320.19920.2646
96
95salish99_TBJ_SM2_01Three Branch Junction - Structure Mutation 25584860
GGGAAAACUCCACGAAAUAAAAGAGGAAUGCCGAAGGCAUUUUUCAAAUAAAACUCUGCUGGGAACCGGCAGAGAAAUAAAACGUGGAGAACGUAAUCUUCGGAUUACGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
5.73good92.90.0390.6140.3260.3140.44131.10051.03170.72910.60530.31290.04700-0.01250.02550.01280.01280.290.58140.85190.40570.67120.35960.52410.29290.07220.03010.0180.00360.0120.01200.0361-0.00240.11762.74731.5970.45420.10640.04480.02520.0335-0.00840.03630.0670.08080.05570.04990.63421.2361.07250.6520.47190.46230.56120.21680.04130.010300.44090.041-0.00650.01020.06840.37191.55611.8531.33160.17570.04750.04860.06630.01060.09460.44290.20630.52020.99711.56331.29290.92770.68070.6440.52080.11020.01710.02550.00870.0086-0.01590.1305
97
96salish99_TBJ_SM2_02Three Branch Junction - Structure Mutation 25584867
GGGAAAACUCCACCAAAUAAAAGGAUAAUGCCGAUGGCAUUAUCCAAAUAAAAGCUUGUCGGGAUCCGACAAGCAAAUAAAAGGUGGAGAACGAUUUCUUCGGAAAUCGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.8
medium
92.900.6860.3430.17610.10961.07940.96170.31770.940700.10440.1042000000.72231.7621.1630.51520.53420.67630.28870.0961000.09600-0.05090000.09582.67711.26980.27110000.1803000000.17980.35791.05811.1631.02570.76120.67040.82850.41190-0.05080.08230.08220.1640.65020.030400.1621.23422.35010.913000-0.050700000.11391.30551.53361.29121.95450.99830.79980.60720.40260.08330.01630.149600.06670.1995
98
97Structure 2 2Three Branch Junction - Structure Mutation 25603098
GGAAUAAGAUAUACAAAUAAAAGUAUAUACCCAAAGGGUAUAUACAAAUAAAAGUAUAUCGGAAACCGAUAUACAAAUAAAAGUAUAUCAACAUCGUCUUCGGACGGUGAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
0.911weak85.700.8190.40900.15190.45291.47891.164100.289900.28870000.28760.28640.28531.123700.36430.55330.54910.680.13570000000000.27051.84521.35520.7658000.25440000000.25350.25260.99660.98310.2450.2944-0.19170.96040.71320.2370000.470900.2347000.73551.3640.4518-0.190700.22520.25750.223200.222500.47162.15742.08462.78252.49512.76930.90290.72021.23890.17660.52580.34890.08710.74720.7581
99
98ChP TBJ SM2 2Three Branch Junction - Structure Mutation 25615400
GGAGAAACUACUGAAAAUAAAAUGUUCAGUCCAAAGGAUUGAGCAAAAUAAAAUGUAGUAGGAAACCUACUGCAAAAUAAAAUCAGUAGAGGGUAGUCUUCGGACUACCAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
1.277
medium
92.90.060.6550.3570.18460.78760.18080.87040.51210.885300.12630-0.0805000.31430.43730.61940.55330.83020.12120.28150.360.47690.70830.11790.117700000.467700.05840.75151.36141.44550.33210000000.1105000.11040.220.89660.96390.66190.75821.0330.2060.20540.10260.10240.3060.10180.10170.0216-0.079900.2741.43661.36110.86460000.09590000.19140.41040.70511.24741.53760.76080.92781.04510.43280.85550.34060.16990.00530.02120.33630.1677
100
99tbjstm2-3Three Branch Junction - Structure Mutation 25617938
GGAAGAAGAUGCUCAAAUAAAAGGUAGCUACCAAAGGUAGCUACCAAAUAAAAGCUCAUCGGAAACCGAUGAGCAAAUAAAAGAGCAUCAAAGGUCCAUUCGUGGACCUAAAAGAAACAACAACAACAAC
.......(((((((........((((((((((...))))))))))........(((((((((...)))))))))........)))))))..(((((((....))))))).....................
0.891weak85.700.9730.4871.85790.81881.60160.19961.37120.94470.383500000000.7591.48691.45710.72130.358900.35710-0.2113000-0.2106000.35540.35371.726300.34360.3421.67080.66220.656200000000.32662.82560.31261.32010.60690.60190.5970.2973000000000.58972.28470.56671.3897000-0.20940-0.20880.27690.06760.274802.77520.91351.02921.75750.99060.4920.730501.5570.69780.69120.22970
Loading...
Main menu