Culliton Fungarium.xlsx

	A	B	C	D	E	F	G	H
1	Proposed Name	Fungarium #	Box #	iNat #	MO #	Notes	Status	DNA Barcode ITS

2	Marasmius rotula	0001	1	62674504	435270
3	Trichaptum biforme	0002	1	63328413
4	Xylaria polymorpha	0003	1	63328621
5	Cortinarius iodes	0004	1	Pictures unavailable	Pictures unavailable
6	Plicaturopsis crispa	0005	1	63422571	503655
7	Chlorencoelia	0006	1	63422566	503599
8	Dacryopinax spathularia	0007	1	63128767	503656
9	Chlorociboria	0008	1	63422570	503598	Good sized cups
10	Resupinatus applicatus	0009	1	63422565	503657
11	Cortinarius marylandensis	0010	1	96954481	503596		OUT - Gene Sequencing
12	Morchella	0011	1	116268690
13	Gyromitra korfii	0012	1	116191573	491769
14	Trametes hirsuta	0013	1	116287147	491768	Feat. gravitropism
15	Mitrula	0014	1	117160460	491767		OUT - Gene Sequencing
16	Cudoniella clavus	0015	1	117231086	491766
17	Gymnopilus luteus	0016	1	Pictures unavailable	Pictures unavailable	Some contamination (mold)
18	Lachnum virgineum	0017	1	118051076	503594
19	Xylaria liquidambar	0018	1	126733888	503592
20	Unknown Omphalinaceae	0019	1	127567130	503591	Growing on acorn cap	OUT - Gene Sequencing
21	Cordyceps militaris	0020	1	131075138	503590	Would be interesting to get the pupa IDed as well
22	Akanthomyces tuberculatus complex	0021	1	135420498	503589	Would be interesting to get the moth IDed as well
23	Coccomyces	0022	1	136748928	503868	Growing on oak leaf along a vein	OUT - Gene Sequencing
24	Cortinarius caryae	0023	1	136619862	503952		OUT - Specimen Destroyed
25	Ampulloclitocybe clavipes	0024	1	136863285	504416
26	Laccaria ochropurpurea	0025	1	136619858	504182
27	Gymnopus	0026	1	136619857	504183
28	Cortinarius caryae	0027	1	137064972	504190	From same patch as specimen #0023	OUT - Gene Sequencing	CCAAGTCAATGGACTGTTAGAAGCTGAAACCTGCTTCACGTCAATAGTGTAGATAATTATCACACCAATAAACGTTTGGCAAAATGTCGTCTGCTAATACATTTAAGGAGAGCTGACCTCAAAAATGGCCAGCAAACCCACATCCAACCAAAAAGGTTGATATATTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATCAATTTATAGGCATAAAAGCCTATTAATTACATTCTTTAAACATACATTAGGGTATTTGAAGAAACATAGACCTGGAAATGTAAGAAGAGACATAAAGTCAATCCCCAATCCTGAATGCTAAAAGCAATCAGAGAGATACCCAAGGTCTACAAAAGGTTCACAGGTGGAAATACAAAAAATTGACAAGTGTGCACATGCTCCCTCAAGAACCAGCAGCAACTCATCAAGTTTATTTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGAC
29	Lachnum	0028	1	137091437	504189
30	Lactarius	0029	1	137091441	504187
31	Pholiota sect. Adiposae	0030	1	137091443	504186
32	Jafnea	0031	1	137091444	504185
33	Scutellinia	0032	1	137424667	504602
34	Unknown Helotiales	0033	1	137216907	504601	Some mold or algae contamination
35	Thuemenella cubispora	0034	1	137299093	504430
36	Agaricus	0035	1	137312900	504600
37	Coprinellus sect. Micacei	0036	1	137312917	504599
38	Laccaria laccata	0037	1	137475843	504911
39	Strobilurus conigenoides	0038	1	137475844	504910
40	Amanita muscaria var. guessowii	0039	1	137475845	504908	Found under quaking aspen
41	Gymnopilus sapineus	0040	1	138151134	505784
42	Multiclavula mucida	0041	1	138715577	506048
43	Hypsizygus tessulatus	0042	1	138715578	506057
44		0043	1
45		0044	1
46		0045	1
47		0046	1
48		0047	1
49		0048	1
50		0049	1
51		0050	1
52		0051	2
53		0052	2
54		0053	2
55		0054	2
56		0055	2
57		0056	2
58		0057	2
59		0058	2
60		0059	2
61		0060	2
62		0061	2
63		0062	2
64		0063	2
65		0064	2
66		0065	2
67		0066	2
68		0067	2
69		0068	2
70		0069	2
71		0070	2
72		0071	2
73		0072	2
74		0073	2
75		0074	2
76		0075	2
77		0076	2
78		0077	2
79		0078	2
80		0079	2
81		0080	2
82		0081	2
83		0082	2
84		0083	2
85		0084	2
86		0085	2
87		0086	2
88		0087	2
89		0088	2
90		0089	2
91		0090	2
92		0091	2
93		0092	2
94		0093	2
95		0094	2
96		0095	2
97		0096	2
98		0097	2
99		0098	2
100		0099	2