R90 SHAPE
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCUCV
1
AnnotationDesign_NameProject_Name
Sequence_ID
SequenceStructure
Signal_to_Noise
SNrating
Score
Score_Min
Score_Max
Score_Thresh
X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15X16X17X18X19X20X21X22X23X24X25X26X27X28X29X30X31X32X33X34X35X36X37X38X39X40X41X42X43X44X45X46X47X48X49X50X51X52X53X54X55X56X57X58X59X60X61X62X63X64X65X66X67X68X69X70X71X72X73X74X75X76X77X78X79X80X81X82X83X84X85X86X87X88
2
1BES gap 0 sub 3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5003895
GGAAAUAAAGAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAGGUGCUUCGGCACCUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.901weak81.801.3440.67201.996100.59610.486400.48241.86721.36731.33572.1437000.42560000.03991.44180.611400.4047001.18921.54330000.38331.12741.46510.3640.361700000000.35940.53420.840100.34650.34450.68083.51670.943400.62220001.06870.75340.29980.29830.296700.58740-0.377500.43721.00251.39761.8926-0.20960.26660.52841.29150.25712.4622.69913.21410.43990.92010.63810.83840.82640.81480.63291.46333.39740.17730.5373
3
2
Marvelous Barcode - Jieux - Eterna History Tour - Introduction to Lab - Bends and Ends Sampler
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5003592
GGUAAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCAGUACUUCGGUACUGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.671weak76.801.4070.7040-0.57570.76511.49070.73580.36562.45071.36731.33570.66021.291000000.63840.63141.23580001.7961003.90770.5529000.54771.597601.55471.0182000000001.4880000.975303.65450.45320.44970.4462000.44280.87230-0.1371000000.85300.42341.64531.5998-0.1673-1.10731.74051.1222-0.33780.41291.17982.88193.32010.89150.8780.07863.02051.61981.54931.00371.4073.93390.21770.4322
4
3Fiskers D2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5064838
GGAAUAAAAUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGAUAGCUUCGGCUAUCGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.347
medium
77.80.121.3250.7221.211.83640.28121.90330.75330.96970.02650.51713.06050.60570.71780.23830.47270.2354000-0.15580.69760.461400.229800.22891.12211.10070.21930000.97030.53411.04880.2090000.4150.615900.204601.00510.399200.04350.59070.7771.51341.36930000.36410.18150.53930.17920.35620.17760.52780.52300.17380.85620.17070.17021.49260.81750.34-0.45640.32150.80121.23470.46092.4721.88452.07640.66670.87840.75191.1591.07447.00E-041.57891.47782.3580.75140.4262
5
4LEL0-BESr-Fswgs0 Omei 1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5011477
GGAAAGAAAGAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGAUGACUUCGGUCAUCGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.456
medium
88.90.0941.0390.5671.2731.44690.58970.74841.63781.05680.69910.6440.36290.60050.446900.148600.14820000.29490.87130.28900.144102.87621.46830.133200.26510.3950.58650.96120.88340.251300000.125400.373700.24810.123800.2465-0.121701.20671.182100000.35250.69640.346100.22980.11470-0.12140.11450.34140.22670.22581.43130.70460.32170.17220.10610.510.4166-0.03221.14530.7671.18190.45230.46920.09370.53330.5684-0.06911.01651.3022.53720.32940.4088
6
5Along
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5035186
GGAUAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAAAAUUUUCGAAUUUUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.903weak66.701.5790.79002.34354.87611.26361.16191.1391.479800.73061.4251000000000000.70390.69541.35821.967900001.28283.03851.19041.7321000.571700001.12120.555200.54990.763700.79831.80461.99130.4936000000.4894-0.31390.485300000002.32881.926501.94941.3551.50581.82831.93383.20051.69923.80941.54490.91231.19131.73341.1331.9173.05443.16981.45570.11010.1684
7
6AU closing barcode reversed gap 0 (Bend and Ends Sampler)
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5003198
GGAAAUAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCACGUGCGUUCGCGCACGUAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.958weak85.901.310.655-0.13850.73991.48430.49062.3531.82312.19241.28621.05230.20971.2314000.4076000-0.27440.40471.18920000.78211.14982.211600000.72790.36172.09160.346500000000.34450.34240.676800.336400.3921.61640.63940.317900000.6290000001.23110.03430.034-0.11740.74950.59350.58740.58150.289300.57290.29924.20791.00481.71360.46920.46120.45341.05190.26110.42440.19521.5341.60570.21040
8
7Animal 2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4998626
GGAAAGAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCAGUGCUUCGGCACUGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.608weak67.701.5750.78701.1401.118-0.61371.0968001.07641.05671.0377001.019400001.9694000002.810600000000000000.92190000.9075000.89340.879803.31751.6125000000.79512.29090-0.60720000000.75371.46911.43271.3981-0.302-0.892100.69072.09332.49462.38172.27381.65652.127401.55270.44572.8982.62862.61411.27820.42290
9
8Meechl LEL0 BESr Gap0
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4995395
GGAAAUAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUUAGUCUUCGGACUAACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.515
medium
81.80.1862.0491.1175.520.41041.06860.52944.40191.29730.47312.27251.62922.92833.534800.3901000001.88690.37490.3725-0.13300.73562.79982.670500.33190.65630.32630.82980.94680.31391.228800.3056-0.09150.60160.29930.29770.03370.87511.97230.97460.27510.27380.27250.93913.9842.710900000.46971.15080.90620.81140.22050.21970.52270.21640.42960.63720.58070.62131.61063.05121.66680.58150.18110.361.66131.02024.77733.89123.13641.44161.15861.92042.8842.412.21541.17352.02463.08231.05030.1591
10
9Mat - Frozen shape - D1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5067346
GGUAAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAGUUGCUUCGGCAACUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.586weak75.800.9190.460.87271.28010.42362.0430.805800.79470.7840.77350.38420.75830.748400.3718000000.73420.36480.36250-0.25731.33441.36440.339100.6704-0.17011.3030.961-0.18050.630200.31340.15630.15580.310.30840.30670.60700.301900.3004001.1770.2928000001.42760.28410.28270000.5600.8280.27470.40910.67390.077400-0.09220.94940.99910.02082.81.59031.0810.43890.65091.06480.5584-0.7488-0.07361.19010.78271.3380.75460.188
11
10try again: GUGCGUC|GGCGCGC
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4995285
GGAAAAGAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUGCGUCUUCGGGCGCGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.098
medium
87.90.1341.4690.8010.411.59431.27561.2480.70450.44891.8510.49950.98190.72721.10510.38910.1566000.15610.155701.06992.06340.2933-0.01710.14590.14552.68962.77030.262600.1310.39040.83371.68120.85881.08350.03870.11990.03830.39340.58730.4660.74750.28611.77470.65790.32710.43290.1080.4543.32831.37840.39120.291900.29040.2890.76040.37770.56110.18640.27830.1849000.73040.36290.62820.62821.38430.51850.08550.43441.4821.20760.63522.0572.60661.80961.29353.30120.63770.84450.68770.60811.2521.88061.62390.90310.3789
12
11KC02
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5030561
GGAAGGAUUACCGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUCGUGCUUCGGCAUGGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.036
medium
83.80.0840.9290.5070.55080.20720.6332-0.03230.24850.69571.00530.40660.65160.5590.15540.309200.077200.07710.0385-0.02590.38240.54120.22620.22530.0750.01071.50941.9345-0.0640.07030.07020.29030.82410.67871.13120.39650.13380000.06580.09850.0983-0.0310.29340.26050.25810.32090.12810.0641.73721.27420.0606-0.0318-0.031800.29430.59550.17810.3540.11780.05880.0588-0.00930.26270.14560.17420.42610.85661.30740.21970.26820.25270.58680.36850.57042.5332.07351.90460.80110.54510.38451.11450.0430.4781.00861.19361.12330.43620.0986
13
12Rockys Nucleotide Abomination
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5032886
GGACUAUGACUAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUAUCGCUUCGGCGGUACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
3.225
medium
85.90.0740.8160.4450.5680.3850.19660.02790.52410.73160.10690.41440.24630.28020.31350.17360.24210.03460.0690.10340.05160.1320.47670.43930.23560.23460.27760.26551.04591.13340.09560.02060.14610.60480.95620.71590.78130.30630.12660.1190.05940.04450.42730.35820.1460.27470.60350.31440.05710.37460.01420.21761.75630.99910.10730.13380.05350.02670.16420.68460.31420.21240.08150.18120.21320.10630.15380.62140.19260.210.72031.47640.29250.18510.19540.31050.46890.52661.81882.07281.24710.7870.28930.3840.87210.55880.67260.60581.15351.0240.38030.1448
14
13lel0besrfsgs0-2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5039778
GGAAAACGAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGGUCCUCUUCGGAGGACCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.51weak64.601.1150.5570.8336-0.61371.22391.19861.5551001.514400.74740.737900000000.12130.719500.7107000.10111.370800.6774000.66950.6619-0.59470000000001.29411.26580000.6263.52710.58190000.57610000000-1.16550.57040001.66221.03880.53361.5577-0.57120.3405-0.0526-0.14962.32483.49482.76621.98891.16920.99340.3771.46980.72572.9281.1812.26930.64120.3188
15
14Fiskers D1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5064827
GGAAUAAAAUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCUUUGGUUCGCCAAAGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.344
medium
83.80.1141.2560.6851.19380.99370.89621.85881.44971.23811.38050.22920.45470.32392.37060000000.63940.63240.62550.2078000.61674.01671.85150.184600.36680.18280.45341.15540.52840.523600000.347000.34490.68170.67370.3349000.25011.69921.42070-0.22240-0.17250.61961.21320.60030.12660.83780.429100.14270.28390.14160.14130.11320.66391.318-0.19750.3030-0.03171.04110.24752.83812.66171.77390.9740.53610.53120.83760.35321.13681.46691.27482.20180.74770.3375
16
15Fiskers D3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5065279
GGAAUAAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGUCAGGUUCGCCUGACGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.547
medium
82.80.1451.5940.8690.38420.19070.31391.82371.06611.45110.14472.23590.69711.3370.79130.52270.26020.2590000.1341.01341.23960.4916000.72811.42051.8340.2283001.43180.76741.49511.15130.62120.206300.40980.40690.20270.60180.59560.19791.22940.7628000.03360.35243.36772.54180.1690.16850.1680.33401.06190.96310.16010.78940000.15750.31320.77260.91241.04532.03460.28610.34350.6981.49581.08760.95532.76972.52412.34421.31610.16190.6411.0491.4450.92341.09451.3472.0870.84220.3525
17
16idk
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4994828
GGAACGCAAACGGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGGGCCCGUUCGCGGGCCCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.676weak68.700.930.4650.49190.71040.932000.462300.458600.455000.67450.6668000000.441100000.43780.43450.43120000000000000000000000.42800000-0.35130000000000000.4249000000.42180.83151.41942.52110.385300.76040.37770.02610.37280.37050.73150.363500
18
17JR_BendsEnds_Sub3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4995172
GGAUAUGAGCGAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGACUGACUUCGGUCAGUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.191
medium
88.90.0840.9230.504-0.2350.34050.20620.2181.17350.15340.53190.45240.30.24160.59080.14730.18360.1465-0.04850.04470.0730.0890.50540.64250.0713-0.056600.38951.8511.890.198300.0660.32820.6490.95740.39310.50180.12520.062500.24900.06220.21680.06191.06610.7191-0.04930.44510.1480.08862.29831.65380.10870.16440.0548-0.05620.10930.38010.59120.10470.05350.21340.31830.15870.49830.4940.15560.4071.45440.93750.02220.47960.27540.38420.31790.39172.65512.33211.04610.69740.27740.31660.7340.50010.45990.36191.43761.55880.40990.0744
19
18try again: GCUUCUG|CAGGAGC
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4995362
GGAAAAGAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCUUCUGUUCGCAGGAGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.587
medium
85.90.1121.2350.6740.80241.24240.29461.40420.59560.1979000.3930.58360.46140.5720000.56640.18820.55910.37041.79440.35670-0.11610.35452.70333.04130.159600.15920.31660.93450.61641.05891.0399-0.11590.148200.29480.293300.1463-0.11560.93560.49940.14230.28330.07070.37551.52041.97470.13130.261500.130500.96210.19180.254600.50470.37610.12510.00990.14310.49190.48771.88720.23740.23350.69190.22950.45420.56220.87152.92033.04472.97720.46020.03221.34011.17340.21531.22591.03621.09262.05670.60770.4522
20
19try again: GCCUAUC|GAUAGGC
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4995383
GGAAAAGAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCCAUACUUCGGUAUGGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.984weak81.80.1511.6570.9041.140.23411.10730.54840.543200.737901.55661.51580.50090.984700000-0.64962.36130.6063000.23140.23052.31832.40531.02931.2094001.94771.88421.46910.72530.3604000.71190.3538-0.31770.35160.34952.34730.6630.97760.644500.63741.8512.928700-0.3159-0.64110.86121.94190.82040.54180.53680.267200.52940.39440.90581.26561.95651.89251.38531.35290.10480.8118-0.16852.23921.76153.83742.28183.78661.05230.18221.06961.34320.45331.15481.12131.89842.55751.13770.1261
21
20B & E 1-1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4997799
GGAAUAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGAUAUCUUCGGAUAUCGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.182
medium
78.80.1191.3080.7131.34621.95120.32341.87730.61910.91391.48412.00570.56740.83881.89310.26920.533400000.52850.39370.64880.2584-0.22600.76481.73122.822900-0.10780.5810.23150.45931.12580.44690000-0.224300.22260.44171.08360.6431.05210.62440.20741.01872.90281.71680.3616-0.036500.35830.35610.70341.03630.85080.16970.67080.49880.16580.16530.81490.26890.16121.50490.76151.18670.24990.4350.92730.8380.40723.19261.96232.25462.02970.46990.76981.05250.86681.31810.52562.66621.59920.61820.1761
22
21B & E 1 - 2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4998218
GGAAAUAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCAUCUGCUUCGGCAGAUGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.944weak76.80.1221.3440.7330.91560.63680.44720.88080.867601.27271.8481.00880.7959000.3952000000.77981.51871.1170.370.36760.7261.75972.42140000.33370.9840.32610.96210.31890-0.262200.31720.31550.93110.614201.20280.59520000.58911.15471.40830000-0.472300.2776-0.46220.273700.27241.07860.26490.274100.14130.77171.13480.00240.250.49281.39320.11053.0633.6283.18831.74781.72270.70241.4551.60180.74391.19572.13432.05831.7171.10590.4576
23
22Animal 3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4998659
GGAAGGAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCAGAGCUUCGGCUCUGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.605weak69.701.260.630.0975001.37950.6662-0.635301.30241.273700.629900000000.62311.2200001.77383.34250000002.1457000.531500000-0.628400.526600.521901.02533.37882.3167000.4597000.904900.44900000000.44552.55491.65450.41070.1882-0.2129-0.20920.39661.16580.114.18523.28930.65051.58170.9337-0.2745-0.8371.49961.17531.43271.93860.27560.546
24
23First try
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4999019
GGAAAACAAACAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGGUCGUCUUCGGAUGAUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.913
medium
78.80.1231.350.7360.37952.9582.32681.39731.53030.83791.20432.58160.84791.20760.93190.14790.1475000.18790.14640.04060.50651.06540.4230.07040.350.48581.83991.81890.51510.151400.63390.50271.35031.31940.119700.238400.23740.23650.1180.2350.02490.75090.86110.22630.225400.12032.72311.90660.3057-0.001300.1020.20320.80160.14990.149500.390900.1970.09830.1960.09220.56541.50180.75340.90060.12070.80750.06130.83190.92952.92672.86432.48931.51991.59951.58461.31980.5961.15691.31051.50572.84961.05510.3518
25
24First try2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4999026
GGAAAACAAACAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUUCGUGUUCGCAUGAGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.615
medium
79.80.0581.0640.5610.04550.29550.72950.57780.99370.63180.34890.27780.55030.40980.13630.13590000000.4050.26870000.04891.76731.69580.744-0.1089-0.10870.13850.85150.60191.06350.235400.009200.12590.179-0.053900.28980.63060.22840.1140.113800.2831.75471.649600.1062000.42180.83150.20270.51230.3058-0.0165000.10120.3020.10050.30.83760.82560.28990.1710.28660.37960.37710.5962.41891.90392.5850.90970.72281.01611.43180.21131.05990.39550.97712.09171.07180.1246
26
25AU closing barcode gap 0 (Bend and Ends Sampler)
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5003193
GGAAAUAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCUCGUGCGUUCGCGCACGAAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.337weak60.602.1951.0985.01560003.51936.2748002.97592.83035.15580000000000002.46794.54762.18782.1080001.03514.75050001.83970000-2.00351.7830000001.7297000000001.67940000005.3960001.43021.395702.66281.30151.27283.58194.41153.12963.89191.77284.22511.642-1.0054-1.75970.6234.31365.81932.47560.6124
27
26
Stupendous Barcode - Jieux - Eterna History Tour - Introduction to Lab - Bends and Ends Sampler
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5003594
GGUAAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCUCUACUUCGGUAGAGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.937weak83.80.0641.3040.6840.43971.28960.42672.1530.80580.40010.78930.09491.34011.67321.450.716000000.355800.70300.3494001.69560.999700001.3032.19370.32450.61350.3051000.15220.452900.300401.7477-0.00420.2884000.28692.73381.85240.263400.26220.2610.77261.25970.49950.49520.73340000.24350001.01622.39490.6763-1.7531-0.1140.16381.10041.45853.43211.51912.95540.95780.779-0.02151.74710.0640.71021.35022.50740.83850.58480.4353
28
27BES gap 0 sub 2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5003891
GGAAAUAAAGAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAGCACCUUCGGGUGCUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.49weak65.700.9940.497-2.23540.68190.6741.317201.910600000.629900000000000001.2331.2072000-0.60860.59741.17060000001.147300.56800.5625000.5571001.09310000000.541400000000.5364000.53150.5266001.0345-0.6795-0.6599-0.07452.41340.94950.3617-0.20330.90491.32630.8709-0.12380.85160.83930.82732.379700.3939
29
28BendAndEndsGap0 1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5006037
GGAAUAAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUAUAUCUUCGGAUAUACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.211
medium
81.80.1551.7080.9311.69370.57692.21922.13711.61383.18461.40771.37433.03821.68553.37280.197700.392800.39010.38750.19312.04882.3240.178200.704202.6862.34650.6346000.47210.46831.81430.5985000.2977000.58940.293201.14940.56910.56350000.28042.4181.56830000.260201.02240.25450.10040.4980.49370.245800.72820.24170.47940.47552.06330.91140.22310.44630.65412.08821.0034-0.85155.53342.44041.80921.53381.23291.59432.1564-0.17280.80422.69212.61523.37870.6212-0.1744
30
29BendsAndEndsGap0 3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5006050
GGAACUAACUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAUUAUCUUCGGAUAAUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.474
medium
83.80.1161.2740.6951.75070.11430.57770.5720.75271.03770.81750.38030.88610.70030.86230.51280.1704000.338900.16890.33590.99050.16460-0.15330.64921.72582.40750.2994000.44560.56910.98320.28530.42490.28190.14060.14030.20960.06980.68960.13760.11730.67661.06270.13250.65520.3905-0.1291.98841.88410.35750.47270.23540.4670.42420.91010.56330.88740.2210.65550.33420.33050.53220.73560.47120.86911.87711.32960.41950.07760.31870.7470.3971-0.22542.81923.16192.37361.11020.3790.43950.71191.55111.56651.10462.03041.89281.05850.0587
31
30just a lab
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5012991
GGAAAGAAAGAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAUAUAUUUCGAUAUGUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.171
medium
76.80.11.9261.013-0.04991.9060.628400.99550.60860.60231.51831.42411.38981.09091.07070.53040001.5487000.5117000.27440.50282.40912.75330000.22851.12051.92560.42830.4251000.4220.831900.413000.81440.80310.5611000.39331.6721.48260.368300001.43650.35691.04920.344200.68020.67230.76480.653301.3632.72463.3221.37021.41591.57940.1450.89040.59095.74952.78482.35441.55171.44110.97341.76462.48231.66343.04171.88183.73750.5295-0.5252
32
31Finally fixed!
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5015332
GGAAGAGAGAGAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCGCGGCUUCGGCCGCGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.329weak64.600.9580.4790.38511.132600000.7453000.7358000000.726600000.71760000000000.70880.70020.3480.34590000000.34390.34180000000000000000.67570000000000000000.667900.66020.652800000000.645500.63840
33
32B&E sampler - Frozen size 0
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5026692
GGAAAUAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGGCCGGUUCGCCGGCCGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.385weak60.601.6920.8462.2362.15272.07552.00351.34674.399201.70771.65870000001.6125000000001.56872.97600001.45070000001.4152000000002.6982000000000001.318400002.521702.4164002.3194-0.33481.1151.09391.07361.0543.92961.90024.38991.70420.220302.3809-0.61751.5245-0.61500.7427-0.60250
34
33Rockys Nucleotide Abomination
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5032904
GGACUAUGACUAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUAUGGCUUCGGCCGUACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.712
medium
84.80.0650.7140.390.35430.09740.25180.12560.41570.73490.12280.34380.22080.17960.29890.20.15950.07970-0.022100.03750.31410.58730.11720.15590.32930.13240.36480.6830.037900.0190.41060.83430.85850.82820.22890.32090.14230.0710.230.41680.20990.34770.22030.65050.27260.1020.30450.03380.20311.70850.93170.10620.0200.0320.34990.73140.54420.10860.2340.21540.03950.14660.19860.67220.22550.1130.57920.75320.09480.15980.11610.15870.09360.22170.72340.77550.56530.41770.25160.29350.47930.81490.97670.76020.92211.11820.27340.1988
35
34Rockys Nucleotide Abomination
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5032908
GGACUAUGACUAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUUGCGCUUCGGCGUAACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.519
medium
82.80.0740.810.4420.36510.07970.27070.0790.26440.52720.15920.62970.31310.07520.27550.1260.15450.051400.05140.05140.02570.2520.60660.08650.08630.40020.19530.95561.34030.07170.02390.04780.36890.6560.80250.42940.63450.3920.15050.04480.24530.46460.27930.29940.34080.5310.39870.1630.359800.15351.53091.44060.060.139600.03990.11930.66830.31280.24370.07770.11630.08750.07730.30760.24880.28570.38740.75480.7960.34420.18950.33270.32330.5690.43671.86441.96381.25940.75270.59220.45870.95160.53660.33630.47880.96290.74830.2010.1712
36
35rtp101
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5035810
GGAAAUAAAUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCACAUAUAUUCGUAUAUGUAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.698weak73.702.0611.030.74512.87031.400401.36733.830201.24914.59921.12741.10581.0851000001.06511.29941.9840000.97535.31383.33810000.82261.59981.55671.51591.47720.7293000.36230.3601000.71131.3885000004.4830.63340-0.7453-1.4532-0.717601.239700.5049-0.7831001.74713.0350.8163.36390.99453.28313.10671.30151.81522.47291.60310.37482.50964.80293.10894.8251.06442.09843.08311.93790.54851.87811.54953.2937-0.75691.20530.4326
37
36rtp101
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5035812
GGAAAUAAAUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCACAAAUAUUCGUAUUUGUAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.044
medium
74.70.1261.3820.7540.41471.1180.73580.48580.47780.47-0.06110.5252-0.47170.9651.50270.3320.97920000-0.23391.276700.08440.62800.31231.52041.1913000.296301.30321.55020.60130.27650000.275100.27380.810.26871.56871.27840.25460.253400.50252.17660.4776000.4737-0.4312-0.22570.92091.1287-0.44790.4480.22310000.222300.22141.92632.03920.78811.07690.47270.56661.07770.8032.82132.05242.64540.93430.24041.4452.0221.33831.43531.61641.58960.86990.69790.2317
38
37Basic
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5038217
GGUCCAUAUAUAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGUUAGAUUCGUUUGAUGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.562
medium
80.80.1161.280.6980.35560.9710.113700.01880.92640.6061.57330.19551.43010.65880.18760.18700000.27770.36920.9930.351400.178901.73522.0098-0.18630.16700.40370.49251.7510.47360.624700-0.09280.31070.154900.3082-0.09270.66780.45260.15050.29940-0.18452.43771.26240.27920.13930.138900.13860.41280.40990.2720.44670.134400.3490.6582-0.183-0.02210.13020.87750.66540.14121.51470.74220.23640.70050.13852.02811.43051.90191.73790.14190.53480.64251.43951.04090.74651.68192.34130.9058-0.0015
39
38lel0besrfsgs0
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5039776
GGAAAACGAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCUCCUCUUCGGAGGAGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.949weak80.800.930.4650.12881.2921.26380.6251.90710.299600.6848001.43820.85030.28200000.55860.55330.27530-0.199500.2742.36532.27230000.50060.24921.45760.71970.23890000-0.19880000.079100.2360.46820.23310.23221.5810.669700.2224000.22150.43970.2190.64970.21570.214900.230.42360.4205-0.19610.01410.8260.814400.2096-0.18550.0079-0.08770.88962.26012.29713.15411.2871.12430.79210.74850.92021.0541.181.25231.35460.8280.2747
40
39BES-L0-GS0-V1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5059943
GGAAAAUAAUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCUCAGCUUCGGCUGAGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.498weak64.601.2180.609004.30550.56680000.9188000.90441.75390000000.863900.85120000.83883.171200000.78210.77161.50320.7419000000.7325001.428900.70570.6972002.66050.6576000000.650201.88690.62220001.808200.5965-0.82180.59041.15720001.13451.65311.3132.69234.16550.12291.07541.27611.65290.41032.33630.7550.73690.70860.70981.04540.3464
41
40BES-L0-GS0-V2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5059946
GGAACAAACAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCUCACCUUCGGGUGAGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.773weak75.801.1080.5541.90841.07030.53030.52541.03211.62330.49400.97141.42131.387200000.4587001.34420.882500001.71272.84950000.23680.98981.91410000000.38030001.4822000001.09070.3613-0.006100000.3568000.35460.70070.34820.34620.68411.008300.33410.98542.211300.262200.92251.2044-0.0613.3843.19692.67110.50050.38511.20951.6950.69490.66710.65951.36331.657800.2065
42
41BES-L0-GS0-V3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5059948
GGAAGAAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCUGAGCUUCGGCUCAGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.977weak79.801.0020.5010.36330.60721.479200.62481.97010.30930.3050.27480.81271.06370.26470.2635000.262300.261101.02590.1280.3813-0.1233-0.12311.24380.9782000.243500.24250.4810.2395000.2385-0.24510.23750000.23650.4693000.46550-0.01221.57831.10580-0.243000.22030.86810.43080.214600000.21380000.2131.045800.4153-0.4819-0.240.71780.63041.75551.88691.11041.08950.53970.17931.0980.960800.5080.76442.08550.63460.3156
43
42Level 1.3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5060219
GGAAAGAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUACUACUUCGGUAGUACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.284
medium
81.80.1281.4130.7710.03611.13261.65041.94920.70020.69180.34391.16950.33391.91861.41290.9269000000.30730.90750.893400.2963002.91233.99210.2591000.34171.9841.68540.94730.11820.11790000.23490.46600.23210.3460.796300.226600.11311.86061.321300000.21250.21170.21090.210100.2094000.10450.3470.41130.10241.98611.89490.3765-0.43651.63060.45880.87341.3483.47083.87522.82040.94540.53520.60691.44151.54341.44381.97851.85851.42480.57670.161
44
43Mat - Frozen shape - D2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5067348
GGUAAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAGAAGCUUCGGCUUCUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.61weak61.601.0680.5341.25981.4717-0.24930.33450.576900.57120.56560.56020.55480.596500000000000001.58821.0398000001.02140.50620000.501800000.497500000.4933000.970001.419300000000.46920.92350.9090000.89490.4440.8140-0.57280.84280.41831.32021.91181.03293.16891.70852.61020.64531.11580.78311.47231.99171.92540.63990.2687
45
44Mat - Frozen shape - D3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5067350
GGUAAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUGUAGCUUCGGCUACACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.489weak66.701.2860.6431.33460.658601.28791.86941.22-0.27050.32140.58530.29890.56800000001.65531.60930001.56570.51721.01630.5037000.1540.49090.48670.4827000000000.478700.9418000.46710.46333.07120.435401.2774000.42271.240900.815601.1980.78780.77720.3861.50390.74231.09242.10530.87850.3386-5.25171.50510.31631.4759-0.77053.16920.41332.88230.99360.49261.32350.1815-0.17090.69731.80142.58151.03690.79880.6049
46
45Viers LEL 0 - BESr - Fswgs 0
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4994307
GGAAAAGAAGAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUUUAAUUUCGAUUAAACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.93weak73.70.1571.7240.942.94341.4352-0.35561.04691.3673-0.02270.66790.660200.652801.89420000.624601.22272.90342.2330.55291.6125-0.34710.53253.02792.87730000.47561.39241.35970000.4497000.44621.52081.06620.42340.42030.41730.125400.38150.7531.64611.944200.3513000.349200.347100.3451000.6820.3390.3370.66630.98411.58350.60970.30830.8473-0.30661.16480.86060.56814.5124.25394.02540.91530.55450.63182.32450.87621.11570.71740.62063.62611.30830.8063
47
46JR_BendsEnds_Sub1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4995168
GGAAAGAAAGAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGACAUACUUCGGUAUGUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.677
medium
86.90.0850.9310.5080.06940.65720.59130.2690.19150.97341.66810.93010.53670.66410.68530.5741000.20800.1038-0.08270.41230.32680000.50730.80041.84040000.28910.66690.93730.38240.195200.092400.19360.091800.36480.27230.27110.44830.2677000.14011.00460.437400.004600.00460.08620.17190.34480.51160.08420.33480.08360.08540.16620.330400.00260.650.72080.3960.458100.30830.37270.36263.1492.25631.73220.72370.63610.43930.77591.28830.61621.14891.79251.12280.77030.1098
48
47JR_BendsEnds_Sub2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4995170
GGAAAUAAAUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGACUAACUUCGGUUAGUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.31
medium
82.80.1151.2610.6880.70651.19560.59170.58570.57980.57941.12031.0991.34191.0541.288100.2565000001.0081.23320.24560.24450.24350.34462.40161.8681-0.1374001.80150.50230.63210.41830.620800000.06970.20540-0.13611.00931.18630.3928000.19573.66610.9022000.17990.96140.38821.02810.20580.337800000.16690.16640.3309-0.26540.81570.96250.34490.8070.61930.15440.30720.85993.6373.28372.14090.93070.75281.51951.69580.53310.86760.65531.46681.32360.71580.3052
49
48B & E 1 -3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4997829
GGAAAUAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGUCUAGUUCGCUAGACGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.413
medium
87.90.1411.5560.8490.85241.17111.82680.16560.97682.39011.60273.65630.83161.15550.99570.97220.7690.255200-0.1961-0.13551.2431.68940.2403000.08982.28922.202100-0.19280.43710.64831.47411.63700000.203900.203200.01030.99490.97810.1971-0.190900.76692.21271.085600000.71480.70610.35090.521600.17330.17280.51390.17080.33960.33760.33562.56581.93-0.189-0.47180.30390.60140.84831.22974.30172.90483.44622.11040.30291.07761.59830.92321.03870.89611.97261.9980.540.3539
50
49Animal 1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4998525
GGAAAGAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCUAUGCUUCGGCAUAGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.622
medium
81.80.111.2090.6591.36162.02710.890.59160.44340.37571.77060.18581.09360.720.88620.526900.175100.174600.1740.51741.182700.16850.1680.20773.07872.27510000.57011.53231.83680.97240.03430.1383000000.27520.06620.9430.79710.13250.13220.13190.67731.88870.86810.247-0.206600.12320.1230.48770.48360.36050.23930.11940-0.10310.23780.70480.35030.7031.01790.7810.33280.33760.27390.17010.96510.64093.04521.68142.40841.09060.88120.60471.02380.85261.41390.83961.27571.32440.61660.4588
51
50First try1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
4999024
GGAAAACAAACAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGUCGUGUUCGCAUGAUGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.641
medium
83.80.1591.7480.9530.080.15691.58840.81370.310801.390.59910.8851.5941.54480.2766-0.12280.275300.41010.13640.41781.06090.525600.26160.26040.77092.22383.91600.22940.22850.55530.44820.54261.08680.85660.4251000.4220.2103000.20951.82591.57870.19670.96690.19270.47792.08441.43430.8480.57540.68830.05060.17112.14150.53080.99760.78780.46880.31090.1550.94490.89881.50390.71741.41.23320.27270.18340.26890.55871.69970.28944.59533.30273.39791.6060.84391.10511.37241.20231.34041.91912.21923.07970.66560.2935
52
51Level0BendsEnds-I
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5000179
GGAAUAAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGUUAGGUUCGCCUAACGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.63
medium
87.90.1261.3850.755-0.15722.0941.21570.74761.20451.59721.25010.61841.35972.66710.606600.09390.28020-0.145200.18620.66291.18650.179300-0.0553.13221.64490.3271000.64690.79752.30010.45470.7480000.29770.296100.29460.3660.93610.99080.14120.42050.070.20411.9361.50270000-0.1430.6460000.1289000.25670.50890.62920.25061.93751.3623-0.02460.29850.34660.45840.65040.38384.06853.01513.38780.76310.82320.52451.69670.92140.8951.31382.38912.15620.70990.2826
53
52Level0BendsEnds-II
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5000182
GGAAGAAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGUGAGGUUCGCCUCACGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.182
medium
87.90.0951.1110.6030.79280.97960.7520.57280.92740.60630.40990.24130.37660.99310.81590.48490.14510.080500.09630.1920.09590.75681.0222000.0928-0.06411.44732.09240.346600.04330.55740.42570.92151.08550.6495-0.1278000.08110.0810.08080.04040.36130.75280.354400.23530.07830.24782.06580.86020.22090.1469000.07340.43680.43350.144200.14380.07180.150900.49650.28890.50621.55870.7360.26640.59510.52460.45210.63870.44152.21692.38131.95810.43340.32080.10161.1040.88340.55130.51190.82041.87670.30020.2276
54
53Level0BendsEnds-III
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5000184
GGAAGAAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGGUGCGGUUCGCCGCACCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.335
medium
83.801.1370.569-0.09870.24281.07230.23731.27420.17420.67980.5610.38640.65921.07810.2148-0.168800-0.168300.2141.050700000.20942.02061.57250.1959000.19520.67530.47840.56840.1889000000.188200.18760.1870.20390.09280.0926001.44480.54620.17780000.353500.3586000.348200.51760.35020.17000.50550.335700.33190.32930.48980.3247-0.00261.86671.66870.89610.59130.14740.29340.58090.57510.80170.83371.62060.93010.91540.1305
55
54BE1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5000695
GGAAAUAAAUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGUAAUGUUCGCGUUGCGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.998weak73.701.5160.7583.47191.12393.91670.32460.95750.35621.23581.209901.759700.58070000000.57491.127400004.18332.01860000.9920.97530.95910.475600.19780.4679000001.370401.3387000.44280.65672.71221.22530-0.27260000.405600.40270000000.39990.24882.36671.823200.09480.09370.71132.058-0.52785.31581.57033.11611.11490.28711.32881.55181.96631.14451.79321.20372.81880.9961.2149
56
55sub1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5001852
GGAAAGAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAGUAGUUUCGACUACUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.863
medium
82.80.1331.4620.7970.49461.35150.0941.58321.16360.62180.43711.2210.51860.5861.3350.49630.329000.1640.16360.16310.48520.3840.160.22120.15860.62772.35662.71610.14260.04570.14190.8390.69081.38460.96120.65340.16420.12980.12950.2579000.12860.12841.25570.74370.12370.123400.27212.52171.20590.792900000.44960.55650.25070.32950.21880.01380.433500.43030.10740.63721.80061.45440.29930.50270.68560.85510.18880.83523.27453.15193.20741.28750.45090.8681.53610.27120.08590.82921.83611.68690.41580.225
57
56AU quad closing barcode reversed gap 0 (Bend and Ends Sampler)
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5003212
GGAAAUAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCAUGUGCGUUCGCGCACAUAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.895
medium
87.90.1361.4950.815-0.08761.89451.61151.12861.68232.7190.64571.00680.42441.17141.33510.56660.18820.18760.37290.830700.27390.72130.9750.78690.261100.6882.70533.09010.30830.30660.15290.45511.11581.09471.07430.637500.141300.28130.41880.27790.13860.12081.08420.73590.20.46290.1320.17653.34191.5655-0.08610.2398000.17931.68310.34610.57120.2276000.30630.33610.55480.13550.43881.07651.4688-0.04280.63130.103-0.03081.11991.01143.20381.58071.7540.94350.42570.58991.47810.7260.71020.80751.63551.06980.20370.0648
58
57
Glorious Barcode - Jieux - Eterna History Tour - Introduction to Lab - Bends and Ends Sampler
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5003587
GGUAAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCACUACUUCGGUAGUGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.065
medium
78.80.0981.0830.5910.88280.2691.22292.22120.5180.89241.36920.97891.54820.8218-0.21180.022800.232900001.80510.44780.6639000.87190.7531.36540.20930.415601.22050.90110.69241.72740.19130.568300.18880.18820.18760.55730.2773-0.0260.54760.45280.18050.358901.31511.78430.4624000000.3340.16650.1660.16560.238800.23440.32191.41310.31230.46470.61311.3473-0.1031-0.11990.87551.15750.4380.42882.4343.55621.48871.06490.4560.7050.5557-0.2720.8740.35031.69451.34890.80130.1
59
58BES gap 0 sub 1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5003886
GGAAAGAAAGAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGACCACUUUCGAGUGGUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.939weak87.90.1661.830.998-0.15923.11020.767200.757200.7474-0.35830.7379-0.35611.4390.71070000.702002.67810.66190.6544000.29313.6386.462800.533601.04792.02241.4780.96891.417700000000.23532.47761.32050.4369000.86073.83941.36410.769100-0.34960.3821.48870.36980.36750000.365100.362800.71670.70792.04850.33940.32340.9661.28240.94612.99043.47992.1822.56182.18330.48111.86262.77082.05010.37560.83142.48612.38370.54490.1811
60
59BendsAndEndsGap0 2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5006047
GGAAUUAAUUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAAUAUCUUCGGAUAUUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.928weak71.70.0431.180.6110.4599-0.2955000.34920.860.17150.34101.00510.039100000000.65860.651200.351400.63691.09343.38250000.58231.55831.247400.54920.27330000.2720000.93661.17960000.26091.23341.72540.24540.24440-0.28960.24340.48270.046400.23540.23450-0.28250.23350.91930.68140.61332.35940.56560.14120.27570.45650.52241.72560.96291.97534.4592.75851.861.47160.53461.79461.47271.85112.58781.34223.0891.29470.4133
61
60Right turn on red after stop.
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5008049
GGAUUAUUAUUAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGUAACGUUCGCGUUACGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.07
medium
87.90.1291.4230.7760.57940.790300.39251.15391.13131.10960.73041.49950.35191.70731.33440.33170.329800.3279000.48771.27200.158600.31541.83241.48770.296000.31670.29150.57731.4081.641600000.80930.53460.26161.04031.02191.2498-0.2668000.61822.25751.616900.2301000.22920.45470.45120.66890.61270.65130.2163000.42940.6370.15720.31441.53060.20340.47530.5934-0.26080.45542.16493.41862.81482.43560.73340.6130.20441.62541.18280.77510.77371.22691.49130.26630.2629
62
61Solution 1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5008346
GGAAAAUUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUGUAGGUUCGCUUAUACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.293
medium
70.70.0741.6190.8471.80050.39950.68680.29020.96222.04220.53151.07931.05951.04040.3447000.3427000001.339000.33280.98160.96521.565100-0.2010.46570.7660.90480.59690.2969000000.29540-0.20031.44030.57040.28381.113400.41451.21753.0741.253100.29730.2474-0.80210.94511.41750.90451.32560.43850.10940.10920.86070.42720.84190.62461.6191.18930.19750.97300.56921.1131.9152.81033.67921.84352.24851.07811.09690.4313-0.14571.19731.45832.23292.43861.54570.3771
63
62First attempt at lab
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5013682
GGAAUAAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUACAUGUUCGCAUGUACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.626
medium
90.90.1251.3710.7480.26991.42551.14871.53280.64231.19651.49340.54790.86351.05961.3960.50860.3056000.1017001.19490.8825-0.0546000.52792.45272.57310.0342000.61361.30021.16190.74380.88720-0.05380000.40060.23940.18470.93811.07410.07660.45610.30250.3223.74921.70130.1373-0.080100.04280.46860.86920.65140.39930.32140.25590.50740.25260.71721.07120.31190.66141.26891.84840.17010.17630.11920.28251.04491.10153.72032.52882.5410.84580.38541.12560.94391.06210.59931.02431.4821.66540.64140.3376
64
63Add more GC this time
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5014042
GGAAUAAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUGCGUGUUCGCACGCACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.877weak81.801.5320.7661.3968-0.40171.02891.98721.60990.63690.62990.62311.221.19481.738300.573700000.5680.56250.557100.551801.08293.07581.49810000.49510.97352.33551.80990.8910001.7287000.42900000004.36272.28560.378400-0.416400.71290.36640.364100.3619000000.71481.39511.30190.33660.22121.6081-0.06320.8-1.47372.09952.02591.68591.37160.17740.80390.5310.6791.76911.95361.4290.70580.69730
65
64no title
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5016026
GGUAUAUAUAUAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCUAUUAUUUCGAUAAUAGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.506weak78.801.1110.5560.657-0.61370001.284800.94780.6250.92262.35990.5840000002.24531.63630000.54042.9431.482500001.445500.94780.470100.4663000.9178000-0.14560.451700.448200.44482.14152.46040000.40720.404300.59330.39330.39070.38810.385500-1.15120.74610.37061.5758-0.30140.1421.32160.86750.1120.51642.07560.84752.72642.03781.72971.44551.41030.67090.80771.9274-0.3231.83692.02860.6080.3683
66
65no title
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5016031
GGUAUAUAUAUAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCUAUUAAUUCGUUAAUAGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.477weak69.701.3710.685-0.83360000.51231.9791.44710.9489000.93360.91880000000.9044000002.59162.480400001.607602.3149000000.761500.75160.74192.82290.697200.6889000.68083.2147000001.86661.218200.602700.89021.4465-0.24890.84670.83451.09171.07152.3920.5436-1.494800.19530.46280.51784.85461.62752.60152.4541-1.278301.98330.95241.25753.44291.16622.3881.42810.7577
67
66Default title
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5018398
GGGAGAGAAGGAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUGUCAGUUCGCUGACACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.766
medium
86.90.1031.130.616-0.05740.10410.37150.33410.4640.39320.09770.96450.38330.38071.12010.3710000-0.0983-0.09820.97261.4230.47050.01940.23380.46391.79781.42470.1094000.34650.53681.36271.23110.407500.10170.1015-0.09750.10130.302400.30080.88870.68300.09740.19420.33782.27170.9126-0.1032-0.09700.18170.18110.97910.26580.70020.17450.4760.21560.25750.07430.17070.4235-0.12020.65411.46260.16210.1640.15980.28530.03140.93063.53943.35462.79821.29991.02460.4581.08040.99110.60120.8541.06191.80.48250.1217
68
67Neg. 51 Kcal
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5024797
GGAAAUAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGGUGUCCUUCGGGACACCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.807weak81.800.970.4850.61372.35470.83481.49861.10250.76461.0621.04291.35791.64890.65210.32420-0.3156000-0.31390.9566000001.55161.5110-0.312200.30061.46511.42891.1210.2789000.27750000-0.1720.6841.596300.264800.39450.85112.230300000.36930.84910-0.307200000.24160.24060.239601.17371.069400.2282-0.00360.44590.28291.07742.07751.81122.20670.83790.08190.44880.62091.13310.58791.19991.17551.15210.65090.1623
69
68Art1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5029922
GGACAACAACAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAUGUGCUUCGGCAUAUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.393
medium
71.70.1281.4090.7680.2840.346700.464100.231100.911.16160.65670.96850.127600.213200.21250.42180.21010.62360.62690.20420.20350.60410.59782.82962.8717000.17890.35570.44121.29390.3430.67790000.1690.16850.3350.33310.16610.97960.8050.16050.94750.15750.64291.70611.46330.36350.217300.14450.14410.71180.70320.17780.68810.81410-0.07820.39950.658300.90721.14331.24310.0610.16890.16980.40720.74451.41932.67861.72112.66231.40180.73061.64331.25241.15671.47481.73642.06352.41651.07630.9568
70
69Art2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5029925
GGACAACAACAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAUUUGCUUCGGCAGGUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.369
medium
76.80.0891.140.614-0.06240.191200.09540.84640.37370.3390.18480.32160.348300.1819-0.0621000.1813000.36040.358100.35590.08880.37881.54461.42290000.43590.89860.64620.96940.3156000.157400.328900.0780.19450.76750.86940.07550.225600.152.17370.571200.071300.07120.21290.63930.1050.24390.1390.06940.07690.01520.0691.0170.4040.34470.79041.2250.13150.58250.25520.37550.67750.78651.26941.4241.63920.93190.65041.47021.53571.6461.19530.96861.31231.79350.32370.7827
71
70Art3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5029929
GGACAACAACAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAUUUCCUUCGGGAGGUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.558
medium
80.80.0981.080.589-0.02190.040.15820.31471.0050.26020.33460.1050.30320.65361.02870.21960.02590.145800.09830.07260.21710.85560.912300.0230.0350.12751.31681.6090.26380.065900.32740.77530.9840.56510.4980.0153000.24770.12360.36830.12250.19710.42390.31420.19290.23870.1785-0.00432.06221.20590.16780.278300.06440.16620.52920.35430.50710.05380.21460.2670.1066-0.03290.48080.2160.59721.12040.82820.15020.75350.29630.48910.76690.80163.06082.12771.93740.90520.8920.24521.41510.54920.50311.26570.98671.85780.6660.2587
72
71KC01
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5030526
GGUAGGCAUAUGGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGACGACCUUCGGGUUGUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.456
medium
79.80.1111.2170.6640.21540.32630.09910.098500.88550.4394-0.25160.43611.279200.2124000000.21161.01561.71130.39990.39710.29630.36442.58221.89610.5367000.26711.13481.19681.21150.9850-0.124400.32650.162800.16230.07510.67240.62990.46860.61810.30740.45753.30662.21230.41180.137000.47541.2870.77930.25860.25740.38360.254600.37941.11630.67420.66640.95341.27320.11610.68810.680.44980.88580.41321.68642.07612.04340.52830.16680.98050.58390.97751.961.26950.83421.62660.63610.0429
73
72Frozen Shape with gap size 0
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5033070
GGUGAAAUUUUAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGGGCAAGUUCGUUUGCUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.78
medium
86.90.1431.5690.8561.14970.69010.22911.43720.66110.76120.96231.00981.52761.19681.26810.95930.19120.445600.18870.18810.18750.92260.78590.53980.23570.17830.87784.38082.36280.3089000.68680.97531.19811.00840.429-0.1212000.14260.42480.28180.01960.17780.70510.67970.13560.4040.13440.28031.93441.69170.06240000.24850.85691.08110.11980.5920.118200.23310.81050.56190.1140.77911.10061.605100.31920.2120.52530.40240.07523.04142.51073.47550.6870.92940.5441.19730.76881.75170.95391.48150.97110.5330.6663
74
73Twisted crab
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5033547
GGAACAACAACAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAUAGUUUUCGAACUAUUAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.006
medium
82.80.1181.3640.7410.59641.1280.40730.47550.09291.23940.61060.82980.96051.22930.64250.565800.421200.41820.139100.75091.2675000.26660.45691.66741.49920.0533000.30041.21270.71860.709700.118000000-0.07110.92921.13870.22680.2260.11280.22461.2460.7940.7470.10650.106300.21190.83530.75250.3380.70660.4010.10010.19950.39620.12670.48930.31821.14350.79650.1403-0.04760.18570.59340.47650.80463.84752.79482.6031.29970.72050.98251.8070.31791.20351.34771.89211.75560.54530.3389
75
74rtp101
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5035820
GGAAAUAAAUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCACAAAUGUUCGCAUUUGUAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.3
medium
79.80.1331.4640.7980.00672.53771.47310.97130.95530.93981.22640.45631.01880.73530.69670.57370.42710.14200000.28260.5598-0.17190.278500.55181.34732.327500000.76560.25410.2530.50150.2497-0.09311.665-0.33290.4690.23350.46330.34541.45910.445500.442100.54742.00781.03780.6160.204600.40640.20250.60110.59490.39390.19630.19560.1950.22130.1930.57330.56770.18861.29081.2730.17920.17870.2369-0.64540.49090.10623.63342.22634.00611.82410.78751.00551.20080.41091.65522.37112.1313.41220.49420.0087
76
75Basic
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5038214
GGCCCACACAGAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCUUAAUAUUCGUAUUAAGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.294
medium
75.80.1251.3740.751.80821.63890.3059000.18720.89871.74320.28910.57250.450.2820.55860.278-0.0584-0.058300.27660.27530.73290.13480.79750.52680.26222.02431.3590.2460.2450.2440.48380.95171.27970.8030.45530.22670000.22590.2250.886100.22070.65460.4331000.20733.25171.86830.39070.194700.38680.19271.13370.37550.187101.2808-0.11550.06720.36250.4865-0.11460.5930.23740.92170.56860.16820.99690.26910.65150.08693.00633.44981.82091.62650.65111.42821.47951.01241.64131.25451.23361.29970.9010.4731
77
76lel0besrfsgs0-3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5039780
GGAAAACGAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGGACCUCUUCGGAGGUCCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.607weak73.701.2360.6183.09110001.05671.037701.351300.6679000000000.98470.32640000.64553.05680.004100000.59871.17311.14981.1274000001.10580.547700.54251.5830000.52292.01860000000.25120.7440.49180000-0.59470.9671000.95120.34711.370400-0.12950.44970.44624.9012.72422.37741.78930.35571.72531.0170.99941.30251.92151.222.89731.68760.2799
78
77Chalk Outline of Stickman
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5043664
GGUAUAGAAAGUGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUAUAUAUUCGUAUGUGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.993weak81.80.1551.7060.930.49450.89210.588700.5827002.24070.82821.34820.53430.529400000.27180.26112.25821.22790.72750.4810.4770.93851.12263.44640.42760.42450.21151.03831.21970.80191.17831.154700.382400.37990.37740.37490.3725-0.25061.45261.06930.7042000.69571.7651.3125000.16360.48670.95721.552500.6683-0.43190.30240.74680.9980.60710.32080.55270.27511.34331.17821.009-0.20821.7197-0.2270.71621.3984.88553.212.59240.75040.43880.6848-0.36830.12460.90052.23282.60750.42851.2541-0.0558
79
78Second attempt
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5043686
GGUAAUUAAAAUGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAUAUAGUUCGCUAUAUUAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.607
medium
80.80.1231.3480.7350.47231.16061.19770.81952.25031.63751.17590.73870.62630.41460.6152000.20440.20360.202900.80040.68130.586100.2801001.87771.81860000.71840.88431.0421.35670.33720.16810000000.33430.82380.3277000.16340.16291.89091.57510000.15260.15221.13850.53630.407300.1830.144600.14420.46450.17770.35311.12820.49870.03040.43180.26710.22731.81831.12663.96412.82772.58931.03641.31660.68631.34450.75641.01030.9862.18341.21681.04340.4567
80
79Just Something I threw Together. I want to see how it goes
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5044275
GGAAUAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGGCCGCCUUCGGGCGGCCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.351weak63.601.1540.577-6.7152.48671.217201.1921001.16801.14491.1227000000001.10130001.08073.071.00550000.988303.70040.9105000000000000000.8964000000.882700000000000000000001.71320.84410.83192.392500001.55220.76580001.49210
81
80Solution 1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5045850
GGAUAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCAACCACUUCGGUGGUUGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.806weak68.701.3590.6801.56341.5222000.75121.464402.787602.887500000000.649900001.88613.26274.1313000000.545600000000.5405000.53550.530600001.54922.94090.963900.47800.47410.70251.14750.45540.89671.73941.68860.83220.82043.10520.38561.1341.11221.0912-0.3962-0.0632-0.06160.21881.62111.29965.88081.75093.25291.14940.49850.62312.18680.4590.68041.75912.13081.23641.38160.7789
82
81Solution 2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5045852
GGAUAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCAACCUCUUCGGAGGUUGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.804weak78.801.1730.5860.613700.60721.18951.73081.680502.41540.53180.78691.03050.51070000000.5062000003.33893.15670000.44750.4440.87463.29890.4094000000001.00580.9886-0.17840.2149002.98011.096400000000000.3632-0.702600.717300.70851.04363.15910.63810.31732.13910.3040.98571.03262.95532.3212.37290.96690.47941.17421.16470.22661.2181.91881.65672.57241.16340.1932
83
82Solution 3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5045854
GGAUAAAUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCAAGCUCUUCGGAGCUUGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.291
medium
80.80.111.2140.662-0.21420.29022.40631.17861.26840.28591.12151.13420.8061.0551.123000000.256700.34311.60800.123401.20852.15463.4881000.21720.3241.16390.42022.12490.10100.201300.3998000.09980.09961.36180.193900.385200.76034.22592.03350.1725000.0040.16750.66230.32930.32740.16320.162800.16230.16190.481600.16012.00871.34140.7261.303500.43131.15910.82952.39641.71521.96750.72850.75270.89351.3230.89780.34930.82381.48261.2861.01230.1011
84
83BES_gap0
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5046237
GGUAAGUAACAGGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCGAGUAUUCGUAUUUGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.181
medium
81.80.1481.6250.8860.2260.44860.88340.43840.86361.47281.43630.4075-0.189301.197100-0.18860000.39631.91580.75630.37570.373300.37091.09161.76390.3506000.69292.32751.92841.56360.3110000.615400.90870.301300.59640.59030.29370.581400.57562.61080.946100.2691000.26780.79240.52350.77470.76450.25370.2526-0.1880.31340.55480.49020.11490.48213.69190.2225-0.32470.76541.61950.23970.82931.82111.75472.58721.43741.20930.85821.65121.5761.86580.76710.53111.65580.43160.3975
85
84B & E Lvl 0 revisited - 1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5047750
GGAACAAACAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCUAUAUCUUCGGAUAUAGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.677
medium
91.90.1321.4480.79-0.17710.60141.46550.96081.40611.08172.45941.28861.4340.82390.81230.60290.20030000.199600.98091.5280.24680.56370.65021.09633.09093.6970.028500.15980.47560.54961.67720.97440.7399-0.13150-0.13120.14760.74140.1450.02790.35851.73860.34560.06900.13780.61782.84441.69430.73560.12340.12310.12280.42680.66290.47810.35640.23660.11810.23520.35060.46380.46010.2291-0.01511.44911.88890.19160.20550.7270.1830.2110.09764.26952.2283.06671.51361.20180.58931.54661.15141.88861.09152.92872.87770.53150.7408
86
85B & E revisited Lvl 0 - 2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5047760
GGUAAUAAAUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCAUAUAUUUCGGUGUAUGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.959weak81.80.0691.6670.8680.45660.75510.74531.45320.71761.40040.69181.351301.3205000.3459000002.49831.22270001.77773.34953.166100001.03641.01821.00061.462900000.48360.4795001.85663.07620000.65183.47161.66720.08820.38920.76801.12950.74330.36931.08710.3601000.5087-0.29741.37200.38211.96481.66870.610.5045-0.11621.570.41730.79783.91042.80272.25931.58230.68990.71310.59221.04380.82650.51041.57292.46280.73940.3207
87
86Level 1.1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5060214
GGAAAGAAGAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGUCAUCUUCGGAUGACGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.086
medium
77.80.0921.0130.5520.52370.24080.83060.50240.14930.80420.342600.45320.22570.44790000000.11180.55350.2400.436100.43291.47632.03480000.40410.59990.97660.58180.38530000.19200.3815000.3790.1889-0.19810.188200.17661.10081.43140.17840000.17781.04760.51910.3440.17150.1710.170500.170-0.02730.36191.2281.0860.31840.27960.31410.58130.72221.46312.26012.79681.61791.631.09940.83641.45160.6341.86120.92192.26291.91240.68350.2915
88
87Lel0-a
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5065879
GGAACAACAACAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCUUCUUCUUCGGAAGAAGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.646
medium
88.90.0961.060.578-0.12660.5621.58840.92320.75480.90811.0404-0.04950.94660.28980.62520.335900000-0.09010.28271.42430.13730.409100.27142.0932.41310.40660.123800.85390.95961.40450.80790.25460.1145000.024900.11400.34010.450.55700.442200.0422.37611.29060.01410.205400.05130.35690.50540.5010.199700.2980.1980.5880.30050.38680.28860.23951.17331.64130.18150.27460.09110.44490.96080.73013.02643.16962.65050.63380.4680.38950.97210.71491.7650.73111.89831.5810.57180.1191
89
88lel0-s0-ggr
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5065911
GGAACAACAAGAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCUUCAUCUUCGGAUGAAGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.901
medium
89.90.1051.160.6330.1261.3421.53680.90760.15091.03720.87550.49010.9240.77141.19430.40790.135700000.20280.46930.92360.13160.131300.49771.94732.52320.060.0601.05940.58261.2780.69840.4454000.11110.22140.22060.11010.109901.07830.74510000.31762.72351.37850.58480.232500.09630.1921.03720.65260.73630.5470.0910.18150.27090.53690.61960.43920.26231.86190.57540.24920.08290.48860.48310.88071.1984.17722.85292.88591.05060.80810.89381.60680.38910.4991.04411.79421.71950.74590.3086
90
89lel0-s0-rgr
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5065916
GGAAGAACAAGAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCUUCAACUUCGGUUGAAGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.194
medium
82.80.1141.2550.6851.00640.16830.992400.32891.73380.93871.05110.43270.599800.29840.296800000.29530.87260000.4330.82013.34152.9190000.8750.61831.91311.17140.233300000.23240.1160.34580.45751.5580.44170.2660.04650.64780.21513.24851.57990.19680.02480.389600.19420.193500.38450.38190.19030.18971.29810.73240.18250.18190.18142.26551.19470.17020.167500.65780.49451.2773.30542.87112.69690.93960.13390.36281.42360.14060.42691.32721.4941.6871.30230.3363
91
90Default title
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5066627
GGAAUAAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCUAGUUCUUCGGAACUAGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.913weak83.80.0951.8380.9660.63051.962301.8978-0.38251.83751.78092.55351.65361.22760.79281.54330000001.86682.500500003.36445.48180.6027000.59651.16892.78171.091700.5407000.53570.53081.549800.5121.00621.470900.964301.41113.94452.111400001.23970.81481.58490.781800.388301.14180.37810.74640.37080.36853.13632.11381.2783-0.05010.62870.77540.46151.71085.38061.57042.02040.73841.87321.31741.08152.9711.65741.36781.0273.37550.94250.2559
92
91Default title
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5066630
GGAAUAAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCUGGUUCUUCGGGACUAGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.582
medium
86.90.1241.3690.7470.73291.04981.78071.72750.90781.18341.83342.41560.77881.52520.82510.2610.40680000-0.14820.70322.0353-0.14780.42830.19130.382.54323.57870.33880.168901.01171.1362.4850.91710.45490.0045000.30090.00370.74070.22140.07370.8711.41620.28190.28050.13990.27854.01642.001200000.24911.45681.07230.11890.2368-0.027800.11790.35170.69480.23070.42540.75420.157200.04520.2210.76330.99331.96963.86361.93572.30130.28841.190.55911.5470.39060.79271.09841.84112.05330.21450.1386
93
92Default title
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5066634
GGAAUAAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCCGGGCUGUUCGCGGCUUGAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
2.237
medium
90.90.131.4290.7790.04830.72470.73061.75761.28571.06791.06170.83321.32091.36871.01770.484200.24110.12030.23960.23860.39250.7591.86450.11280.11260.33570.36362.31452.4150.20300.15180.5891.41341.28660.65950.37440.11960.13940.04640.68810.22850.27290.36160.04520.80160.92030.60710.43040.51190.25941.88671.360100.239000.55241.46150.52930.22740.22220.4490.1442-0.10670.44041.63110.49440.48111.01951.35440.39710.04940.76220.44840.66720.65773.71011.86852.15490.66280.47070.54551.36130.78880.65320.82931.16551.58440.57050.0476
94
93Whitman s Sampler
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5071861
GGAAUAAGAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAUGCUCUUCGGAGCAUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.944weak80.80.22.1981.1998.01981.37432.62384.81112.30953.268403.093502.9364001.8935000003.13412.15520.84943.209101.18512.25072.85290.7045001.37552.62612.5120.85560.60820001.19130.58960.583600.57781.1332.18050.541.06030.52531.03194.14723.359900.44450000.87561.69980.42180.83160.81980.439401.18761.16371.14070.37782.87192.07661.02-0.161500.64940.32292.47283.67295.23761.54341.91891.2892.45523.220.17091.05681.49441.58512.15450.55860.6986
95
94Whitman s Sampler - Nut Chewy & Crisp
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5071873
GGAAUAAGAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGAAGCUCUUCGGAGCUUCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.129
medium
77.801.1450.5730.49971.9061.6461.20870.79470.7840.77351.91811.2941.41450.88620-0.15520-0.154700000.345200.343100.34111.97672.06340000.78131.07361.20141.177000000000.58260.71910.428300.84410.280.27863.1611.1338000-0.15350.51060.50610.7493000.24870-0.1531000.24760.33831.6692.13760.22810.898200.29370.44221.41424.2461.79663.57471.22470.520101.18871.04381.14590.17411.71670.47030.30720.4571
96
95Whitman s Sampler - Pecan Crowns
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5071879
GGAAUAAGAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUAGCUCUUCGGAGCUACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
0.797weak72.70.0731.1710.6220.96300.47751.39800.462301.35430.8890.44111.71221.256300.82550.20570.2049000.80820.79710.7863-0.289300.39050.38790.38530.38270000.75540.08740.37281.09730.72240.07250.490.696300.34610.68400.340.33800002.30081.263300000.31410.31240.31070.309100.91260000.602101.17960.58380.86270.56950.5639-0.28090.55421.86261.03091.92192.38860.59121.80640.66960.87921.02152.00441.34041.69372.05431.27640.62570.6986
97
96B&ESampleresque1
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5072986
GGAAAUAAUAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCCAUGGUUCGCCAUGGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.187
medium
85.90.1541.6940.9241.68670.83122.26262.17742.36963.42371.19741.62921.13462.37622.4919000.818900001.59271.550.764700.37991.11752.49512.06240000.34171.65950.65632.80960.61770.3072000.6080.30240.30080.29930.592402.00160.057400.28310.42162.8082.06310.51120000.25450.75350.4980.54540.242700-0.22360.71910.4755000.71282.2480.66660.53170.10480.21480.6372-0.64953.54523.35512.89341.95590.98220.43923.06581.43090.67331.08461.7351.67270.79350
98
97B&ESampleresque2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5072988
GGAAAUAAUUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCAUAGGUUCGCCUAUGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.536
medium
87.90.1351.4860.8110.3928-0.05161.09051.84740.22891.081.49480.5751.27662.14091.12890.286600.66440000.22061.08250.85320-0.16100.78363.8213.32430000.72940.36241.24130.87320.69020.17200.17150.1710.1705-0.160200.25471.56911.44920.16060.3180.07950.07942.85161.8930.145300.14490.14450.43041.12530.83180.13830.1380.27460.54410.13570.53780.26760.26640.78832.02852.54520.24140.59720.35610.19510.65590.43133.83543.2452.60680.99420.60870.68470.75650.60950.4690.85762.10241.87770.69570.2349
99
98B&ESampleresque3
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5072990
GGAAUUAAUUAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGCAUAGGUUCGCCUGUGCAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.547
medium
90.90.1261.3870.7570.0925-0.04890.72062.08380.31371.34610.73841.92220.63370.41941.231400.10240.30570000.20310.40331.185200002.2773.56120000.9041.19851.50091.3040.32420000.56180.08010.31880.07960.70760.63110.46170.15350.1611-0.2870.6792.65041.39760.13940.415300.13810.97150.65160.64430.256600.63440.37810.061300.24780.55220.61631.84321.47470.33830.20090.70140.38110.66240.02872.5412.90182.29681.55640.26520.71470.73851.03560.7541.05841.34552.54740.48490.4127
100
99Solution 2
Lab Entry Level 0 - Bend and Ends Sampler revisited - Frozen shape with gap size 0
5008364
GGAAAAUUAAAAGGUGGCAAGUACAAGUCGAAAAGACGGUACAAGAUCAAGUUCGAAAGAACGAUCAAGCGGACGAAGUCACGCAAGCCACCGUAUAUGUUCGCAUAUACAAAAGAAACAACAACAACAAC
............((((((..((((..(((.....))).))))..((((..((((....))))))))..((((((...))).)))..))))))(((((((....))))))).....................
1.199
medium
78.80.1441.5860.8650.266501.4907-0.24820.37031.08990.53993.22831.48980.49241.28380.142700.315700000.62460.61790000.30731.78691.167200.290300.85810.56652.441400.270.268700.26750.26630.52770.5229000.26030.51590.25680.760301.11842.72350.9320.46230.2302000.22931.56180.442800.43950.436101.61340.20940.82560.8140.75690.98291.90110.37770.56111.42320.17730.4029-0.0135.1632.90352.36251.90280.6930.83741.81592.77540.97151.39351.90251.55841.18150.9118
Loading...