Iowa Mycoflora Fungi Collected (for sequencing)
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJ
1
Click here for a note about searching this spreadsheet
2
OrderGenusSpeciesRevised IDLocationCounty
Date Collected
SubstrateCollector's NameFinder's NameForay?Mycoflora IDiNaturalist IDGrant UsedShipment #Sent to Herbarium?GenBank AccessionSequenceNotes
3
AgaricalesBolbitiustitubansEagle PointClinton5/25/18
wood mulch and pine needles
Dave Layton04906
https://www.inaturalist.org/observations/12798262
Spring 2018 Mycoflora GrantShipment #1yes
TTAGAGGAANTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATAAACCTGGCTTGGTTGTTGCTGGCTCTCTCGGGAGCATGTGCACGCCRGTCACTTTTATCTTACCACCTGTGAACACTTTGTAGATCTGGAGGCATCTTCACAGAYTCTTTTGTCTGTGGTTTTTGGAAGTGYTCCGACTCTTCCTGGCCTTCAGGTTTATGTCTTTACATCTACACCATAAGCATGTAAACGAATGAATCAATGGCAGCTTCATTGCAGCCTATAAAACTTAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATCCTGTCTTTCTTTCGAGAGGCAGCGATGCGTTGGATGTGGGGACTTGCCTGTTTCTTATGAGACTTCGGCTTCCCTTAAAAGCATTAGCTAGAGCGCTTCTGTTGACTAGCTGCTAGTGTGATAATTATCTACACTGTGGCCAACGAAGGAAACTCTGCTTCTAATCGTCTGCTTGCAGACAACTTCTGATATCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA
titubans usually on dung - closely related though
4
TremellalesTremellareticulataHomeClinton6/9/18groundDave Layton04907
https://www.inaturalist.org/observations/13262110
Spring 2018 Mycoflora GrantShipment #1need replacement specimenno
aging - no dried sample
5
AgaricalesRussula fragrantissimaEagle PointClinton6/12/18groundDave Layton04908
https://www.inaturalist.org/observations/13371040
Spring 2018 Mycoflora GrantShipment #1yesno
6
BoletalesParagyrodonsphaerosporusEagle PointClinton6/12/18groundDave Layton04909
https://www.inaturalist.org/observations/13370443
Spring 2018 Mycoflora GrantShipment #1yes
GTGACCTGCGGAGGATCATTATCGAACAGCAATCCGAAGGGGGAGAGGGGCGAGCGAAGTCGGGTGGAGCGTAGAGATCGTAGCTGGCCTTTGGAAACGAAGGCATGTGCACGTCTAGACCTCTTCCCAGTCCTCGCTCCCTTTCCTTTCGTGAACCTTCGACACCCGTGCACCTCTTGTAGGTCCCCTCTAGGGGGGATCTATGTCTTCGTCTACCCCAATCGTATGTCTACGAATGTATCTATGACGTCGTCGACCTGGCTGACGCCTCGTGGGCGATGGATAAAAGTTATTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAAYGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAGTTCTCAACCGTGACTCGATCGATTTCGAGGCCCATGGCTTGGATTTTGGGGGCTGCTGGCGACCGTAGGGTCTTCGGCTCTCCTTAAAGGCATTAGCAAAGGCAGGCCATCCCTGCATGCACGGCCCTCGACGTGATAACGATCGTCGTGGCTGGAGTGCTGGGGCGTGGTCTCACAGTCTATGCTTCCAATATCGCGACTTTCGCTACGGCGGAAGTCCCTCTTCGAAACT
with white oak
7
AgaricalesMarasmiusoreadesHomeClinton6/9/18groundDave Layton04910
https://www.inaturalist.org/observations/13258372
Spring 2018 Mycoflora GrantShipment #1yes
GTGACCTGCGGAAGGATCATTATTGAAACATTGTAAAGGGAGGTTGAGCTGGTTCTTCTAGAGCAAGTGCTCGCCTGTCTTTCGATATTCATCCACCTGTGCACTTTTTGTAGGAAGGCCGAGAAGATGGACCTGGTTAAACAACCAGGTCTTTTGGTATCGGGGCTTTCTATGTCTTTTATACACTCTGTATGTTTTTGAATGTCCTTTATAAAGGGGCTTAGTTGACCCTTTTAAACAAACTATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTCTTGGTATTCCGAGAGGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCTCAAAAGCTTTTTTGTTTCTGAGGCTTGGATGTGGAGGCTTTTTTTGCTGGCTTGCTTTTTAGAGTCAGCTCCTCTCAAATGCATTAGTGGAAACCTGTTTGTAGTCCGCGTTGGTGTGATAATTATCTGCGCCATTGTATTCGTGGCTACAGCTCTTGTGGTGTTCGTTTGGAAAGCTGCATGAACTTGCTCTTTCTGTTCTGATTGACCTGCGAGAGAGTATATGGTATTCGCTTCAAACCGTCCTAAGTCGCTGGACAACCTTTGACTATTTTGACCTCAAATCAGTANGACTACCCGCTGAACTTAAGCATATCA
8
AgaricalesRhodotuspalmatus
Indian Creek Nature Center
Linn5/31/18HardwoodSarah Duhon04951
https://www.inaturalist.org/observations/12993962
PHIL Student Success Grant
9
AgaricalesMegacollybia (?)rodmanii (?)
Indian Creek Nature Center
Linn5/31/18Pinus strobusSarah Duhon04952
https://www.inaturalist.org/observations/12993983
PHIL Student Success Grant
Looks like M. rodmanii but the spores are round, and substrate was definitely Pinus strobus.
10
AgaricalesCoprinopsisvariegataSquaw Creek ParkLinn6/4/18HardwoodSarah Duhon04954
https://www.inaturalist.org/observations/13125554
PHIL Student Success Grant
Growing from a milled log used as a trail step, as well as the base of a nearby dead tree
11
AgaricalesGymnopilus fulvosquamosus (?)Squaw Creek ParkLinn6/4/18DeadwoodSarah Duhon04955
https://www.inaturalist.org/observations/13126892
PHIL Student Success Grant
12
AgaricalesCoprinopsisromagnesiaFlying Fox Trail (Pinicon)Linn6/5/18Acer saccharumSarah Duhon04957
https://www.inaturalist.org/observations/13151528
PHIL Student Success Grant
At the base of a living sugar maple, bent over with some roots exposed, otherwise healthy. Probably growing off of broken roots
13
AgaricalesMycenaleianaMt. Hosner ParkAllamakee6/8/18HardwoodSarah Duhon04958
https://www.inaturalist.org/observations/13248397
PHIL Student Success Grant
Ganoderma megaloma growing on the same tree, which had been cut cleanly at the base
14
AgaricalesVolvariellabombycina
Indian Creek Nature Center
Linn6/23/18live mapleSarah DuhonPSMCyes04959
https://www.inaturalist.org/observations/13704103
PHIL Student Success Grant
15
CantherellalesCantharellus"cibarius"Ellis ParkLinn7/3/2018SoilSarah Duhon04960
https://www.inaturalist.org/observations/13787873
PHIL Student Success Grant
Likes mossy soil and lightly grassed patches
16
CantherellalesCraterellusfallaxEllis ParkLinn7/3/2018SoilSarah DuhonRoger Heidt04961
https://www.inaturalist.org/observations/14020824
Spring 2018 Mycoflora GrantShipment #1yes
TTGATACATTGAAAAAGGCCAGGAGGGGCCTCTATCCTTTTATAAGGATCATTGGAAGCAAGTTTCAAAATCACTGAGACTTTTCATGACTGAGACGTATGAGATTCCTCTCAAGGAGGCCTGACCAAATTAACAACGCCCTCATTCGAAAAGACTTTCAAGTGCTGAGAAGCTTTTGCTAATGCTTTCAAGGTGAGCCAAGATAGAATATTTCACGGCAAGACCCAAATCCAAAGGGTTTTAAAACCAAAAACCCTTTGAGAGGTTCAAATGACCCTCGAACAGACGTACCCCCTATGAGTCAACCCCCAATTGGAAGCGACCGAGAGGGCGCAATTGCGTTCAAAGACTCGATGATTCACTTGGTGTTATTCGTAAATTAGAGTTACTTGGATGCAATTCACACCAGTTATCGCATTTCACTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCATTGCTGAAAGTTGTAAATGAGCCCATGTTTATGATAATTCCAATATGGACAATTATCTCAAGTTCTCTAGACTCAAGAGAGACAAGATAGAGAATACAACCTTGGGTTTAACAAACCCTCAATCATATCTTCTCTC
Found near Cantharellus
17
BoletalesBoletus (?)pallidus (?)Ellis ParkLinn7/9/18SoilSarah Duhon04962
https://www.inaturalist.org/observations/14201442
PHIL Student Success Grant
Found twice (first time, iNat ID 14017375) spore surface stains blue then dark purple, in cross section pores and context near it stain blue then reddish
18
AgaricalesGliophoruspsittacinus
Wickiup Natural Area / County Park
Linn7/23/18MossSarah Duhon04963
https://www.inaturalist.org/observations/14655401
PHIL Student Success Grant
Orange stem base, orange/yellow/olive cap, with bluish green tint. Gelatinous cap. In moss at the base of dead Prunus serotina.
19
Dacrymycetales
Dacryopinaxelegans
Indian Creek Nature Center
Linn8/6/18HardwoodSarah Duhon04965
https://www.inaturalist.org/observations/15178275
PHIL Student Success Grant
20
LeotialesLeotialubrica
Indian Creek Nature Center
Linn8/6/18SoilSarah Duhon04966
https://www.inaturalist.org/observations/15178313
PHIL Student Success Grant
Bluish at the base
21
PolyporalesTrametesgibbosa
Palisades-Kepler State Park
Linn8/8/18HardwoodSarah Duhon04967
https://www.inaturalist.org/observations/15251175
PHIL Student Success Grant
Appears perennial, growing new shelves from last year's
22
AgaricalesMycenahaematopusPinicon RidgeLinn8/11/18HardwoodSarah DuhonPSMCyes04968
https://www.inaturalist.org/observations/15319751
Spring 2018 Mycoflora GrantShipment #1yes
CGTAGGTGACCTGCGGAAGGATCATTATTGAATACGATTGGGACTGATGCTGGCTCTTCACTGAGCATGTGCTCGTCTCGTCTATTTATCTTCTCTTGTGCACATCTTGTGGTCTTGAATTGAAAACCTTTTCGCATTCGTGCGGTTTGGGAGATTGTTAAACCTTCTCCTGCTTTCGTCGCGGTTTGGGAGATTGTTAACCCTTTCTTCTGTTTCCTTCGYGCGGTTTGGGAGATTGTTAACCCTTCTCCTGCTTGATTCAAGGCCATGTTTTCATATACACTATATAAAGTTACAGAAYGTCTTTTAACGATTGCGCTTGTCGTAGTCATTAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACCTTGCTCGCTTTTACTAGTTTGAGTTAGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGACGGTCTGCTCCCTTTRAATACATTAGTGGGATCTCTTGTGGACCGTCACTTGGTGTGATAATTATCTATGCCTTGCGACTTTGAAGCAAACTTATGGGAATCCGCTTATAACCGTCTTCGGACAAYTAATGACTATTGACCTCAAATCAG
Bleeds red (ID # was switched with C. odora, was 04969 should be 04968)
23
AgaricalesClitocybeodoraPinicon RidgeLinn8/11/18Pine duffSarah DuhonPSMCyes04969
https://www.inaturalist.org/observations/15332050
Spring 2018 Mycoflora GrantShipment #1yes
TAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACTTGGTTGGGTTGTTGCTGGCTTTTCGGAGCATGTGCACGCCTAGCGCCATTTTTACCACCTGTGCACTTCTTGTAGATTTGAAACACCTCTCGAGGAAACTCGGTTTGAGGACTGCTGTGCGCAAGCTAAGCTTTCCTTGCGTTTCAGGTCTATGTTTTTATATACCCCATAAGAATGTTTTAGAATGTCATTAATGGGCTTCATTGCCTCTAAATTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCTTTCAGCTTTTGCGAGCTGGATTGGCTTGGATGTGGGGGTTTGCGGGCTTCTCAGAAGTCGGCTCCTCTTAAATACATTAGCGGAACCTTTGTGGACCAGCTTTGGTGTGATAATTATCTACGCCGTGGTTGTGAAGCAGCTTTATATGGGGTTCAGCTTCTAACCGTCCATTGATTTGGACAATTTCTGACATTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC
Anise scent (ID # was switched with M. haematopus, was 04968 should be 04969)
24
ThelephoralesHydnellumconcrescens?Rock Island PreserveLinn8/21/18SoilSarah DuhonGlen Schwartz04970
https://www.inaturalist.org/observations/16475309
Spring 2018 Mycoflora GrantShipment #1yes
TGCGGAAGGATCATTATAGAAATCGTGATGGCTCGTGAAAGGTTGTTTGCTGGTCCTACAGGGGCATGTGCACGCTTGGATCGGGTTCGTTCATCCTTTTCTTCCACACACCTGTGCACGATCTGTAGCTTAGGGATGATCACGAAGTTGCTCTGTCRATTTCGAATGCCCTTCGCTATGTATTATAACACACGCTCTATGTATTTTGGAATGTTAYGGATATATGCGTGTTAACAAACGCAGATGCAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTATCAACTGCTTTGATTTTTTTTGAAGTGAAGTTGGATTTGGAGTGTTTGCTGGCGATTTCGTTCAGCTCCTCTTAAAWGCATTAAAGCCGTCGTTATTATTCCTGGCATTGAAGTATCTTTGACGTGATAACTATCTACGTCGCAGAGAAAGCTTTGAATGTGTTACGGCTTCATTACAAAGTCGCCGATAAGACTTTGCATTGATCAATTTGACCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGCATATCAT
Either some different species or a lot of morphological variance (maybe a feature of age)
25
GomphalesRamaria aureaMaquoketa CavesJackson9/1/18soilDave LaytonPSMCyes04971
https://www.inaturalist.org/observations/16102928
Spring 2018 Mycoflora GrantShipment #1yes
CGTAGGTGACCTGCGGAAGGATCATTACAGTATGATTAGGGGGTTAGATGCTGGCCCGTGAGGGCATGTGCGCACCCCCATCTTCTAATCCCACACACACCTGTGCACCTATGGAGAAGCGCCTCCCATCTTGGAGTCGTCTGGCGTCCTTCTCTCTCTTCGGAGGGTGGGGGAGGCTGGACTGGGGTGCTCTCTCCTTTTACATCTCAGCCTGTTAAAAYGCATGTCTTTTGAGCCCTACGGGGGTGGAAAATTGTAATACAACTTTCAACAACGGATCTCTTGGCTTTCGCATCGATGAAGAACGCCGCGAAAGTGCGAAACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAAACCCTCTCGACCCTCCTTCTTTGCTGAAGGAGGGTTGGATTTGGACGCTTGCGGTGGGTTCCCATCGCTCGTCTCTAAATGCATCAGCTGGTCCCATAGAGTTGGTTTGACGATGGTGTGATAATATACACTTTTTGTTGACTGTGGCGCCGTCCTAGGCCGACTCTGAACCGGGCCGCTCATAGCCGTCTTCGGACARTGATTTCATGTCGTCTGACCTCAAATCAG
26
GomphalesRamaria strictaMaquoketa CavesJackson9/1/18soilDave LaytonPSMCyes04972
https://www.inaturalist.org/observations/16107994
Spring 2018 Mycoflora GrantShipment #1yes
AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTGAAACGTAATCGGGGGAGGGCTGCTGCGTGTATTGCGCGCCCCTCTCCCGTGACGCATCCACTTACACCTGTGCACCTGTCGGCGAGCGCCTTTGGGGGCGCCGCCGTCCTTTCACAACCGCTCTGTAATGCATGTTTGAACGCCCCACGGGGTTGGAGTAAAGTAACAACTTTCAACAACGGATCTCTTGGCTTTTGCATCGATGAAGAACGCCGCGAAAGTGCGAAACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGTAATGCCTCGAAGCCCTCCCTTTTGACCGAGGGTAAGGCTTCGGACTTGGATGTTTGCGGCTGGTGGCCGCTCGTCTTGAAATGCATTAGCTTGGTCCCCTCGGACGACGACGGTGTGATAATAGACGCTATGTGACGCCGTCAAAGTCTAACRGAGGGGACGGCTGACAGCCGTCCTTTGAAAGGACAGTGTTTGAACGTATGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC
27
AgaricalesHygrocybeconicaMaquoketa CavesJackson9/1/18soilDave LaytonPSMCyes04973
https://www.inaturalist.org/observations/16102867
Spring 2018 Mycoflora GrantShipment #1yes
CGTAGGTGACCTGCGGAAGGATCATTACTGAAGTGATTTGGGGATGTTGCTGGCCTCTCAAGGGGGGCATTGTGCACTCCTCGAAACAATTCACAATTTCCATCACACCCCTTGTGCACATCTTGTAGG
28
AgaricalesRussulaspMaquoketa CavesJackson9/1/18soilDave LaytonPSMCyes04974
https://www.inaturalist.org/observations/16108923
PHIL Student Success Grant
29
GomphalesClavariadelphusamericanusMaquoketa CavesJackson9/1/18soilDave LaytonPSMCyes04975
https://www.inaturalist.org/observations/16108936
Spring 2018 Mycoflora GrantShipment #1yesno
30
BoletalesBoletuspseudosensibilisMaquoketa CavesJackson9/1/18soilDave LaytonPSMCyes04976
https://www.inaturalist.org/observations/16116154
Spring 2018 Mycoflora GrantShipment #1yes
GGGGGAAGATTGGGGAGTTGGACTGTCGCTGGCCCCNTCGGGCATGTGCACGTCTTGCTTTTCGTCGACCTTCTCTCACCCACACACACCTGTGCACCCGCTGTAGGTTCTCGAGAGAGGATCTATGTTTTTCACATCACACCCTATCGTATGTCTACAGAATGTATTGAAAACGTCGACCGACACTCGTGTTGGCCGGCGGTGAAATAAATCATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTGAATTCTCAACCATGCCTTGATTGACTTTCGAGGCATGGCTTGGAGTTGGGGGTTGCTGGCAGCGAAAAGCTTGTCGGCTCTTCTGAAATGCATTAGCAAAGGACGGCAAGTCTTTGACGTGCACGGCCTTCGACGTGATAATGATCGTCGTGGCTGGGAGCGTCGGACATGCATGAATCGTTCGTGCTTCCAATCCATATGCATTCCCTAGCTCGAGCGAGTTTTCTTAGCTACTAGTTGGTCGCGAGGCCGACGAACGTTGGGCAAGCTTGCTTTTGCTGGGTTGGCATTTTCGAAACTGACCTCAAATC
flash green with ammonia
31
AgaricalesCortinariusviolaceus
Cortinarius subsolitarius
Maquoketa CavesJackson9/1/18soilDave LaytonPSMCyes04977
https://www.inaturalist.org/observations/16116383
Spring 2018 Mycoflora GrantShipment #1yes
GATTTGAGGTCACATTAATGAAAAGTTGTCCAAGTCAATGGACTGTTAGAAGCTGAACTGCTTCACGTCAATAGCGTAGATAGTTATCACACCAATGAACGGTCCACAAATTGTTCCGCTAATACATTTCAGGGGAGCTGACCTTTGAAAGACCAGCAAATACCCCCACAGCCAACACTCAACAAACAAAAATCTGAAGAGGTTGATATATTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAGGTTTATAGGCACAAAGAGAGCCCATTGATTACATTCTATAACATAGATTGGAGTATATGAATGAAACATAGGCCTAGAAATGTAAAGAGAGACAAATGAAATGTCAATCCTCAAACCTGGAATGGCTAGCATTCAGAGAGATATCCAGGTCTACAAAAGGTGCACAGGTGGAGATATAAAGATGACAAGTGTGCACATGCTCCCTAGAGAACCAGCAACAACTCATCAGGTTTATTTCAATAATGATCCTTCCGCAGGTCAC
matched C subsolitarius type material on GenBank
32
BoletalesBoletussensibilisEagle PointClinton8/27/18soilDave Layton04978
https://www.inaturalist.org/observations/15950523
Spring 2018 Mycoflora GrantShipment #1yes
TTTTTCACATCACACCCTATCGTATGTCTACAGAATGTATTGAAAACGTCGACCGACACTCGTGTTGGCCGGCGGTGAAATAAATCATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTGAATTCTCAACCATGCCTTGATTGACTTTCGAGGCATGGCTTGGAGTTGGGGGTTGCTGGCAGCGAAAAGCTTGTCGGCTCTCCTGAAATGCATTAGCAAAGGACGGCAAGTCTTTGACGTGCACGGCCTTCGACGTGATAATGATCGTCGTGGCTGGAGCGTCGGACATGCATGAATCGTTCGTGCTTCCAATCCATATGCATTCCTAGCTCGAGCGAGTTTTCTTAGCTACTAGTTGGTCGCGAGGCCGACGAACGTTGGGCAAGCTTGCTTTTGCTGGGTTGGCATTTTCGAAACTTGATCTCAAATCAGGCA
quick dark blue stain no ammonia flash
33
AgaricalesCortinariusrubripesMaquoketa CavesJackson9/1/18soilSarah DuhonPSMCyes04991
https://www.inaturalist.org/observations/16100761
Spring 2018 Mycoflora GrantShipment #1yes
AAAGGTCAGCTCCTCTGAAATGCATCAGCAGAACGACCTGTTCAATTGGTGTGATAACTATCTATGCTATTGAATGATGAAGGCAGTTCAGCTTTCTAACAGTCCTCGGACAATTTATCATTTA
34
?Resupinatus?Maquoketa CavesJackson9/1/18mossy deadwoodSarah DuhonPSMCyes04992
https://www.inaturalist.org/observations/16110476
Spring 2018 Mycoflora GrantShipment #1yes
CGTAGGTGAACCTGCGGAAGGATCATTATTGAATTCAACGCGAAGTTGTGCTGGCTTGTCAAGAGCATGTGCACNCGACGCATATATTCANCCACCTGTGAACCTATTGTAGATCTGAGAATATTTNTCAAGGAAACTTGGACGTGGAGCTTGGCGGCCTTTGCTTAGAAGGTCGNCTGCTCTTGCTTCTCAGGTCTATGTTTCTACATACCCCATAGCATGTTATAGAATGTTATAAATGGCTTATAAGCCTTTAAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTGCTGGTTTAAAAGGCTTGGATGTGGAGGCTTATGCGGGCTTCTTCGAAGTCGGCTCCTCTCAAATGCATTAGCAGAGCCATTGTGTCAGCTTTG
Jellylike texture in rosette clusters, with raised wrinkes, dark grey/brown/black
35
AgaricalesMycenaleptocephala
Wickiup Natural Area / County Park
Linn9/18/18conifer branches/sticksSarah Duhon04995
https://www.inaturalist.org/observations/16672536
PHIL Student Success Grant
36
AgaricalesRussulapulchraEagle PointClinton6/14/18groundDave Layton59701
https://www.inaturalist.org/observations/13431679
Spring 2018 Mycoflora GrantShipment #1yes
MF59701-iNat13431679
mild flavor pink stain on solid stem
37
AgaricalesAmanitarussuloidesEagle PointClinton6/19/18groundDave Layton59702
https://www.inaturalist.org/observations/13615170
Spring 2018 Mycoflora GrantShipment #1yesno
growing with spruce or fir
38
PezizalesHelvellacrispaStrasser woodsDes Moines6/18/18groundDave Layton59703
https://www.inaturalist.org/observations/13593421
Spring 2018 Mycoflora GrantShipment #1yesno
39
AgaricalesRussulaparvovirescensEagle PointClinton7/2/18soilDave Layton59704
https://www.inaturalist.org/observations/14044873
Spring 2018 Mycoflora GrantShipment #1yesno
iNaturalist pic shows color - delicious!
40
AgaricalesLactariushygrophoroidesEllis ParkLinn7/3/18SoilDave LaytonSarah Duhon59705
https://www.inaturalist.org/observations/14013518
PHIL Student Success Grantwide gills
41
AgaricalesLactariuscorrugisEllis ParkLinn7/3/18SoilDave Layton59706
https://www.inaturalist.org/observations/14071606
Spring 2018 Mycoflora GrantShipment #1yes
AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAACAGGAGGTGCCGAGGTTGTCGCTGACCCTAGGTCGTGCACGCCTCGAGCATTCTTACTCCTCATCCACCTCACCCCTTTGTGCATCCCCGCGTGGGCTTCTCTTTCGAGATGAGCCGGCGTCTTTACACAAACGTAAAGCATTGTAGAATGTTCTTTGCATATATTTCTATGCAGTCAATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAAGGGCACACCCGTTTGAGTGTCGTGAAGTTCTCAACCTTTCTCATTTCTTTGTTGACTTGGTGAAAGGCTTGGAATTTGGAGGTCTTTGCCGGACTCTCTCGATCGAGATCGGCTCCTCTTAAATGGATTAGTAGGATCCCTTTACGCTGGTCCTCGACGTGATAAGGCTTTTCTACGTCTGGAGCTTAGCTTATTAGGCCTGCTTCTAATCGTCTCTTCGAGACAGTTGGTCAGAATCCTTCTGACCTGTGAACCCTTTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGC
dark wrinkled cap baked odor
42
AgaricalesMelanoleucasp?
Indian Creek Nature Center
Linn6/23/18probably soilDamian PieperPSMCyes59707noneeds iNat observationCavalier
43
AgaricalesBovistella radicataHomeClinton6/21/18soilDave Layton59708
https://www.inaturalist.org/observations/13646735
Spring 2018 Mycoflora GrantShipment #1yesno
44
AgaricalesLactariusvolemusEllis ParkLinn7/3SoilDave Layton59709
https://www.inaturalist.org/observations/14013472
Spring 2018 Mycoflora GrantShipment #1yes
AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACCACAGGAGGTGCCGAGGTTGTCGCTGACCCCCCTGGGTCGTGCACGCCTCGAGCATTCTTACTCCTCATCCACCTCACCCCTTGTGCATCCCCGCGTGGGCTTCTCTTTCGAGAGAGGCCGGCGTCTTTTTACAAACACAAAGCAGTTTAGAATGTTCTTTGCATTTGTATGCAGTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAAGGGCACACCCGTTTGAGTGTCGTGAAGTTCTCAACCTTCTTCATTTCTTTCTTGACTTGGAGAAAGGCTTGGACTTTGGAGGCTTTTGCCGGACTCTCTTTCATCGAGGTCGGCTCCTCTTAAATGCATTAGTAGGATCCMYTTTTGCTGGTCCTCGACGTGATAAGGCTTTTCTACGTCTGGGACTTAGCTTACGAGGCCTGCTTCTAATCGTCTCTCTCGAGACAAGCTGGTCAGACCCCYCTCTGACCTGTGAACCCCTTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGCATATC
lighter cap slightly fishy odor
45
AgaricalesAmanitafulvaEllis ParkLinn7/3/18SoilDave Layton59710noneeds iNat observation
Tawny grisset Copper color cap
46
AgaricalesRussulabarlaeEagle PointClinton7/12/18SoilDave Layton59711
https://www.inaturalist.org/observations/14295751
Spring 2018 Mycoflora GrantShipment #1yes
GTAGGTGACCTGCGGAAGGATCATTATCGTACAACCGAGGTGCAAAGGCTGTCGCTGGCCCTCAAAGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACCTTTGTGCATCACCGCGTGGGTCCCCTTTGCGGGAGGGCTTGCGTTTTCACATAAAACTTGATACAGTGTAGAATGTTTCTTTTGCGGTCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATCTTCAAAATCCTTTTTCCTTTGAACCATTGTGGTCGGGAAAAGGGGTTTTGGACTTGGAGGTTTAATGCTCGCCCTTTCTTTCGAAAGTGAGCTCCTCTCAAATGAATTAGTGGGGTCCGCTTTGCTGATCCTTGACGTGATAAAATGTTTCTACGTTTTGGGTTTAGCTCTGTTCCTTGGACGCCTGCTCCTAACTGTCTCATTGACAATGATGGCGCTCTGGTCACTTGCCGTCTACATCGGCGGGAGGCTGGACCCACAAAAAGAAAACCTGACCTCAAATCG
copper colored, shrimp smell, oaks
47
AgaricalesAmanitaflavorubescensEagle PointClinton8/27/18SoilDave Layton59712
https://www.inaturalist.org/observations/15949721
Spring 2018 Mycoflora GrantShipment #1yesno
48
BoletalesBaorangiabicolorEagle PointClinton7/29SoilDave Layton59713
https://www.inaturalist.org/observations/15437268
Spring 2018 Mycoflora GrantShipment #1yes
CCGTAGGTGACCTGCGGAAGGATCATTATCGAATTTCGAGGGGGGGAAGATTGGGGAGTTGGACTGTCGGCTGGCCCTCGGGCATGTGCACGTCTTACTTTTCGTCGACCTTCTCTCACCCACACACACACCTGTGCACCCGTTGTAGGTTCTCGAAAGAGGATCTATGTTTTTCACATCACACCCCTATCGTATGTCTACAGAATGTATTGAAATGAAATAAATCATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTGAATTCTCAACCATGTCTTGATTGACTTCGAGGCATGGCTTGGAGTTGGGGGTTGCTGGCAGCGAAAAGCTCGTCGGCTCTCCTGAAATGCATTAGCAAAGGACGGCAAGTCTTTGACGTGCACGGCCTTCGACGTGATAATGATCGTCGTGGCTGGAGTGTCGGACATGCATGAATCGTTCGTGCTTCCAATCCATATCCATTCCTAGCTCGAGCTCAGTTGCTTAGCTACTAGTTGGTCGCGAGGCCGACGAACGTTGGGCAAGCTTGCTTTTGGCTGGGGGTTGGCATTTTCGAAACTGACCTCAAAT
light blue gray ammonia flash may indicate a related species.
49
BoletalesLeccinumrugosicepsEwing ParkPolk8/22/18SoilDave Layton59714
https://www.inaturalist.org/observations/15785304
Spring 2018 Mycoflora GrantShipment #1yesnowith oaks
50
AgaricalesPluteuslongistriatusEwing ParkPolk8/22/18decayed logDave Layton59715
https://www.inaturalist.org/observations/15784640
Spring 2018 Mycoflora GrantShipment #1yes
GATCATTANCGAATAAACAAGTGTTGGTTGTGCTGACCATTCCTGGTATGTGCACGCTGACCACTGTTTCATTCATTTTCCACCTGTGCACTTCATGTAGTCCATTGCATTGCTGATTTCGGGCCTTTTAAGCCTGGTTTAAGGAAGTTGCCTGTTTCACAACAGGCTCTTCTTGGGCATGTATGGTCTATGTTTACTATCTACACCATATAAATGTCATAGAATGTATCAAGCCTTGTGCCTTTAAACTATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCNAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCTATGCTCTCTTGTATTGTATGGTGATTGGATTATGGAGGCTGCTGGCTTGTTCAGCTCCTCTTA
51
AgaricalesLeucoagaricusamericanusLincolnwayClinton9/8/18wood mulchDave Layton59719
https://www.inaturalist.org/observations/16329821
PSMC Grant
52
PhallalesMutinuselegansRobins, IALinn9/19/18Wood chip mulchRoger HeidtNo59737
https://www.inaturalist.org/observations/16704355
PSMC Grant
53
PhallalesPhallusrubicundusRobins, IALinn9/19/18Wood chip mulchRoger HeidtNo59738
https://www.inaturalist.org/observations/16704530
PSMC Grant
54
PolyporalesGrifolafrondosaWapsipinicon State ParkJones9/19//18Base of Oak treeRoger HeidtNo59739
https://www.inaturalist.org/observations/16704759
PSMC Grant
55
PhallalesLysurusperiphragmoidesSW Cedar Rapids, IALinn9/20/18Soil mulch mixRoger HeidtNo59740
https://www.inaturalist.org/observations/16728109
PSMC Grant
56
PhallalesPhallushadriani
Wickiup Hill Natural Area / county Park
Linn9/18/18
soil/leaf litter and pine needles
Roger HeidtNo59741
https://www.inaturalist.org/observations/16687072
PSMC Grant
57
PolyporalesLentinustigrinus
Indian Creek Nature Center
Linn5/31/18Ulmus (dead)Sarah Duhonneeds voucher
https://www.inaturalist.org/observations/12993970
PHIL Student Success Grant
58
ThelephoralesThelephoraanthocephala
Palisades-Kepler State Park
Linn9/8/18SoilSarah DuhonPSMCyes04994
https://www.inaturalist.org/observations/16325126
PHIL Student Success GrantNo smell
59
HypocrealesCordyceps?
Palisades-Kepler State Park
LinnBeetle larvaeSarah DuhonPSMCyes04993
https://www.inaturalist.org/observations/16325143
PHIL Student Success Grant
In rotten wood on beetle larvae
60
AgaricalesPholiotaalnicolaSpringdaleClinton9/21decayed logDave Layton04981
https://www.inaturalist.org/observations/16762925
PSMC Grant
61
AgaricalesLepiota subincarnataEagle PointClinton9/24/18leaves and soilDave Layton04984
https://www.inaturalist.org/observations/16875878
PSMC Grant
deadly dapperling
62
AgaricalesStrophariarugosoannulataEagle PointClinton9/22/18wood mulch and leavesDave Layton04983
https://www.inaturalist.org/observations/16874636
PSMC Grant
Winecap or Garden giant
63
AgaricalesClitocybesubconnexaEagle PointClinton9/22/18
pine needles and leaves
Dave Layton04985
https://www.inaturalist.org/observations/16874663
PSMC Grant
64
AgaricalesClitocybeodoraEagle PointClinton9/22/18LeavesDave Layton04982PSMC Grant
65
RussulalesLactariuscamphoratusRobins, IALinn6/11/2018GrassRoger HeidtNo59742
https://www.inaturalist.org/observations/16949080
PHIL Student Success Grant
Near oak tree in lawn
66
RussulalesLactariuschelidoniumWickiup Hill Natural AreaLinn9/29/18Pine needle duffRoger HeidtNo59743
https://www.inaturalist.org/observations/17047325
PHIL Student Success Grant
67
CantherellalesCantharelluscinnabarinusRock Island PreserveLinn9/30/18SoilRoger HeidtGlen SchwartzNo59744
https://www.inaturalist.org/observations/17078898
PSMC Grant
68
BoletusCyanoboletuspulverulentisSpringdaleJackson9/28/18soilDave Layton59716
https://www.inaturalist.org/observations/17028160
PSMC Grant
69
AgaricalesHygrophorusrussulaEden ValleyJackson10/6/18soilDave LaytonPSMC59725
https://www.inaturalist.org/observations/17246942
PHIL Student Success Grant
70
PolyporalesPolyporusradicatusEden ValleyJackson10/6/18SoilRoger HeidtPSMC59745
https://www.inaturalist.org/observations/17301568
PHIL Student Success Grant
71
AgaricalesGymnopilusluteusEden ValleyJackson10/6dead logDave LaytonDave LaytonPSMC59726
https://www.inaturalist.org/observations/17336144
PHIL Student Success Grant
72
AgaricalesLyophyllumdecastesLincolnway Clinton IAClinton10/10/18GrassDave LaytonDave Layton59720
https://www.inaturalist.org/observations/17420690
PSMC Grant
73
AgaricalesClitocyberivulosaLincolnway Clinton IAClinton10/11/18GrassDave LaytonDave Layton59721
https://www.inaturalist.org/observations/17420703
PSMC Grant
74
AgaricalesHypsizygusulmariusSouth Troy Park TrailLinn10/13/2018TreeRoger HeidtNo59746
https://www.inaturalist.org/observations/17481972
PSMC Grant
75
AgaricalesLepistanudaRock Island PreserveLinn10/14/2018SoilRoger HeidtNo59747
https://www.inaturalist.org/observations/17515328
PSMC Grant
76
AgaricalesFlammulinavelutipesSouth Troy Park TrailLinn10/13/2018Dead TreeRoger HeidtNo59748
https://www.inaturalist.org/observations/17482006
PSMC Grant
77
RussulalesLentinellusursinusSwiss ValleyDubuque10/18/18Dead TreeRoger HeidtNo59749
https://www.inaturalist.org/observations/17651278
PSMC Grant
78
AgaricalesTricholomasubresplendensRock Island PreserveLinn10/16/18SoilSarah DuhonRoger Heidt72657
https://www.inaturalist.org/observations/17689803
PHIL Student Success Grant
Blue-green stain at the base of stem. Sandy soil near oak and birch. Very many of them.
79
PezizalesAleuriaaurantiaJ. Harold Ennis PreserveLinn10/23/18SoilSarah Duhon70701
https://www.inaturalist.org/observations/17842235
PHIL Student Success Grant
80
HypocrealesHypocreasulphureaPinicon RidgeLinn10/27/18Dead woodRoger HeidtNo59750
https://www.inaturalist.org/observations/17912008
PSMC Grant
81
AgaricalesClitopilusprunulusEagle PointClinton10/30/18leaf litter and soilDave LaytonNo59727
https://www.inaturalist.org/observations/17965502
PSMC Grant
82
PolyporalesPycnoporuscinnabarinusPinicon RidgeLinn11/23/18Downed logRoger HeidtNo04996
https://www.inaturalist.org/observations/18582971
83
AgaricalesPhyllotopisisnidulansPinicon RidgeLinn11/23/18Downed logRoger HeidtNo04997
https://www.inaturalist.org/observations/18583040
84
PolyporalesPycnoporussanguineus
now Trametes sanguineus
Big Grove PreserveJohnson9/15/18Dead branchSarah Duhon70916
https://www.inaturalist.org/observations/16566625
Dried but not yet sampled
85
PolyporalesTrametestrogiiSquaw Creek ParkLinn11/24/18Dead hardwoodSarah Duhonneeds voucher
https://www.inaturalist.org/observations/18607480
Or Coriolopsis gallica? Not sure how to tell apart effectively. Dried but not sampled.
86
PolyporalesPostiacaesia
Matsell Bridge Natural Area
Linn10/13/18Dead hardwoodSarah Duhon70702
https://www.inaturalist.org/observations/17513005
P. caesia not supposed to occur on hardwood but I've found it on hardwood several times. From MycoBank public comments: "there are some disturbing intermediate specimens on hardwoods."
87
PezizalesGyromitabrunneaWickiup Hill Natural AreaLinn4/29/2019SoilRoger HeidtRoger HeidtNo04999
https://www.inaturalist.org/observations/24178820
88
PolyporalesPolyporussquamosusWickiup Hill Natural AreaLinn4/29/2019Dead hardwoodRoger HeidtRoger HeidtNo70751
https://www.inaturalist.org/observations/24179628
89
PezizalesSarcoscyphaaustriacaWickiup Hill Natural AreaLinn5//2019Dead hardwoodRoger HeidtRoger HeidtYes05000
https://www.inaturalist.org/observations/24638433
90
PezizalesUrnulacraterium
Wickiup Hill Outdoor Learning Area
Linn5/9/2019
Downed log with soil contact
Roger HeidtRoger HeidtNo70753
https://www.inaturalist.org/observations/24842922
91
PezizalesVerpaconicaDiscovery ParkMuscatine5/4/19leaf litter and soilDave LaytonDave LaytonYes59729
https://www.inaturalist.org/observations/24490372
92
PezizalesMorchellapunctipesCamancheClinton5/3/19leaf litter and soilDave LaytonDave LaytonNo59730
https://www.inaturalist.org/observations/24450628
93
AgaricalesAgrocybepraecoxWide River WineryClinton5/16/19mulchDave LaytonDave LaytonNo59731
https://www.inaturalist.org/observations/25259905
94
AgaricalesAgaricusbitorquis7th Ave. & 5thSt.Clinton5/20/19hard packed soilDave LaytonDave LaytonNo59732
https://www.inaturalist.org/observations/25462438
95
PolyporalesPorodisculuspendulusRock Island PreserveLinndead red oak saplingSarah DuhonNoneeds voucher
https://www.inaturalist.org/observations/25623936
96
RussulalesArtomycespyxidatusBackbone State ParkDelaware5/26/2019Dead WoodRoger HeidtRoger HeidtNo70754
https://www.inaturalist.org/observations/25850074
97
AgaricalesPluteuscervinusRobins, IALinn5/27/2019
Buried root of dead Silver Maple
Roger HeidtRoger HeidtNo70755
https://www.inaturalist.org/observations/25962797
98
MycorrhaphiumadustumFaulkes Heritage WoodsLinn6/29/19Rotted woodSarah Duhonnoneeds voucher
https://www.inaturalist.org/observations/27897300
99
PezizalesGaliellarufaSwiss Valley ParkDubuque6/29/2019Downed StickRoger HeidtRoger HeidtYes70756
https://www.inaturalist.org/observations/27905823
100
TremellalesTremellamesentericaSwiss Valley PArkDubuque6/29/2019Dead WoodRoger HeidtRoger HeidtYes70757
https://www.inaturalist.org/observations/27905779
Loading...