PrimerDatabase
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXY
1
sr_IDPrimer nameIDT #Organismdate orderedPrimer SequenceDesigned By#bpGC%melting tempGeneGene Accession#full sequencelocation on referencepair w/sr_IDproduct sizeother notes
2
1707P_gurneyi_1_revP. Gurneyi10/5/2015TTTCCAAAGCTCATTGCCGCJDA205060.04Luciferase RNATTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC470Created from consensus sequence
3
1708P_gurneyi_1_fwdP. Gurneyi10/5/2015TATACATGGCATCGTCGGGCJDA205560.04Luciferase RNATTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC470Created from consensus sequence
4
1709P_gurneyi_2_revP. Gurneyi10/5/2015CCGCTCGGATGATAACTGGTJDA205559.77Luciferase RNATTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC470Created from consensus sequence
5
1710P_gurneyi_2_fwdP. Gurneyi10/5/2015CGACATTATCCGCCGTTTCGJDA205559.77Luciferase RNATTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC470Created from consensus sequence
6
16895ILL-NR137225864NA9/18/2015CTACACGACGCTCTTCCGATCTNRhttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
7
1690Anti-ILL137225859NA9/18/2015AGATCGGAAGAGC/3InvdT/http://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
8
16913ILL-NR137225865NA9/18/2015CAGACGTGTGCTCTTCCGATCTNRhttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
9
1692ILL-Lib1137225866NA9/18/2015AATGATACGGCGACCACCGAhttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
10
1693ILL-Lib2137225863NA9/18/2015CAAGCAGAAGACGGCATACGAhttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
11
1694ILL-HT1137225860NA9/18/2015AATGATACGGCGACCACCGAGATCTACAC-ATGCAT-ACACTCTTTCCCTACACGACGCTCTTCCGATCThttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
12
1695ILL-HT2137225861NA9/18/2015AATGATACGGCGACCACCGAGATCTACAC-CGTACG-ACACTCTTTCCCTACACGACGCTCTTCCGATCThttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
13
1696ILL-BC1137225862NA9/18/2015CAAGCAGAAGACGGCATACGAGAT-CGTGAT-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATChttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
14
169718s_1_REV135962640O.conchaphila8/12/2015CGCTTCACTCGCCGTTACTAJH205560.1818s Ribosomal RNAEF035118.11698392Genbank 18s ribosomal for O. conchaphila
15
169818s_1_FWD135962639O.conchaphila8/12/2015TTCCTTTTCCCCCACTCAGCJH205559.8918s Ribosomal RNAEF035118.11697392Genbank 18s ribosomal for O. conchaphila
16
169918s_2_REV135962638O.conchaphila8/12/2015GCCCGATCTCTTTCCACCTCJH206060.1818s Ribosomal RNAEF035117.11700218Genbank 18s ribosomal for O. conchaphila
17
170018s_2_FWD135962637O.conchaphila8/12/2015CTCGATTCCCTTTCCCCCACJH206060.1118s Ribosomal RNAEF035117.11699218Genbank 18s ribosomal for O. conchaphila
18
170128s_3_REV135969758O.lurida8/12/2015CGCCTCACTTTTTGTGCCTCJH205560.04
"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"
Q5REJ1gtgatatattcccggattgacgcagcatgagtttggcccgaatcggaactggacttcataatgcgacaaaaactttaagtttgacaaatatattgcaaggaacaggttgtccaaaatgtcccagcctactgtcggtatttgtactctcgcaccacaatcatttgcagtccaggaactacagttttgtcacaacagtctcgagtgatgaattatgggaaggtgtgacctccgtcagctcagcaggaaagaaacgaggccgagccaaatcaaccaagaaaaagattaatcttcatattggccaaagattaggacatggtaaggaaggcatgtctttccctggattaaacaccaaagttttcagcgagacttcacgagttaaatccactgttaaacgttctgaggaatttgatacaacacttgaggaacttcgacaacagcggaagtccacaaagaagacccgcagtacaacaaaatatgtcaatcctttgttaagaggttatactagtaatttcttaccaggaaccagtttaggaccaccagctcaagtacgagaggaaaactttgatggctttgattcaagattgttgcaaatcaagaaaatcaccaacattacagcggatcagggaaaggtgttctcatacagagctctggtagctgtcgggaatggaaatggtctggcaggttttgcagttgctaaagcaaagaaactaaatgctgctggaattaaggcgagagacaaagcagggcaacaactaatatttattgaaagatacaatggacatacattgtaccacaactcacattcacaagttcattgtacaaaggtgtttgccaaaagagcatatgaaggacatggagttgtggcacacagagtgattaaagacttgtgcctgctgtctggaattaaagatatttatgtcaagacagagggcaacacaaaaaataccatcaccatgacaatggctttcttcaatgcagttacacatcaggaaacacaccaagaattggccaaccgaaccaagatgcatgtactagagctctcagatgaacgaaatcagacaccagttgttgtggcatctccggaagatggaaagatacaagcaaaatactatggaagtgaaagggatgtgtatgacttagatactctgtacactaaaggcaaactccactggactcggcctaaaataaggccagtgtgggagagacttggttttacatcatttagaaggaagctagatcagcgggaaaggagacgagggcaacacgaggcacaaaaagtgaggcgattgtgtagactggagccctcgaaagaggagcggattcaacgcgatcaagctgggaaaaagaacgaggaataatgatgtgtgtgacttgttagatattattaaaataaatctatagaatatgaaatgca1702100Reference transcriptome Oly Transcriptome V3
19
170228s_3_FWD135969757O.lurida8/12/2015TAAGGCCAGTGTGGGAGAGAJH205559.88
"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"
Q5REJ1gtgatatattcccggattgacgcagcatgagtttggcccgaatcggaactggacttcataatgcgacaaaaactttaagtttgacaaatatattgcaaggaacaggttgtccaaaatgtcccagcctactgtcggtatttgtactctcgcaccacaatcatttgcagtccaggaactacagttttgtcacaacagtctcgagtgatgaattatgggaaggtgtgacctccgtcagctcagcaggaaagaaacgaggccgagccaaatcaaccaagaaaaagattaatcttcatattggccaaagattaggacatggtaaggaaggcatgtctttccctggattaaacaccaaagttttcagcgagacttcacgagttaaatccactgttaaacgttctgaggaatttgatacaacacttgaggaacttcgacaacagcggaagtccacaaagaagacccgcagtacaacaaaatatgtcaatcctttgttaagaggttatactagtaatttcttaccaggaaccagtttaggaccaccagctcaagtacgagaggaaaactttgatggctttgattcaagattgttgcaaatcaagaaaatcaccaacattacagcggatcagggaaaggtgttctcatacagagctctggtagctgtcgggaatggaaatggtctggcaggttttgcagttgctaaagcaaagaaactaaatgctgctggaattaaggcgagagacaaagcagggcaacaactaatatttattgaaagatacaatggacatacattgtaccacaactcacattcacaagttcattgtacaaaggtgtttgccaaaagagcatatgaaggacatggagttgtggcacacagagtgattaaagacttgtgcctgctgtctggaattaaagatatttatgtcaagacagagggcaacacaaaaaataccatcaccatgacaatggctttcttcaatgcagttacacatcaggaaacacaccaagaattggccaaccgaaccaagatgcatgtactagagctctcagatgaacgaaatcagacaccagttgttgtggcatctccggaagatggaaagatacaagcaaaatactatggaagtgaaagggatgtgtatgacttagatactctgtacactaaaggcaaactccactggactcggcctaaaataaggccagtgtgggagagacttggttttacatcatttagaaggaagctagatcagcgggaaaggagacgagggcaacacgaggcacaaaaagtgaggcgattgtgtagactggagccctcgaaagaggagcggattcaacgcgatcaagctgggaaaaagaacgaggaataatgatgtgtgtgacttgttagatattattaaaataaatctatagaatatgaaatgca1701100Reference transcriptome Oly Transcriptome V3
20
170360s_REV135969756O.lurida8/12/2015ACCCTCTGTCTGTCCTTCCAJH205559.89
60S ribosomal protein L10 (QM protein homolog) (dQM)
O61231gaggaagaaggccaaggctctttccggtagttctaattcaaaatgggacgccgaccagctcggtgttaccggtactgtaagaacaaaccttatccgaagtccagattttgtagaggtgtcccagatgcaaagatccgtatttttgatcttgggaggaagaaggccaaggtagatgacttccccctgtgtgtgcatctcgtatctgatgagtacgaacagctctcctcggaagctctagaagcaggacgtatctgtgccaacaagtatttggtcaagaactgtggtaaagatgctttccacatgcgaattcgagtgcaccccttccacgtcatcagaatcaacaagatgttgtcgtgcgctggagctgataggcttcagacgggaatgagaggagcttttggtaaaccacaaggcaccgtagcccgtgtacacataggacagccaatcatgtctgtacgtgctcgtgagagtcaccaggctgccgtgatagaagcactcaggagagccaagttcaagttccccggacgtcagaagatccacgtgtccaagaagtggggattcactaagtgggagaagcctcagtacgaggtgatgagagcggacgggcgcctgatccctgatggagttaccgtacaatataaacctaacaagggccccctgcgtgcatggaaggacagacagagggtctaaagctatttattgtgatctggacaatatgaataaaccatcatgtaggccttcaaaaaaaaaaaaaa1704105Reference transcriptome Oly Transcriptome V3
21
170460s_FWD135969755O.lurida8/12/2015GTACGAGGTGATGAGAGCGGJH206059.97
60S ribosomal protein L10 (QM protein homolog) (dQM)
O61231gaggaagaaggccaaggctctttccggtagttctaattcaaaatgggacgccgaccagctcggtgttaccggtactgtaagaacaaaccttatccgaagtccagattttgtagaggtgtcccagatgcaaagatccgtatttttgatcttgggaggaagaaggccaaggtagatgacttccccctgtgtgtgcatctcgtatctgatgagtacgaacagctctcctcggaagctctagaagcaggacgtatctgtgccaacaagtatttggtcaagaactgtggtaaagatgctttccacatgcgaattcgagtgcaccccttccacgtcatcagaatcaacaagatgttgtcgtgcgctggagctgataggcttcagacgggaatgagaggagcttttggtaaaccacaaggcaccgtagcccgtgtacacataggacagccaatcatgtctgtacgtgctcgtgagagtcaccaggctgccgtgatagaagcactcaggagagccaagttcaagttccccggacgtcagaagatccacgtgtccaagaagtggggattcactaagtgggagaagcctcagtacgaggtgatgagagcggacgggcgcctgatccctgatggagttaccgtacaatataaacctaacaagggccccctgcgtgcatggaaggacagacagagggtctaaagctatttattgtgatctggacaatatgaataaaccatcatgtaggccttcaaaaaaaaaaaaaa1703105Reference transcriptome Oly Transcriptome V3
22
170540s_REV135969754O.lurida8/12/2015GGACTTGGCTACACGCTCAAJH205560.32
"40S ribosomal protein S5 [Cleaved into: 40S ribosomal protein S5, N-terminally processed]"
P46782tttttttttttgacttccggcaccttcacggtacaatggctgagaactgggatgaagctgccccggcagtagaactgccagaaatcaaactcttcggcaagtggtcttcagatgatgttcaagtgaacgacatcagtttaactgattacatagctgtcaaagagaagtatgcgaaatatttgcctcactctgcgggaagataccaagtaaaaagattccgaaaatctcagtgtccaattgtggagcgcctgacctgttcactgatgatgcgtggaaggaacaatggaaagaaactgttgacaactcgtatcgtcaagcacgccttcgaaatcattcacctgctcacaggagagaaccctctccaagtactggtgaatgcgatcatcaacagtggtcctcgtgaagactccacccgtatcggacgtgctggtacagtacgtcgtcaggcggtagacgtctctcctctccggcgggttaaccaggctatctggctgctgtgtaacggagctcgtgaggcttccttcaggaacatcaagaccattgctgagtgcttggctgatgagctaatcaatgctgcaaagggatcctccaattcccatgctatcaagaagaaggatgaacttgagcgtgtagccaagtccaaccgataaatgacattatgtgttatcagtgaactgaaaataaactgtcaggcaaaaagtggtatttcttgttcctcagcacaccagattttattgatattgggttatggaggctgaaacagatatgaaaattatttaaaagagagcttgagttgtagtatatttgctcctaaaagtttg1706103Reference transcriptome Oly Transcriptome V3
23
170640s_FWD135969753O.lurida8/12/2015CATTGCTGAGTGCTTGGCTGJH205560.11
"40S ribosomal protein S5 [Cleaved into: 40S ribosomal protein S5, N-terminally processed]"
P46782tttttttttttgacttccggcaccttcacggtacaatggctgagaactgggatgaagctgccccggcagtagaactgccagaaatcaaactcttcggcaagtggtcttcagatgatgttcaagtgaacgacatcagtttaactgattacatagctgtcaaagagaagtatgcgaaatatttgcctcactctgcgggaagataccaagtaaaaagattccgaaaatctcagtgtccaattgtggagcgcctgacctgttcactgatgatgcgtggaaggaacaatggaaagaaactgttgacaactcgtatcgtcaagcacgccttcgaaatcattcacctgctcacaggagagaaccctctccaagtactggtgaatgcgatcatcaacagtggtcctcgtgaagactccacccgtatcggacgtgctggtacagtacgtcgtcaggcggtagacgtctctcctctccggcgggttaaccaggctatctggctgctgtgtaacggagctcgtgaggcttccttcaggaacatcaagaccattgctgagtgcttggctgatgagctaatcaatgctgcaaagggatcctccaattcccatgctatcaagaagaaggatgaacttgagcgtgtagccaagtccaaccgataaatgacattatgtgttatcagtgaactgaaaataaactgtcaggcaaaaagtggtatttcttgttcctcagcacaccagattttattgatattgggttatggaggctgaaacagatatgaaaattatttaaaagagagcttgagttgtagtatatttgctcctaaaagtttg1705103Reference transcriptome Oly Transcriptome V3
24
1681EF1d_REVO.lurida7/22/2015TGTGGGGTGAAACACGTTGAJH205060Elongation factor 1-delta (EF-1-delta)A5D989acaactgatctggagtttcctgataccatatccaataggcaccagtttcgattgaccccatagtagtccatctgcagtaatctttctgacttcctgatccatcttttccatatctgtttcatcatcccagggctttacatccaaaatcaaactggacttggcaataatagctggtttttttgcttttttggctgcataagctgctaatctttcctgtctgattctgtctgcttcttcatcctcctcatcactaccaaagaggtcgatatcatcatcatcctcctcatcttcggcaggagcagcagctgatttcttgggtacaggagcttgtgtagaaggggttgaacttcctccctcgagcttggatacacggttttctaatctttgaactaaactcttcatatcttccacaacctttttaagatctctgttttctttctctaaggattggactcgcttcatcatctgactactatctcccattgttcctccagatcctccagaattaagaactttttgaatttgttgtctggcttcagctatttcagttttgatagaactgcccactgatttgccactttttttgtccttagcagcttttccagaagagccagctttcgcggttcctgccaggaactcctgataatgtgtctcagcctcttcatacttctgtttgtttctccagactgaatcatgcattagaggattggccattttttggaggtttttttttaaggaaccggcgacgatacaacttcaacgtgtttcaccccacaattgctccaagtaa1682220Reference transcriptome Oly Transcriptome V3
25
1682EF1d_FWDO.lurida7/22/2015GAACTGCCCACTGATTTGCCJH205560Elongation factor 1-delta (EF-1-delta)A5D989acaactgatctggagtttcctgataccatatccaataggcaccagtttcgattgaccccatagtagtccatctgcagtaatctttctgacttcctgatccatcttttccatatctgtttcatcatcccagggctttacatccaaaatcaaactggacttggcaataatagctggtttttttgcttttttggctgcataagctgctaatctttcctgtctgattctgtctgcttcttcatcctcctcatcactaccaaagaggtcgatatcatcatcatcctcctcatcttcggcaggagcagcagctgatttcttgggtacaggagcttgtgtagaaggggttgaacttcctccctcgagcttggatacacggttttctaatctttgaactaaactcttcatatcttccacaacctttttaagatctctgttttctttctctaaggattggactcgcttcatcatctgactactatctcccattgttcctccagatcctccagaattaagaactttttgaatttgttgtctggcttcagctatttcagttttgatagaactgcccactgatttgccactttttttgtccttagcagcttttccagaagagccagctttcgcggttcctgccaggaactcctgataatgtgtctcagcctcttcatacttctgtttgtttctccagactgaatcatgcattagaggattggccattttttggaggtttttttttaaggaaccggcgacgatacaacttcaacgtgtttcaccccacaattgctccaagtaa1681220Reference transcriptome Oly Transcriptome V3
26
1683EFG_REVO.lurida7/22/2015TGTGTCCCCTTGTTGCTCTCJH205560
"Elongation factor G, mitochondrial (EF-Gmt) (Elongation factor G 1, mitochondrial) (mEF-G 1) (Elongation factor G1) (Protein iconoclast)"
B3MK91attttacgcacatgtatcgccggtggtgaatgtcaactctgccttatgatcttgtttttataacaggaaaatgacgatccttaaaagattttcaagtgttttacacctttcattaaaaaatggtatcatgttacaaaagttcacaccatgtgcagcctgttcagttaaaacatattcaacacggaaaatgggggatgtaaccttggattcctcaatgatcagaaacattggaatctcagcacacatagactcgggtaaaaccactcttacagagcgccttctgtattacaccgggaaactggcggaaatgcacgaagttcgagggaaagataacgtaggagctaaaatggacttcatggaattagaacgacagcgtggaatcacaattcaatcagcagcaacatatgtaaattggaaaggtacaaacattaacattattgacactcctgggcacgtggacttcacggtcgaggtggagcgtgctctccgcgtgttggacggtgctgtgcttgtgctttgtgcagttggaggagtgcaaagtcagaccattactgtgaatagacagatgaagagatacaacgtgccatgtttagccttcatcaataaactggatagaatgggatccaatcctgtcagagtcttaacacagctgaagtccaaactgaatcacaacgccgagttcatacagttacctataggactggaaaaagaccaagagggagtcgtagatcttattgaaatgaaggcattgtattttggagaaccctctggcctaaatattattgaagatgaaatcccagctcatttaagaacggaagccaaagagagaagacaaaggctaatagaggcagtgtctaatgtggatgatgttttgggagaaatgttcctggaagagaaagagcccacaaatgatgatatcaaggcagctatccgaagatcttgtattaagagggccttcacacccgtgttcctgggaacagctctgaagaacaagggggtacagccattattagatggggtgttagactacctcccgaaccccacagaggtccggaatgagtgtctgaacaacgatgaattggatgaaaatgggaatccatcaaaaatagtcctcagttcagagcgaacaacagataaaccatttgttggattagctttcaaactggaggctgggaagtttggtcagctgacctacatgagagtgtaccaaggggggatgaagaaaggagacaccatcatcaataccagaaacaacaaaaaagtccgggtgtccaggctggttcgaatgaacgctgatgaaatggaggacatcacagaagcctatgcgggagacatctgtgcgttgtttggagtggactgtgctgggggagatacttttgtcaacaaaggcaacacacaactctcattggagtccatgtatgtgccagaccctgttatttccatgtccatcaaactagctaacaaacaagaccaagaaaatttctccaaagggatctcaagatttaccaaggaggatccaacatttagagtggcatttgatccagagttaggagagaccattgccactggaatgggagagttacacctggatatttatgctcagagactggaaagagagtacaaaacaaagtgcattctgggaaaacctaaggtttctttcagagaaacattattacaaccttgcgagtttgattattggcataaaaagcaatcaggtggccgaggagagtacgcccgtgttattggaacagttgagcccttgcctccagacgaaaacacaaaacttatatttaaggaccacactacaggaacgaatattccaaagagctacatcccagccattgaaaggggtttcagaaagtgttatgaaaaaggacctttggcagaacaaaaagtatctggagtcttaatcaagttaaaagatggcgacgcccatgctgtggacagtagtgattgggcatttgaacaagctgccgttcaagcaggcctggacacctacacttacgactgggccatgttggagccgattatgacggtagaagttaacgcccctcaggagttccaaggttctgtcttagcaggacttaccaaaaggaatgctatatttctggggactgattctaacgaaggctacttcacctcctattgtgaggtaccactcaacatgatgttcggctattccacggaattgagaacaatgacccaaggacagggagagttcacaatggagtacagtaaatactgccccgcggcggaggacacggtcagacagctgaccgagagtctggaacaggagagcaacaaggggacacaggagaaaaagagaaagaaaaattaacaacagtgctcataggctcttaatgtttataaattatttatgttttatgaacttatgatgtgaaagatgtgatattgaatgtgtgcctgaatgaaagcaaatgcaagttaggttgttgagtctgagaacataagggatacgatacatgaaataaatggtaaaactatttag1684113Reference transcriptome Oly Transcriptome V3
27
1684EFG_FWDO.lurida7/22/2015ACCCAAGGACAGGGAGAGTTJH205560
"Elongation factor G, mitochondrial (EF-Gmt) (Elongation factor G 1, mitochondrial) (mEF-G 1) (Elongation factor G1) (Protein iconoclast)"
B3MK91attttacgcacatgtatcgccggtggtgaatgtcaactctgccttatgatcttgtttttataacaggaaaatgacgatccttaaaagattttcaagtgttttacacctttcattaaaaaatggtatcatgttacaaaagttcacaccatgtgcagcctgttcagttaaaacatattcaacacggaaaatgggggatgtaaccttggattcctcaatgatcagaaacattggaatctcagcacacatagactcgggtaaaaccactcttacagagcgccttctgtattacaccgggaaactggcggaaatgcacgaagttcgagggaaagataacgtaggagctaaaatggacttcatggaattagaacgacagcgtggaatcacaattcaatcagcagcaacatatgtaaattggaaaggtacaaacattaacattattgacactcctgggcacgtggacttcacggtcgaggtggagcgtgctctccgcgtgttggacggtgctgtgcttgtgctttgtgcagttggaggagtgcaaagtcagaccattactgtgaatagacagatgaagagatacaacgtgccatgtttagccttcatcaataaactggatagaatgggatccaatcctgtcagagtcttaacacagctgaagtccaaactgaatcacaacgccgagttcatacagttacctataggactggaaaaagaccaagagggagtcgtagatcttattgaaatgaaggcattgtattttggagaaccctctggcctaaatattattgaagatgaaatcccagctcatttaagaacggaagccaaagagagaagacaaaggctaatagaggcagtgtctaatgtggatgatgttttgggagaaatgttcctggaagagaaagagcccacaaatgatgatatcaaggcagctatccgaagatcttgtattaagagggccttcacacccgtgttcctgggaacagctctgaagaacaagggggtacagccattattagatggggtgttagactacctcccgaaccccacagaggtccggaatgagtgtctgaacaacgatgaattggatgaaaatgggaatccatcaaaaatagtcctcagttcagagcgaacaacagataaaccatttgttggattagctttcaaactggaggctgggaagtttggtcagctgacctacatgagagtgtaccaaggggggatgaagaaaggagacaccatcatcaataccagaaacaacaaaaaagtccgggtgtccaggctggttcgaatgaacgctgatgaaatggaggacatcacagaagcctatgcgggagacatctgtgcgttgtttggagtggactgtgctgggggagatacttttgtcaacaaaggcaacacacaactctcattggagtccatgtatgtgccagaccctgttatttccatgtccatcaaactagctaacaaacaagaccaagaaaatttctccaaagggatctcaagatttaccaaggaggatccaacatttagagtggcatttgatccagagttaggagagaccattgccactggaatgggagagttacacctggatatttatgctcagagactggaaagagagtacaaaacaaagtgcattctgggaaaacctaaggtttctttcagagaaacattattacaaccttgcgagtttgattattggcataaaaagcaatcaggtggccgaggagagtacgcccgtgttattggaacagttgagcccttgcctccagacgaaaacacaaaacttatatttaaggaccacactacaggaacgaatattccaaagagctacatcccagccattgaaaggggtttcagaaagtgttatgaaaaaggacctttggcagaacaaaaagtatctggagtcttaatcaagttaaaagatggcgacgcccatgctgtggacagtagtgattgggcatttgaacaagctgccgttcaagcaggcctggacacctacacttacgactgggccatgttggagccgattatgacggtagaagttaacgcccctcaggagttccaaggttctgtcttagcaggacttaccaaaaggaatgctatatttctggggactgattctaacgaaggctacttcacctcctattgtgaggtaccactcaacatgatgttcggctattccacggaattgagaacaatgacccaaggacagggagagttcacaatggagtacagtaaatactgccccgcggcggaggacacggtcagacagctgaccgagagtctggaacaggagagcaacaaggggacacaggagaaaaagagaaagaaaaattaacaacagtgctcataggctcttaatgtttataaattatttatgttttatgaacttatgatgtgaaagatgtgatattgaatgtgtgcctgaatgaaagcaaatgcaagttaggttgttgagtctgagaacataagggatacgatacatgaaataaatggtaaaactatttag1683113Reference transcriptome Oly Transcriptome V3
28
1685Act_REVO.lurida7/22/2015CACCATGAAACGCCGACTTGJH205560ActinP53498cgtcacaaactgggacgacatggaacagttatggcagtacatcttcacgggagtgctaggagtatctcccgaggaatacaatgtactgaattctgaaatctcctttataccaaaagcttgtaaggaagcaatgttacagttattaatggaaaagtttaatgtacaaggctacaacgcccagctgcagggtattttagctgccatggcctacggtcataccagcagcctcattctggaatgtggtgaaggcgttgcacaagcatttcctgtttatgagtcctacgcttttccggactcgataaaaagtatggagatcggtggaaaggacgtcacactgtcgctacagaaactcctatacgaaaagggatattcttttactacacattctgagattgatgcagtgagggagataaagggaaaatattgttctgtacgcccatataactttacttcggacaagatgtcgtcgcaatcagacggagaggacacatacacattaccagacggtcagcaaatagtcattggtgacgaaaggtttgaggctccggaagtcctttttcggtcatccttactaggttacgacacgggtgagcttggagggatccaggatttggtgcacgccgcaatccaggcctgcgattggtcctgccggcgagacctgtattggaatgttctcctgtcgggtggaagcaccttactgccaggttttaaagagaggctttcacaagaactgagcagtaaggcaccgtgtcgtgttaaagtgtgggcggatccaagtcggcgtttcatggtgtggattggcggatccatttacgcctctctgatgttttgtgagaataaatggataactaagagtgaatacaacgaatatggacccaatattattcaccgaaaatgtcaattggccgcgcagacaaacctaacttagtggactacaatactatattgtacatcatcttattttatataaaaaaaaaaaggaggg1686123Reference transcriptome Oly Transcriptome V3
29
1686Act_FWDO.lurida7/22/2015GTTCTCCTGTCGGGTGGAAGJH206060ActinP53498cgtcacaaactgggacgacatggaacagttatggcagtacatcttcacgggagtgctaggagtatctcccgaggaatacaatgtactgaattctgaaatctcctttataccaaaagcttgtaaggaagcaatgttacagttattaatggaaaagtttaatgtacaaggctacaacgcccagctgcagggtattttagctgccatggcctacggtcataccagcagcctcattctggaatgtggtgaaggcgttgcacaagcatttcctgtttatgagtcctacgcttttccggactcgataaaaagtatggagatcggtggaaaggacgtcacactgtcgctacagaaactcctatacgaaaagggatattcttttactacacattctgagattgatgcagtgagggagataaagggaaaatattgttctgtacgcccatataactttacttcggacaagatgtcgtcgcaatcagacggagaggacacatacacattaccagacggtcagcaaatagtcattggtgacgaaaggtttgaggctccggaagtcctttttcggtcatccttactaggttacgacacgggtgagcttggagggatccaggatttggtgcacgccgcaatccaggcctgcgattggtcctgccggcgagacctgtattggaatgttctcctgtcgggtggaagcaccttactgccaggttttaaagagaggctttcacaagaactgagcagtaaggcaccgtgtcgtgttaaagtgtgggcggatccaagtcggcgtttcatggtgtggattggcggatccatttacgcctctctgatgttttgtgagaataaatggataactaagagtgaatacaacgaatatggacccaatattattcaccgaaaatgtcaattggccgcgcagacaaacctaacttagtggactacaatactatattgtacatcatcttattttatataaaaaaaaaaaggaggg1685123Reference transcriptome Oly Transcriptome V3
30
1687GAPDH_REVO.lurida7/22/2015CGCTCCTTCCAAGTCTCCAGJH206060
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12)
Q6BMK0caattgcattaatcgacaactatatccaaactcattatcataccaggatatcaacttgatcaatttatctccatctttacttgctatttcaatgcacgccttttcgtcaaccaaactactatgcgattcatccattaccccagccaatgtcaaagaatcggtgctatcaactttcaatatatccttcaactcattcttagacgcaacttttatagcttccataacttcattcaatcctaccttcgagttttctaatgtaagtgtcaagtcaacaacagacccacaaatcgttggaactctgaatgccattccggtaagtattccgtttacttcaggcagtacttttccgacagctttggcagcacctgtcgaagcaggaattatgtttgcagctccagagaagcccattcttatgctccttgcatttccgtcaacaataggctgagaaatagtcactgaatgcactgtggtcattaaacctgtttttattttgtacttatcattgacagccttcaccaatggtgctagacagttagtagtgcaggaagcgttgctgattatactctctcctttgtactctttgtcgttcacacctttaacaaacataggaatgtctggagacttggaaggagcgctgagtacaactttggtaacgtctgaagtttggttgtattctttgaggtggtttctagctgtctctgtggttaggaaaacccctgtgcaatctacgacaactttgacgcctgttaatttccagttgattaatgatggactcttctcgtgggtgattttgatagaagatacgagattttctttagtttccttgggattcgcacagcaacgattgtagatgtttaaggattgatttgcttcgtctgctgctgcgtgatatgcaaaacgaccatgag1688221Reference transcriptome Oly Transcriptome V3
31
1688GAPDH_FWDO.lurida7/22/2015TGCTCCTTGCATTTCCGTCAJH205060
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12)
Q6BMK0caattgcattaatcgacaactatatccaaactcattatcataccaggatatcaacttgatcaatttatctccatctttacttgctatttcaatgcacgccttttcgtcaaccaaactactatgcgattcatccattaccccagccaatgtcaaagaatcggtgctatcaactttcaatatatccttcaactcattcttagacgcaacttttatagcttccataacttcattcaatcctaccttcgagttttctaatgtaagtgtcaagtcaacaacagacccacaaatcgttggaactctgaatgccattccggtaagtattccgtttacttcaggcagtacttttccgacagctttggcagcacctgtcgaagcaggaattatgtttgcagctccagagaagcccattcttatgctccttgcatttccgtcaacaataggctgagaaatagtcactgaatgcactgtggtcattaaacctgtttttattttgtacttatcattgacagccttcaccaatggtgctagacagttagtagtgcaggaagcgttgctgattatactctctcctttgtactctttgtcgttcacacctttaacaaacataggaatgtctggagacttggaaggagcgctgagtacaactttggtaacgtctgaagtttggttgtattctttgaggtggtttctagctgtctctgtggttaggaaaacccctgtgcaatctacgacaactttgacgcctgttaatttccagttgattaatgatggactcttctcgtgggtgattttgatagaagatacgagattttctttagtttccttgggattcgcacagcaacgattgtagatgtttaaggattgatttgcttcgtctgctgctgcgtgatatgcaaaacgaccatgag1687221Reference transcriptome Oly Transcriptome V3
32
1677Flk_Actin_REV133870016O.lurida6/9/2015AACTGGGACGACATGGAGAAJH20611678479Flanking primers for primer SR_ID
33
1678Flk_Actin_FWD133870015O.lurida6/9/2015TCGAGGGAGGAAGAGGAAGCJH2059Actin Flankingttttttttttaattttattggtttttaattggtgatttttttcacatttttttttttcagtacaaaaaaatatcaacgattggaatcttagacaacgtcagtgtaaatcagatcttgtcttcagatctacgcaccattatgatcagtcagcgcacccagcactgcaagggactttggcgaaaaatgaccgtttgtgtgactagaaaatattggcaaataagtctaaaaacacttcctgtggacaatggatggaccagattcatcgtattcctgtttgctgatccacatctgttggaaggtggagagagaagcaaggatggaaccaccgatccagacggagtatttcctctctggtggggcaatgatcttgatcttcatggtgcttggagcaagagcggtgatttccttctgcatacggtcagcaatacctgggaacatggtggtacctccggagaggacggtgttggcgtacagatccttacggatgtcgacgtcgcacttcatgatggaattgtaggtggtttcatggataccagcagattccatacccaagaaggatggctggaagagggactctgggcaacggaatctctcgttaccgatggtgatgacctgaccgtcgggaagctcgtagctcttctcgagggaggaagaggaagcggcggtggccatttcctgctcgaagtcgagggcgacatagcagagtttctccttgatgtctctgacgatctctctctcggcggtggttgtgaatgaataaccacgctcggtgaggatcttcatgaggtagtcagtaagatcacgaccagccaaatccagacgaaggatagcgtggggaagggcgtaaccttcgtagatggggacagtgtgggtgacaccatcaccggagtcaagcacgataccagtggtacgaccggaagcgtacagggacagcacggcctggatggcgacgtacatggcgggagcgttgaaggtctcgaacatgatctgtgtcatcttttctctgttggccttggggttgagtggggcctcggtcaggaggacggggtgttcctctggggccacacggagttcattgtagaaggtgtgatgccagattttctccatgtcgtcccagttggtgacgataccgtgttcaatggggtacttgagggtgaggattcctctcttgctctgggcctcgtctcctacatagctgtctttctgtcccataccaaccattacaccctgatgtctgggtcgtccaacaatggaggggaacacggccctgggggcatcgtctccggcgaatccggccttgcacattccagatccattgtcgataactaaagctgcaacgtcttcgtcacccattatgagttctgtgtgtttgattgtcaaaaggtaagacaggtaatcgtcactattcggtctctcgaatctaag1677479Flanking primers for primer SR_ID
34
1679Flk_HSP70_REV133870014O.lurida6/9/2015TCAGGACGGCTTGTGAACGJH196016801068Flanking primers for primer SR_ID
35
1680Flk_HSP70_FWD133870013O.lurida6/9/2015GACCCGGATGTCCAGAGGAAJH2060HSP70 Flankingttctctatttaaataaatttattacaacaataaacataagtaacatttgtataatttgtaaacacattcttcaacacaatatcatccaacaaactaaacgctttgagacaataatttacaaataatcttcattgaaagtactatggcaacttcaaatactagtccacctcttctacagtgggcccctgacctgagtgacccggatgtccagaggaaccgttttggtgtagtttggccatgatgggggaacacactttctgaacctccttcagtttgaattcatactcgtctatttctgccaaggcgttgttgtcgagccaggacagagtttcgctgcacactttggaaatggtctctttgtcttcagactggagtttgtcgccattttcctcgctggcttgtttgatggagaacacgtaggattccagctgatttcgtgctcctatcctctgtcgttgtttttcatcttcttctttgtatttctcagcctcattcaccattctctcgatgtcagccttactaaggcgacctttgtcgttggtgatggtgattcggttgcatttgccagtactcttgtctttggctgagacattcaggattccgttggcatcgatgtcaaattccacttcgatctgtgggacacctcggggtgctggaggaattccgttcagttcaaaagtacccagtttgttattgtctttggtcatcgctcgttcgccctcaaatacctgaatggaaactccaggctggttatcagaataggtggtaaacgtctgagatgccttggttgggattttagcatttcgttcgatgattttggtcatgacacctccggcagtttcaatgcccagagataagggagtgacatctaccaggagaacatctttaatggcatcacttctgtctccctttaaaatggcagcctgaacagcagcaccgtatgccaccgcttcgtctggattaatggacttgttcaattctttgccgcccatgaaatcttgtagcagtttttggatcttaggaattcttgtcgatcctcctaccagaaccacttcgtgaattttggacttgtccaacttggcatccctcagagctttctctaccggctccagggtggcacggaacaaatcggaacacaattcctcgaatctggctcgtgtaattttactgtaaaagtcaattccctcgaagagagagtcaatctctatgttggcttctgcgctgctggacaaagttctcttggcacgttcacaagccgtcctgagtcgtctcagggaacggttgttcttagaaatatctttactgtacttgcgtttaaattcttgaacgaagtgattcaccattcgattgtcaaaatcctcccctcccaaatgagtgtctcctgccgttgaacgaacctcaaatatggatccctcgtctattgtgaggatagacacatcaaaagttccacctcccaggtcaaagatgaggacatttttctcaccagaaatgtttttgtctagtccataagccaaagcggcggccgtgggctcgttcacgatccggagaacgttgagaccggctatcactccggcatccttggtggcctctctctgggcgttattgaaataggcgggcacagtgatgacggcgtcccgaatggactgtcctaggtaggcttctgctgtctccttcatttttgtcagtaccatagaactgatttcctcgggtgtaaatctctttctctcacctttgtgctctacttgaagtctaggttttccaccgtcgttgatgacagtaaaaggccagtgcttcatatcagactgcacgttttcgtcgttgaatttgcgtccaatcagccttttagcgtcgaagattgtattggtggcgttcatggccacctggtttttggctggatccccgatgagtctctctgtgtctgtgaatgccacataactgggcgttgttctgtttccctgatcgttagcaatgatttccactttcccatgttgaaaaacaccgacacaggaaaacgttgttccgagatcaatgccgatcgctggagctttactagccatgattgtttgtaaacacgaaagtgaaagtagctgtccgatataatataatcactcactgtttctcgtgtatcctccttggaacgctttcttctctttgatagctctcgccgatttctgcgtttgtttgacattctagagtcagagctgctcttatatatactattatcgaaagttctggacactgcgagattcatcgctct16791068Flanking primers for primer SR_ID
36
1651Flk_p29ING_REV133561932O.lurida6/1/2015AAGCAGACTCAGATTCAGGCJH2058Q8C0D71652514Flanking primers for primer SR_ID 1623
37
1652Flk_p29ING_FWD133561931O.lurida6/1/2015GTGGACACACATGCACTCCTJH2060p29ING4 FlankingQ8C0D71651514Flanking primers for primer SR_ID 1624
38
1653Flk_H2A_REV133561930O.lurida6/1/2015TCAGGACGTGGTAAAGGAGGAJH2160P022701654373Flanking primers for primer SR_ID 1605
39
1654Flk_H2A_FWD133561929O.lurida6/1/2015TGCTGGGGTTTTTCTGGGTCJH2060H2A FlankingP022701653373Flanking primers for primer SR_ID 1606
40
1655Flk_H2A.V_REV133561928O.lurida6/1/2015CAAGGCAGTTTCTCGTTCGGJH2059P089911656487Flanking primers for primer SR_ID 1607
41
1656Flk_H2A.V_FWD133561927O.lurida6/1/2015GCGATGGAGTTGATGAGGTGJH2059H2A.V FlankingP089911655487Flanking primers for primer SR_ID 1608
42
1657Flk_H3.3_REV133561926O.lurida6/1/2015TCGTACAAAGCAAACTGCACGJH2160Q6P8231658552Flanking primers for primer SR_ID 1609
43
1658Flk_H3.3_FWD133561925O.lurida6/1/2015CCAATGACAAATGAGCCACACAAJH2360H3.3 FlankingQ6P8231657552Flanking primers for primer SR_ID 1610
44
1659Flk_GRB2_REV133561924O.lurida6/1/2015ACTGCGCTGACATACTGGACJH2060P629941660695Flanking primers for primer SR_ID 1611
45
1660Flk_GRB2_FWD133561923O.lurida6/1/2015TCAGAACTGGTTCAAAGCTGAGTJH2360GRB2 FlankingP629941659695Flanking primers for primer SR_ID 1612
46
1661Flk_GABABR_REV133561922O.lurida6/1/2015TGCACCACACTCCTGATGACJH2060Q9WV181662558Flanking primers for primer SR_ID 1619
47
1662Flk_GABABR_FWD133561921O.lurida6/1/2015GAGGAGGACACGAAACTCCGJH2060GABABR FlankingQ9WV181661558Flanking primers for primer SR_ID 1620
48
1663Flk_PGE/EP4_REV133561920O.lurida6/1/2015TCCGTCTGCTTTTTAGAATGGTAJH2358P322401664654Flanking primers for primer SR_ID 1637
49
1664Flk_PGE/EP4_FWD133561919O.lurida6/1/2015GCTCAACGAATTGCTCTACTCCJH2259PGE/EP4 FlankingP322401663654Flanking primers for primer SR_ID 1638
50
1665Flk_HSPb11_REV133561918O.lurida6/1/2015ATCAACGCCAGGGGAACTTGJH2061Q9Y5471666323Flanking primers for primer SR_ID 1649
51
1666Flk_HSPb11_FWD133561917O.lurida6/1/2015AGAATTGTCTGTGGAATCGAGCJH2259HSPb11 FlankingQ9Y5471665323Flanking primers for primer SR_ID 1650
52
1667Flk_BMP2_REV133561916O.lurida6/1/2015ATGGAGTCTGTGGACGGTTTGJH2160P126431668676Flanking primers for primer SR_ID 1639
53
1668Flk_BMP2_FWD133561915O.lurida6/1/2015GGCTGGCTGGATCGTCATJH1860BMP2 FlankingP126431667676Flanking primers for primer SR_ID 1640
54
1669Flk_CARM_REV133561914O.lurida6/1/2015TGGGATGGGTCAGATAAACCTJH2158Q6DC041670638Flanking primers for primer SR_ID 1641
55
1670Flk_CARM_FWD133561913O.lurida6/1/2015TTCACACAGCCCATTGTGGATJH2160CARM1 FlankingQ6DC041669638Flanking primers for primer SR_ID 1642
56
1671Flk_PGRP_REV133561912O.lurida6/1/2015TGTGTATGAAAAGTAATGAAGAGCAJH2557O755941672450Flanking primers for primer SR_ID 1631
57
1672Flk_PGRP_FWD133561911O.lurida6/1/2015AGCTGGTGCAGTCCTATCAGJH2059PGRP-S FlankingO755941671450Flanking primers for primer SR_ID 1632
58
1673Flk_CRAF_REV133561910O.lurida6/1/2015CCAGGACATTAGGCTTGCTGAJH2160Q608031674423Flanking primers for primer SR_ID 1635
59
1674Flk_CRAF_FWD133561909O.lurida6/1/2015GGACATCCAGTGGCAACATTCJH2160CRAF1 FlankingQ608031673423Flanking primers for primer SR_ID 1636
60
1675Flk_TLR_REV133561908O.lurida6/1/2015TCTAGTATGCGCTTCGTTTGCJH2059Q9DD781676425Flanking primers for primer SR_ID 1629
61
1676Flk_TLR_FWD133561907O.lurida6/1/2015GCAATAGCTTGTCACCGCCJH2059TLR2.1 FlankingQ9DD781675425Flanking primers for primer SR_ID 1630
62
1605H2A_REV133210778O.lurida5/21/2015GGAACTACGCCGAGAGAGTGJH2055Histone H2AP02270tggccgtgaaaacggccgtttgttattataggttcctgcaagcagactttttacttgctggggtttttctgggtcttcttggggaggagcacagcctggatgttgggcaggacaccaccctgggcgatggtcacgccggacagaagtttgttcaactcctcgtcgttgcggatggccagctgcaaatgacggggaatgattctggtcttcttgttgtcacgggcggcgttgcctgccaattccaagacttcggcggccaagtactccagaacggcggccaggtacacgggggcgccggctcccactctctcggcgtagttccccttcctcagcagacggtggatacgacccacgggaaactgaagtcccgcacgggatgatcggctctttgcctttcccttcacttttcctcctttaccacgtcctgacatcttgtttttactgttgtgcgctgatgaattcaaacomp23253_c0_seq11606266Reference transcriptome Oly Transcriptome V3
63
1606H2A_FWD133210777O.lurida5/21/2015GCTGGGGTTTTTCTGGGTCTJH2055Histone H2AP02270tggccgtgaaaacggccgtttgttattataggttcctgcaagcagactttttacttgctggggtttttctgggtcttcttggggaggagcacagcctggatgttgggcaggacaccaccctgggcgatggtcacgccggacagaagtttgttcaactcctcgtcgttgcggatggccagctgcaaatgacggggaatgattctggtcttcttgttgtcacgggcggcgttgcctgccaattccaagacttcggcggccaagtactccagaacggcggccaggtacacgggggcgccggctcccactctctcggcgtagttccccttcctcagcagacggtggatacgacccacgggaaactgaagtcccgcacgggatgatcggctctttgcctttcccttcacttttcctcctttaccacgtcctgacatcttgtttttactgttgtgcgctgatgaattcaaacomp23253_c0_seq11605266Reference transcriptome Oly Transcriptome V3
64
1607H2A.V_REV133210776O.lurida5/21/2015TATCACACCCCGTCACTTGCJH2055Histone H2A.V (H2A.F/Z) (Fragment)P08991ttttttttcagttttgtaatctacatttattcttcaacttcactttgagattaccactacaataggcaaccttactaagtctcccaaagttataaaagagagatggtttttaaaatttatttatgataaatggacatgaaaataataaaactcgacacaaacattgacgctgtactattaaaaccaaaagcgatggagttgatgaggtgaaagatgaggataaaaaatgtcttctaagttatatgacagtcatagtctctatatataaacttttacacaacattcaggtagagtcttttgttcagctcccagaattttctcaccatgaacactttaagctgctttctgtgtgcccttctttccaatgagagatttgtgaatatgtggaatgacaccaccaccggcaattgttgctttgattaaagaatccaactcttcatctcctctgatggcaagctgcaagtgacggggtgtgatacgctttaccttcagatctttactggcgtttcctgccaactccaacacttcagctgtcaagtactccagaatagcggcactgtacacggcagctgtggctccaacacgtccatgacttgtggtcctgttcttcaaatgtcgatgaatacgtcctacgggaaactgaagacctgctctggccgaacgagaaactgccttggccttcgcttttccggaatctttacctgctttacctcctgccatctttgctgcctgatgaaatcaatctcaaaccgacgctaacgaaggccgccaaagtatatgccagttcaaggtcacgtgataaaataaaccaatgggtacaccgcaaatgaaaacaaaggacomp25000_c0_seq11608139Reference transcriptome Oly Transcriptome V3
65
1608H2A.V_FWD133210775O.lurida5/21/2015TGCTTTCTGTGTGCCCTTCTJH2055Histone H2A.V (H2A.F/Z) (Fragment)P08991ttttttttcagttttgtaatctacatttattcttcaacttcactttgagattaccactacaataggcaaccttactaagtctcccaaagttataaaagagagatggtttttaaaatttatttatgataaatggacatgaaaataataaaactcgacacaaacattgacgctgtactattaaaaccaaaagcgatggagttgatgaggtgaaagatgaggataaaaaatgtcttctaagttatatgacagtcatagtctctatatataaacttttacacaacattcaggtagagtcttttgttcagctcccagaattttctcaccatgaacactttaagctgctttctgtgtgcccttctttccaatgagagatttgtgaatatgtggaatgacaccaccaccggcaattgttgctttgattaaagaatccaactcttcatctcctctgatggcaagctgcaagtgacggggtgtgatacgctttaccttcagatctttactggcgtttcctgccaactccaacacttcagctgtcaagtactccagaatagcggcactgtacacggcagctgtggctccaacacgtccatgacttgtggtcctgttcttcaaatgtcgatgaatacgtcctacgggaaactgaagacctgctctggccgaacgagaaactgccttggccttcgcttttccggaatctttacctgctttacctcctgccatctttgctgcctgatgaaatcaatctcaaaccgacgctaacgaaggccgccaaagtatatgccagttcaaggtcacgtgataaaataaaccaatgggtacaccgcaaatgaaaacaaaggacomp25000_c0_seq11607139Reference transcriptome Oly Transcriptome V3
66
1609H3.3_REV133210774O.lurida5/21/2015AAGTTGCCTTTCCAGCGTCTJH2055Histone H3.3Q6P823tttttttttttattaagagactacatttattgttaaaataagatacttgcacaaatctaaaatattacaaaaagacaacacaatgggggacacctgtataaaaaaaacttttgtgaaagtcaagagtttcaagatttgaacagatagaaataagacagtccagaacaagaatacataaaaattgacatatttccctgactattcatgatagaatgaccagcatggttcaatgcaagaaatcaaaagtgttaatcaagaaaaccatggaattaactttctcaatcacatttctatgcatgcatataatggacattatcaaaaccaacgactgttgatctgcattaaataagaggtgtcttacagaacataaattaaaaaaaatccaatgacaaatgagccacacaatgagaatttgtctggaatggaaactaaattaccatgccatgtcctgaaaatgtctgctgcattcacgataaaaatttcaatgtctatatgaaagtaagtttgtgtgatgaaacagaaacgagatcatgcacgctctcctcgaatcctcctagccaactgaatgtctttgggcatgattgtgactctctttgcatggatggcgcacaagttagtgtcctcaaataatccaaccaggtaagcttcactggcctcttgcaaggctccaatagctgcactttggaatctcaagtcagtcttgaagtcttgagcaatttctctcaccagacgctggaaaggcaacttcctgatgagcaactcggttgatttctggtacctacggatttctctgagggcgactgttcctggcctgtatctatgaggtttcttcactcctccagtggacggggcactcttacgtgcagcctttgtggccagctgtttacgaggggctttacctcctgtacttttacgtgcagtttgctttgtacgagccattctgtcaaatttacttcttacaccgactaaccgatccgacgtttgtgaatattttaactcttgtcaagtttgtatgttatattcomp19571_c0_seq11610214Reference transcriptome Oly Transcriptome V3
67
1610H3.3_FWD133210773O.lurida5/21/2015CACGCTCTCCTCGAATCCTCJH2055Histone H3.3Q6P823tttttttttttattaagagactacatttattgttaaaataagatacttgcacaaatctaaaatattacaaaaagacaacacaatgggggacacctgtataaaaaaaacttttgtgaaagtcaagagtttcaagatttgaacagatagaaataagacagtccagaacaagaatacataaaaattgacatatttccctgactattcatgatagaatgaccagcatggttcaatgcaagaaatcaaaagtgttaatcaagaaaaccatggaattaactttctcaatcacatttctatgcatgcatataatggacattatcaaaaccaacgactgttgatctgcattaaataagaggtgtcttacagaacataaattaaaaaaaatccaatgacaaatgagccacacaatgagaatttgtctggaatggaaactaaattaccatgccatgtcctgaaaatgtctgctgcattcacgataaaaatttcaatgtctatatgaaagtaagtttgtgtgatgaaacagaaacgagatcatgcacgctctcctcgaatcctcctagccaactgaatgtctttgggcatgattgtgactctctttgcatggatggcgcacaagttagtgtcctcaaataatccaaccaggtaagcttcactggcctcttgcaaggctccaatagctgcactttggaatctcaagtcagtcttgaagtcttgagcaatttctctcaccagacgctggaaaggcaacttcctgatgagcaactcggttgatttctggtacctacggatttctctgagggcgactgttcctggcctgtatctatgaggtttcttcactcctccagtggacggggcactcttacgtgcagcctttgtggccagctgtttacgaggggctttacctcctgtacttttacgtgcagtttgctttgtacgagccattctgtcaaatttacttcttacaccgactaaccgatccgacgtttgtgaatattttaactcttgtcaagtttgtatgttatattcomp19571_c0_seq11609214Reference transcriptome Oly Transcriptome V3
68
1611GRB2_REV133210772O.lurida5/21/2015CCAGTTGCAGTCCACTTCCTJH2055
Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)
P62994aaaataggaactacacaacaacgcggaggtaaatatcagggtcaagatggaggcgatagcgaaacatgatttcagagcaactgctgatgatgaattaagcttttccaaaactaacattttaaagatcttgagcatggatgatgatcagaactggttcaaagctgagttagatggtaaagagggatacgtaccaaataattatatagaaatgaaaccacacccttggtttgctggaaagattcctcgattagaagcagaaagacgattattggagaaagactgtcgagggaactttgtccacccagacggggcattcctgctcaggaatagtgagagtgccccgggggaattctcaatatcagtaaagtttcaagaaaatatccagcattttaaagtattaagggatggagcagggaaatatttcctatgggttgtcaagttcaactctataaacgaactgatcgaatatcatcggatgtcatctgtcaatcgtggacagaccattgtactcaaagatatggcgactaacaggggaaagaaagcgtcggcaatgtacgaattcaaaccagaaaccgttggggagctagcactcagcagaggtgatatcataacagttctagaggaagtggactgcaactggtggaaaggagaacgcaacggcgaggaggggttgtttcctgctgcatatgtcaaaaagcttgattgacctgcaattgtgtcgcgaatcttgcttgtggaaaattagcttgaaaaaaaaatcgtttgtaatgtcatctttgatcgggacaagcttctcatcctgtctattctgatggattggtccagtatgtcagcgcagtgtttgatatatattggcactcacgaaaaaactactatttgttagccatagtgtgccagccttattacgtatacccatcttctaactgtgtaccacgggagaccttccgtcagtagtctcagaaaacgattctctttccaatcaactagttataaagattttttttttccaaaaagatcaaagatgtacacatgtatttgtataaatttcattttcatatatagatactcattgtacataactgaacattttgcagaagtatatatgtggcttaattcatatttttaagcatttctgtgcaagataataagaaagctcttcatttgaatagaagtagaataggaccataaggtacaggagagaaaacataacaatccaaaagaatcgtgtcctcaaatgtgagaacttgcaaattgcttggagattcaacaagaaaccatagacaccattaggagctgttggacgtaagcgcagtaacacttcagacactgttgaagctgcaagtagatctgatgacatgagaattatagatttgtgtgtataaccattttgaatttctatatcctggttctagaataatatacattctgttggaagttccatatactaattttcagttatggttatattgatgcttgaatggtctccttattcactaaatatcaaatgttctgcgtatatttttttaatgtgtacaaattttagatgtatgttttttgaagggattcttgcataatgatttgtactcagagactgaaatctgtatggaccggtttgcggtttagtaatttccaggcatagattacagaggctaatgatgagttattgattgaaatcgcaggttattgacatgtttatgttgatgttgatgtatggatatatatatttatatactataactacaatttcttgtgatcttgtttttgtactttcactttcattcttaaaaacaattgcatgactatcttcttggcatcaaacaagttttgaaaagacaaccgctttcacattctttctgcagtttgtgtggcaattttgtctgttaagctaatatgatgctttaaatttctgcgttcttcctctaaacacatatacttccaatgtcattatgctggtcaagacatttttgcacttaatagtaatataacttaacagtggcactggtggtatatgagttagtttctgagaaacagtgtgtcctctgccatattttatgaaatgttaacaagattgtcaatatgtcatgaataaatttagcaatttttaaaaaaaaaaaaaaacomp10127_c0_seq11612351Reference transcriptome Oly Transcriptome V3
69
1612GRB2_FWD133210771O.lurida5/21/2015AACTTTGTCCACCCAGACGGJH2055
Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)
P62994aaaataggaactacacaacaacgcggaggtaaatatcagggtcaagatggaggcgatagcgaaacatgatttcagagcaactgctgatgatgaattaagcttttccaaaactaacattttaaagatcttgagcatggatgatgatcagaactggttcaaagctgagttagatggtaaagagggatacgtaccaaataattatatagaaatgaaaccacacccttggtttgctggaaagattcctcgattagaagcagaaagacgattattggagaaagactgtcgagggaactttgtccacccagacggggcattcctgctcaggaatagtgagagtgccccgggggaattctcaatatcagtaaagtttcaagaaaatatccagcattttaaagtattaagggatggagcagggaaatatttcctatgggttgtcaagttcaactctataaacgaactgatcgaatatcatcggatgtcatctgtcaatcgtggacagaccattgtactcaaagatatggcgactaacaggggaaagaaagcgtcggcaatgtacgaattcaaaccagaaaccgttggggagctagcactcagcagaggtgatatcataacagttctagaggaagtggactgcaactggtggaaaggagaacgcaacggcgaggaggggttgtttcctgctgcatatgtcaaaaagcttgattgacctgcaattgtgtcgcgaatcttgcttgtggaaaattagcttgaaaaaaaaatcgtttgtaatgtcatctttgatcgggacaagcttctcatcctgtctattctgatggattggtccagtatgtcagcgcagtgtttgatatatattggcactcacgaaaaaactactatttgttagccatagtgtgccagccttattacgtatacccatcttctaactgtgtaccacgggagaccttccgtcagtagtctcagaaaacgattctctttccaatcaactagttataaagattttttttttccaaaaagatcaaagatgtacacatgtatttgtataaatttcattttcatatatagatactcattgtacataactgaacattttgcagaagtatatatgtggcttaattcatatttttaagcatttctgtgcaagataataagaaagctcttcatttgaatagaagtagaataggaccataaggtacaggagagaaaacataacaatccaaaagaatcgtgtcctcaaatgtgagaacttgcaaattgcttggagattcaacaagaaaccatagacaccattaggagctgttggacgtaagcgcagtaacacttcagacactgttgaagctgcaagtagatctgatgacatgagaattatagatttgtgtgtataaccattttgaatttctatatcctggttctagaataatatacattctgttggaagttccatatactaattttcagttatggttatattgatgcttgaatggtctccttattcactaaatatcaaatgttctgcgtatatttttttaatgtgtacaaattttagatgtatgttttttgaagggattcttgcataatgatttgtactcagagactgaaatctgtatggaccggtttgcggtttagtaatttccaggcatagattacagaggctaatgatgagttattgattgaaatcgcaggttattgacatgtttatgttgatgttgatgtatggatatatatatttatatactataactacaatttcttgtgatcttgtttttgtactttcactttcattcttaaaaacaattgcatgactatcttcttggcatcaaacaagttttgaaaagacaaccgctttcacattctttctgcagtttgtgtggcaattttgtctgttaagctaatatgatgctttaaatttctgcgttcttcctctaaacacatatacttccaatgtcattatgctggtcaagacatttttgcacttaatagtaatataacttaacagtggcactggtggtatatgagttagtttctgagaaacagtgtgtcctctgccatattttatgaaatgttaacaagattgtcaatatgtcatgaataaatttagcaatttttaaaaaaaaaaaaaaacomp10127_c0_seq11611351Reference transcriptome Oly Transcriptome V3
70
1613Defensin_REV133210770O.lurida5/21/2015ATGGCTGTCGGAGGAGGATTJH2055Big defensinP80957gaacagagactgcaaaagacaagaaacaggccgcagcagccctgctccctctagcggagtttgttggggccaccgtgtcagcgccgttatttttggccctagtggcagcctacgggctatcagctgttctggctcaccacattacacaatcctcctccgacagccattcctgtgctaataatcggggctggtgccgatcgcaatgtttctctcacgaatacgttgatcactaccacagtattgtttgtgggttttacgtatgctgtagaccaggcaacomp10930_c0_seq11614118Reference transcriptome Oly Transcriptome V3
71
1614Defensin_FWD133210769O.lurida5/21/2015TCTAGCGGAGTTTGTTGGGGJH2055Big defensinP80957gaacagagactgcaaaagacaagaaacaggccgcagcagccctgctccctctagcggagtttgttggggccaccgtgtcagcgccgttatttttggccctagtggcagcctacgggctatcagctgttctggctcaccacattacacaatcctcctccgacagccattcctgtgctaataatcggggctggtgccgatcgcaatgtttctctcacgaatacgttgatcactaccacagtattgtttgtgggttttacgtatgctgtagaccaggcaacomp10930_c0_seq11613118Reference transcriptome Oly Transcriptome V3
72
1615THRa_REV133210768O.lurida5/21/2015GGGTGCCGAGTAAACAAGGAJH2055
Thyroid hormone receptor alpha (Nuclear receptor subfamily 1 group A member 1)
Q9W6N4agcagcaatcaattcagaaacaaacattcattagcaaatgtactgcagcagcaatcaaccacggaaagaaacatggacactggtttctaataaaaacaccaatggtaaaggtcttgattaaaaccgaaacaagtgtttgtggcatgaaaccaagggcgaaggcagtgctagctccaaaacacgtgaccactattttactgtaaaaagtaacaccggttcttgttaataaatacatcaacaatgttctatgtggaaagagagtattgcatctcaatcaacaaattctaagctccaaacgggtttgatagatttgtgttttggaactcttcttataaaaaaaaataaataaataaataacttgcagtttttgtcttaccaaaatcacttaacataatttacagagagatgcaaacgtttcacattaaggactcgtgggaaatggtttgttacatataataattactaacatacatgaacaaaataacaatgataaacatactattaatttagcagggccttatgtaagcgactaaatgaccggggcatcacttctcacgttcggtatatgacatcataatacgtttcacaaacttacaactaccatctatagttggtcaaatgaattaagaaggtctaacacatctccatattataacgttgacctcgttttgaaacactgaatgaaaatatgcatatttgcaatacttatataatccttaaaaatataattacacgtgtacttagccgagtgcgtaaccgagcccactactggtgtgtaaatctacaattcggatctaacagggcttctattcccaaactttctttcctccaaaattgtgtttttccactaaatggtaaacaagacagttttcaagtttaaaatagcattgtgcatatccttcatttctcaatccacagaagatttttcaggtgtgtcatccctccttaaaatacaggaccgcacgaaatgaaaatctcccatacagtgaataaaaaaatcgaccctgggctggtacggtatggaaggtagcatgtaaccatagtacaataacaaccaatatacaatatggaacagtaaaatgtttacaacaacgataacaattcattctctatggacctaacggggggagggggggggggcattgatcaacaacacaaaagacccgtaattcttcgtacacactcgggagatttctattttgtgcatggctacagtgagttacctacaatcctggatacattagcactaaccattagacactaccagctgcttgcactaacgtagacagcgaagttatacttcgtcaggatacagcgaaacaaatatgactggcaaaggtacaaaagaattccccactgttaccagtgctattcggctactaggatatatgttcatgttattatggcttctttcacaaatccaaatgctatggtacactttcccaatggcaattacctatggcaacagtagaccacggagaaccaaggtttcctactataacatcaaccattgaattactggggagacaatatattgtttaaaaacccttggatttcacgtatcggtatcaatactacaaattaaaatcttcagttatatacagcacctgtgaagtttaaaacactatgtcgaggtatatataaatatttttccatgtgaatcgtttcagctataatatgactgtccctcattaaacaaatccaatagctgcggaggaatatcaccttggtgatctagtcggatgcacaacacgcgctctgcatgacgggtactaatagtgcgcagatccgtcactttcatcagtatcttagcccagtgcactggttggtgtgggcgtttggtcgctatgtaacgtttaaatgctcccagaatggaatcctgaagtttttccacagcttccggttcctttaaacctgaacgatccgactgcatgagcaacacagaagcaagtaatgcgagctcagttttatccagttttagtttagaaaggccaacagcaaattcaaatattggttcaacaaggagacctaaaccttctgatttgagttgtgatttgtgtagacagacgccattatgcatggttatggtctctttttccggatcgtaccgacaggcggcacgcaaacacatgatctccatgcagcacgactttaatagcaggatctggtcgtccacgaacaattgaataaatcctggtacatttttggcaaattctacaactttgacaatagagggcgtcatggcttccgctaactgttgccaagcttcaggatctgaggggggtaagccatcttgggtagcagactctttcattggcactttgacaacagtttgttcataagctgacgtaacttccgctataatcgtcttgtctgtttctgtcagggtgtcatggttacacccttctgtcggctttggttttactttcatagtctcttgttttcttttttctctattgtcttctatcagtttccgtttggcttttctttgtttttcattcaaaacaagatccgttgccatgccaacgtttaagcattttctaaatctacactcttggcactggttacgagagtttttatcgatcgaacacattttattccacttgcagtgatattgaagattcttctgtattgtgcgacgaaagaagcccttgcagccttcacaggtcatacatcgataatggtatcctgtggccgcgtcaccacaaacaacacacggctctggtccattagtgaggtccatgtagctgggaatgtagggagtccctttcctcttgttggccgccgcaagatcccctccccccgcgtctgacgaagcctgtgacgatgaaggcgatggcgaggagttaaaagcactgatgggagaaggcatggatgagttgtccggactggacatggaaacagaggacagtccagcatacgatttggccccagcttcacagacactatcctcactcggcgatggtctctgtggcaacactgcataagatggagtaggtcctgttggcatcatggcagattgaaagtatggcaaaaatcctcgattcattccgtccacaaattcattctcctcactacctaactgaatgtccattgtgaaaaactaaatcgttcaaggtaaatgtgtagctgtttacactcacgaatgatatcactacctatccacacaatccgaaactgaccaactcaatgtccgttctcatcgatcgagagtttacgccattaataaacacacatgtaacattgttcattcgggttgaatttcaagggggtggtggtggggaatattctatatccttgtttactcggcaccccacatttgtgcgtctacgacatggtcaacaactatagaatgtgactagccgatgtgatgtaacgccccagcagttcaacgctggtcggatccactatagagcgaaggggaaatagcatttttcctgacctgatcattcctcgactttctgtcctgattccatgcaccatacagcctggtcactgttatcomp16251_c0_seq11616373Reference transcriptome Oly Transcriptome V3
73
1616THRa_FWD133210767O.lurida5/21/2015GACACTATCCTCACTCGGCGJH2055
Thyroid hormone receptor alpha (Nuclear receptor subfamily 1 group A member 1)
Q9W6N4agcagcaatcaattcagaaacaaacattcattagcaaatgtactgcagcagcaatcaaccacggaaagaaacatggacactggtttctaataaaaacaccaatggtaaaggtcttgattaaaaccgaaacaagtgtttgtggcatgaaaccaagggcgaaggcagtgctagctccaaaacacgtgaccactattttactgtaaaaagtaacaccggttcttgttaataaatacatcaacaatgttctatgtggaaagagagtattgcatctcaatcaacaaattctaagctccaaacgggtttgatagatttgtgttttggaactcttcttataaaaaaaaataaataaataaataacttgcagtttttgtcttaccaaaatcacttaacataatttacagagagatgcaaacgtttcacattaaggactcgtgggaaatggtttgttacatataataattactaacatacatgaacaaaataacaatgataaacatactattaatttagcagggccttatgtaagcgactaaatgaccggggcatcacttctcacgttcggtatatgacatcataatacgtttcacaaacttacaactaccatctatagttggtcaaatgaattaagaaggtctaacacatctccatattataacgttgacctcgttttgaaacactgaatgaaaatatgcatatttgcaatacttatataatccttaaaaatataattacacgtgtacttagccgagtgcgtaaccgagcccactactggtgtgtaaatctacaattcggatctaacagggcttctattcccaaactttctttcctccaaaattgtgtttttccactaaatggtaaacaagacagttttcaagtttaaaatagcattgtgcatatccttcatttctcaatccacagaagatttttcaggtgtgtcatccctccttaaaatacaggaccgcacgaaatgaaaatctcccatacagtgaataaaaaaatcgaccctgggctggtacggtatggaaggtagcatgtaaccatagtacaataacaaccaatatacaatatggaacagtaaaatgtttacaacaacgataacaattcattctctatggacctaacggggggagggggggggggcattgatcaacaacacaaaagacccgtaattcttcgtacacactcgggagatttctattttgtgcatggctacagtgagttacctacaatcctggatacattagcactaaccattagacactaccagctgcttgcactaacgtagacagcgaagttatacttcgtcaggatacagcgaaacaaatatgactggcaaaggtacaaaagaattccccactgttaccagtgctattcggctactaggatatatgttcatgttattatggcttctttcacaaatccaaatgctatggtacactttcccaatggcaattacctatggcaacagtagaccacggagaaccaaggtttcctactataacatcaaccattgaattactggggagacaatatattgtttaaaaacccttggatttcacgtatcggtatcaatactacaaattaaaatcttcagttatatacagcacctgtgaagtttaaaacactatgtcgaggtatatataaatatttttccatgtgaatcgtttcagctataatatgactgtccctcattaaacaaatccaatagctgcggaggaatatcaccttggtgatctagtcggatgcacaacacgcgctctgcatgacgggtactaatagtgcgcagatccgtcactttcatcagtatcttagcccagtgcactggttggtgtgggcgtttggtcgctatgtaacgtttaaatgctcccagaatggaatcctgaagtttttccacagcttccggttcctttaaacctgaacgatccgactgcatgagcaacacagaagcaagtaatgcgagctcagttttatccagttttagtttagaaaggccaacagcaaattcaaatattggttcaacaaggagacctaaaccttctgatttgagttgtgatttgtgtagacagacgccattatgcatggttatggtctctttttccggatcgtaccgacaggcggcacgcaaacacatgatctccatgcagcacgactttaatagcaggatctggtcgtccacgaacaattgaataaatcctggtacatttttggcaaattctacaactttgacaatagagggcgtcatggcttccgctaactgttgccaagcttcaggatctgaggggggtaagccatcttgggtagcagactctttcattggcactttgacaacagtttgttcataagctgacgtaacttccgctataatcgtcttgtctgtttctgtcagggtgtcatggttacacccttctgtcggctttggttttactttcatagtctcttgttttcttttttctctattgtcttctatcagtttccgtttggcttttctttgtttttcattcaaaacaagatccgttgccatgccaacgtttaagcattttctaaatctacactcttggcactggttacgagagtttttatcgatcgaacacattttattccacttgcagtgatattgaagattcttctgtattgtgcgacgaaagaagcccttgcagccttcacaggtcatacatcgataatggtatcctgtggccgcgtcaccacaaacaacacacggctctggtccattagtgaggtccatgtagctgggaatgtagggagtccctttcctcttgttggccgccgcaagatcccctccccccgcgtctgacgaagcctgtgacgatgaaggcgatggcgaggagttaaaagcactgatgggagaaggcatggatgagttgtccggactggacatggaaacagaggacagtccagcatacgatttggccccagcttcacagacactatcctcactcggcgatggtctctgtggcaacactgcataagatggagtaggtcctgttggcatcatggcagattgaaagtatggcaaaaatcctcgattcattccgtccacaaattcattctcctcactacctaactgaatgtccattgtgaaaaactaaatcgttcaaggtaaatgtgtagctgtttacactcacgaatgatatcactacctatccacacaatccgaaactgaccaactcaatgtccgttctcatcgatcgagagtttacgccattaataaacacacatgtaacattgttcattcgggttgaatttcaagggggtggtggtggggaatattctatatccttgtttactcggcaccccacatttgtgcgtctacgacatggtcaacaactatagaatgtgactagccgatgtgatgtaacgccccagcagttcaacgctggtcggatccactatagagcgaaggggaaatagcatttttcctgacctgatcattcctcgactttctgtcctgattccatgcaccatacagcctggtcactgttatcomp16251_c0_seq11615373Reference transcriptome Oly Transcriptome V3
74
1617HSP70d_REV133210766O.lurida5/21/2015GACATGAGACCAAAGACGCCJH2055
Heat shock 70 kDa protein 6 (Heat shock 70 kDa protein B')
P17066gaatatcaaaacgtttcgctctttctttgtctcaccggctttgtgcttgtctaacccataagcaattgcagcggctgttggctcgttgattattctgagcacgttgatgcctgcaactttggcggcgtctttggtctcatgtctctgggagtcgttgaaatatgcagggactgtgataacagctcctcctattttctgaccgaggtagtcctctgctgtctcomp16752_c2_seq11618118Reference transcriptome Oly Transcriptome V3
75
1618HSP70d_FWD133210765O.lurida5/21/2015TTTGTCTCACCGGCTTTGTGJH2055
Heat shock 70 kDa protein 6 (Heat shock 70 kDa protein B')
P17066gaatatcaaaacgtttcgctctttctttgtctcaccggctttgtgcttgtctaacccataagcaattgcagcggctgttggctcgttgattattctgagcacgttgatgcctgcaactttggcggcgtctttggtctcatgtctctgggagtcgttgaaatatgcagggactgtgataacagctcctcctattttctgaccgaggtagtcctctgctgtctcomp16752_c2_seq11617118Reference transcriptome Oly Transcriptome V3
76
1619GABABR1_REV133210764O.lurida5/21/2015CGGACAGGTTCTGGATTCCGJH2055
Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
Q9WV18atttagacagttgcgtacctttgatcttgaggatcccgccaacaccgaggaggacacgaaactccgcccacagctggaactttgtgttgcgaaacacatggcaatttggcttggtatcacccttggtttcaatgggatcattctgctgtttggtatatttctaaccttcgaaacaagaaaagtgaaattagaaaattataacgactcccgattcgttggaatggcaatctacaatattacggtgcttggttccattacagtaccattatgcctcatcatcagcaagcaacatgtagcaaactttatctttgtggcaggttgcatccttctctcttgctatttgtcaatgggtcttctgtttcttccaaagatattacatgtattgcggaatccagaacctgtccgagatgaaagatttctagatgatttcgggaccccaaggggagaggtggacactatccatcagagacttatacgtgaaaatgaagatttgaaaagacgtatacagatgatggagaacagagtggcattgttgaataaacaactgataaataaatcgtataaaagagtttatctatcagctggtcatcaggagtgtggtgcacataaaagcagctgattgacttaattaattcggcgtttcacomp19002_c0_seq11620361Reference transcriptome Oly Transcriptome V3
77
1620GABABR1_FWD133210763O.lurida5/21/2015CCGAGGAGGACACGAAACTCJH2055
Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
Q9WV18atttagacagttgcgtacctttgatcttgaggatcccgccaacaccgaggaggacacgaaactccgcccacagctggaactttgtgttgcgaaacacatggcaatttggcttggtatcacccttggtttcaatgggatcattctgctgtttggtatatttctaaccttcgaaacaagaaaagtgaaattagaaaattataacgactcccgattcgttggaatggcaatctacaatattacggtgcttggttccattacagtaccattatgcctcatcatcagcaagcaacatgtagcaaactttatctttgtggcaggttgcatccttctctcttgctatttgtcaatgggtcttctgtttcttccaaagatattacatgtattgcggaatccagaacctgtccgagatgaaagatttctagatgatttcgggaccccaaggggagaggtggacactatccatcagagacttatacgtgaaaatgaagatttgaaaagacgtatacagatgatggagaacagagtggcattgttgaataaacaactgataaataaatcgtataaaagagtttatctatcagctggtcatcaggagtgtggtgcacataaaagcagctgattgacttaattaattcggcgtttcacomp19002_c0_seq11619361Reference transcriptome Oly Transcriptome V3
78
1621CerS2_REV133210762O.lurida5/21/2015CCGTCTTCTGAGCCATCGTTJH2055
Ceramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2)
Q3ZBF8tggagatgatatggagcgagaagttttggtttcccgagggcgtgacatgggcagagttacagaatgtgaacccaaaggtgtacctcccacagattgaagatatcggatttttatccatatttgtcggtctcctcctgctaatcacacgatttctgacggagaggttgttagtgatacctttggctaagtgcttgggagttaaagttagaaaacatctgcatcttgcaaaagttccggagttagagcagctttacaagtcaaagaaaactgatgtcaaatctatcagggaggttgtgaaaaagacggatttatctgaacgtcaggttgaacgatggctcagaagacgggtcaagttagacacgccaagcaccatgcaaaaattcaccgagtgcagctaccatttcttattctactgtgcgatgtttttctatgggctttacatactctgggataaatcttggttctggcomp20292_c2_seq11622227Reference transcriptome Oly Transcriptome V3
79
1622CerS2_FWD133210761O.lurida5/21/2015TTGTCGGTCTCCTCCTGCTAJH2055
Ceramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2)
Q3ZBF8tggagatgatatggagcgagaagttttggtttcccgagggcgtgacatgggcagagttacagaatgtgaacccaaaggtgtacctcccacagattgaagatatcggatttttatccatatttgtcggtctcctcctgctaatcacacgatttctgacggagaggttgttagtgatacctttggctaagtgcttgggagttaaagttagaaaacatctgcatcttgcaaaagttccggagttagagcagctttacaagtcaaagaaaactgatgtcaaatctatcagggaggttgtgaaaaagacggatttatctgaacgtcaggttgaacgatggctcagaagacgggtcaagttagacacgccaagcaccatgcaaaaattcaccgagtgcagctaccatttcttattctactgtgcgatgtttttctatgggctttacatactctgggataaatcttggttctggcomp20292_c2_seq11621227Reference transcriptome Oly Transcriptome V3
80
1623p29ING4_REV133210760O.lurida5/21/2015GTCCATCACACACCCCTCAGJH2055Inhibitor of growth protein 4 (p29ING4)Q8C0D7tatctgatagctcgtgtagaaggaaaagtgttcacaagctattttacatcctccacccctctgggatccaccataacattaaagaaaattattggatcctcctgcctcaacaatatatgcacatctacaaatggttatgaaacactgcacaaagtttcaagtttatcctataagtcattaaggaggagaagacatacttttctaaagtatggccttgttagaaggtatacacatatgaaatatgaaagccctagcattgaacattcaaaataaatggccaaggttaaagtttttgtagacaaaatctccaatgcaatttattaagaaaggaatcggtttaaatgccatttgttttcagtgacaatgtacagtggttcatctgataatgatcaaattaactgactgcttccaatattcatacctctcagatctaaagaaaacagtattgtttaatacatttcttaataacatctaattctgccatcaaaagcttgatctttgatcaagtgttggtaacaaataaatagaataagttatcaagttacatggatatgtggacacacatgcactccttgtcaactcccctttttctgaagatgttcagtctgagtcggtgtaagaacgagacttacaatcactatacaattttttatttccaattcagttttgcatgcactctgatgttgatccatttcattttttctttctttcttctgtgcatcgtggacagaaccatttacctttgggcttcaccgtcaacccaacacaagcgaagtggaaccactcaatggggcaatccgggttatcacagccaatcatttcgccataagacacttggtgacaaagacagtaggttggttcattgggatcaacaggcatgtccagaacatctgaggggtgtgtgatggacaatgtcgacaagattggtattgatgataccacctcttctggaggactttgctggcctttcttctttttctttttgggaatttcatcatcatattcttcctttttccttttctttttgtctttatctttgttctttttgcctgaatctgagtctgctttgagcttagcagctgagctcttgtctttcagatctgcttcaaaccttgccaagtcagcatctagctttcgtatatgtttgtcaaccatttcatatgtctgcatggctagctgtactttgtcatcaccatattccctgcttttggagaatttgccttctatagttgttagtttttgggaccgtttctctgatgacattcctctgacattttttaagtattcttcagataagtggtcaatgtctttcaaaagatcttgagtgcgctggtctaaatctctcataaggttgaagtttctttgcaactctgtgggcaatgtttcaagactgtccaagtagtgttccaagtacattgctgtcgccatatttgctgtttaagaggcomp22144_c0_seq11624173Reference transcriptome Oly Transcriptome V3
81
1624p29ING4_FWD133210759O.lurida5/21/2015TACCTTTGGGCTTCACCGTCJH2055Inhibitor of growth protein 4 (p29ING4)Q8C0D7tatctgatagctcgtgtagaaggaaaagtgttcacaagctattttacatcctccacccctctgggatccaccataacattaaagaaaattattggatcctcctgcctcaacaatatatgcacatctacaaatggttatgaaacactgcacaaagtttcaagtttatcctataagtcattaaggaggagaagacatacttttctaaagtatggccttgttagaaggtatacacatatgaaatatgaaagccctagcattgaacattcaaaataaatggccaaggttaaagtttttgtagacaaaatctccaatgcaatttattaagaaaggaatcggtttaaatgccatttgttttcagtgacaatgtacagtggttcatctgataatgatcaaattaactgactgcttccaatattcatacctctcagatctaaagaaaacagtattgtttaatacatttcttaataacatctaattctgccatcaaaagcttgatctttgatcaagtgttggtaacaaataaatagaataagttatcaagttacatggatatgtggacacacatgcactccttgtcaactcccctttttctgaagatgttcagtctgagtcggtgtaagaacgagacttacaatcactatacaattttttatttccaattcagttttgcatgcactctgatgttgatccatttcattttttctttctttcttctgtgcatcgtggacagaaccatttacctttgggcttcaccgtcaacccaacacaagcgaagtggaaccactcaatggggcaatccgggttatcacagccaatcatttcgccataagacacttggtgacaaagacagtaggttggttcattgggatcaacaggcatgtccagaacatctgaggggtgtgtgatggacaatgtcgacaagattggtattgatgataccacctcttctggaggactttgctggcctttcttctttttctttttgggaatttcatcatcatattcttcctttttccttttctttttgtctttatctttgttctttttgcctgaatctgagtctgctttgagcttagcagctgagctcttgtctttcagatctgcttcaaaccttgccaagtcagcatctagctttcgtatatgtttgtcaaccatttcatatgtctgcatggctagctgtactttgtcatcaccatattccctgcttttggagaatttgccttctatagttgttagtttttgggaccgtttctctgatgacattcctctgacattttttaagtattcttcagataagtggtcaatgtctttcaaaagatcttgagtgcgctggtctaaatctctcataaggttgaagtttctttgcaactctgtgggcaatgtttcaagactgtccaagtagtgttccaagtacattgctgtcgccatatttgctgtttaagaggcomp22144_c0_seq11623173Reference transcriptome Oly Transcriptome V3
82
1625HSP70c_REV133210758O.lurida5/21/2015ACCTCGGACTTTGGACGAACJH2055Heat shock 70 kDa protein 12AQ8K0U4gatcgccgtatgcgcatgtttgtttatttcgacaagcgacagcgacgtccacggtccagaactttgtctagaccaggcctatatacatttacacagagtgattatatgtgactggtattaagcatactacaatggcatgcgcacaagaggaccgccttatgacggccgccatagattttggcacgacatactcaggatactgcttctcgtttcgacatgatttcgagactgaccctctcaaagtgtcagccaacacgtggaccgcaggcactgcaggtcttgtgtccctaaaaacgcccaccactgttctcctggacggagatggaaaattagtgacgtttggttatgaagcagaagatcgctactcggagcttgcagacgatgacgaacatggcgactattattatttcagacggtttaagatgacacttttcaattcttcatcaagactaactagggataccatgttaaaagacataaccggaggaaaacagatgaaagccatcacggtttttgctcatgccatccggtacttaaaagaccacatgctgaaaaccctggatcagcgtggagccggaatcaaagccagggacatcaactgggtgctgacggttcccgccatctgggacgatcccgcgaaacagttcatgcgtgaagccgcagaggaggcaggtataaatcgagcgcagctgatgatttccctggaacccgaggcagcctcgctgttctgtaaatatctacctatagagaagttacagggcgtagataaaggaatcggcgcattcaaaccgggtagccgatacctcgtcttggatgctggaggtggcacggtcgacatcacagtccatgaggttcagttcaacggaactctgaaggaattggataaggccagtggtggcgcatggggaggtactcgagtcgatgaatccttcaaggaaatgctggaagaaattgtgggagcgggaatgctcgaggagtttgccttgtcacacacagcagactacatagatttgttccgagatttcgagacaaaaaagcgcaatgtgaaagacgacgccccaggaaagatcacaattcgtattccgataagtctgcaagagttgtacgaggaaaggtcgggagaggaaattaaaaagaaaattcgccagacgaaatacaaagatgatctcacttgggtcggcgatcgtctgcgcattaacaagccatgttttgtaaacttgttttctgcagcctgtgatggtatggtggatcacgtaaagaaattgttacgttcgtccaaagtccgaggtacaaataacatcctcatggttgggggtttttcagaatcccccttactacagaaaagaattcgtgatgaatttagtgattgtcgaataattattccacaagaagcagggttagccgtccttaaaggtgccgtcatatttggtcatcaaccagcaaccatcgcggcacgtgtagctagatgcacgtatggtatagaaaccaacacgtcctttgatgctagaaaacatcctcagtcaaagaaaaaagtggtagaaggcaaggagaaatgtaaagaagtgtttgacaggcacgtgtccattggacaagtgttggaagtagacgaagttcaaagtgaaaaaagctactggcctctctattcaaaccaaaccaaagtatcgctaccggtatattcatcctcaatggacaacccggacttcgtggacgaggctggatgtagttatctaggaaagctcacagtggatatcccgcaatacggttccgacaaagaagtgtcgacaaatttcatctttggtggtactgaactaaaagtgcaagctattgtgaaaagcacaggggaagttaccactgccaattttgactttttggaaggagacagttaagacctttcgatatgaattctactaatttttaagacatgtatatcaatatttaaaaatgatgcagcagtcataatgatagtcacagcaaatatgtaaacaacaccgctgattatcaaattacacttatttgtaaataggaaatgtaggatagtgtgtgtaatcttattaatataatacgagtaaaaacacomp22403_c0_seq11626182Reference transcriptome Oly Transcriptome V3
83
1626HSP70c_FWD133210757O.lurida5/21/2015AGGAAAGGTCGGGAGAGGAAJH2055Heat shock 70 kDa protein 12AQ8K0U4gatcgccgtatgcgcatgtttgtttatttcgacaagcgacagcgacgtccacggtccagaactttgtctagaccaggcctatatacatttacacagagtgattatatgtgactggtattaagcatactacaatggcatgcgcacaagaggaccgccttatgacggccgccatagattttggcacgacatactcaggatactgcttctcgtttcgacatgatttcgagactgaccctctcaaagtgtcagccaacacgtggaccgcaggcactgcaggtcttgtgtccctaaaaacgcccaccactgttctcctggacggagatggaaaattagtgacgtttggttatgaagcagaagatcgctactcggagcttgcagacgatgacgaacatggcgactattattatttcagacggtttaagatgacacttttcaattcttcatcaagactaactagggataccatgttaaaagacataaccggaggaaaacagatgaaagccatcacggtttttgctcatgccatccggtacttaaaagaccacatgctgaaaaccctggatcagcgtggagccggaatcaaagccagggacatcaactgggtgctgacggttcccgccatctgggacgatcccgcgaaacagttcatgcgtgaagccgcagaggaggcaggtataaatcgagcgcagctgatgatttccctggaacccgaggcagcctcgctgttctgtaaatatctacctatagagaagttacagggcgtagataaaggaatcggcgcattcaaaccgggtagccgatacctcgtcttggatgctggaggtggcacggtcgacatcacagtccatgaggttcagttcaacggaactctgaaggaattggataaggccagtggtggcgcatggggaggtactcgagtcgatgaatccttcaaggaaatgctggaagaaattgtgggagcgggaatgctcgaggagtttgccttgtcacacacagcagactacatagatttgttccgagatttcgagacaaaaaagcgcaatgtgaaagacgacgccccaggaaagatcacaattcgtattccgataagtctgcaagagttgtacgaggaaaggtcgggagaggaaattaaaaagaaaattcgccagacgaaatacaaagatgatctcacttgggtcggcgatcgtctgcgcattaacaagccatgttttgtaaacttgttttctgcagcctgtgatggtatggtggatcacgtaaagaaattgttacgttcgtccaaagtccgaggtacaaataacatcctcatggttgggggtttttcagaatcccccttactacagaaaagaattcgtgatgaatttagtgattgtcgaataattattccacaagaagcagggttagccgtccttaaaggtgccgtcatatttggtcatcaaccagcaaccatcgcggcacgtgtagctagatgcacgtatggtatagaaaccaacacgtcctttgatgctagaaaacatcctcagtcaaagaaaaaagtggtagaaggcaaggagaaatgtaaagaagtgtttgacaggcacgtgtccattggacaagtgttggaagtagacgaagttcaaagtgaaaaaagctactggcctctctattcaaaccaaaccaaagtatcgctaccggtatattcatcctcaatggacaacccggacttcgtggacgaggctggatgtagttatctaggaaagctcacagtggatatcccgcaatacggttccgacaaagaagtgtcgacaaatttcatctttggtggtactgaactaaaagtgcaagctattgtgaaaagcacaggggaagttaccactgccaattttgactttttggaaggagacagttaagacctttcgatatgaattctactaatttttaagacatgtatatcaatatttaaaaatgatgcagcagtcataatgatagtcacagcaaatatgtaaacaacaccgctgattatcaaattacacttatttgtaaataggaaatgtaggatagtgtgtgtaatcttattaatataatacgagtaaaaacacomp22403_c0_seq11625182Reference transcriptome Oly Transcriptome V3
84
1627GDF-8b_REV133210756O.lurida5/21/2015TGTTCTTCCACCCACCACTGJH2055Growth/differentiation factor 8 (GDF-8) (Myostatin)Q8AVB2cctttgtttggtttaaccagattttaaaaagccctgatttcatttttgaaatcagatgggtgttgtgaacatagatctttctagtctgatctatgacgaatgacctcaacagtttagtcggtgtcatattcaacaaactgaaagactcccagccttgtggatctttgatccagccacactacaaacgaaaacaaacgcgaccattttctccctctatccttttctctcgccatcttttgcctttaagagcaaccacaccgcacgactcgcattctcggtaatgttgttaactgtaatctagaagtatggtcaaagtacagcattcttaagtttgccattctaacgggtgaacaacaaggaccaggattatttccgatcattcttgactcgggaacctgttgtacaactgacgaatgtccgtggttactaagagcctcgtttcgacattctcccgcgcagtagtaggcgtcataccatttgggtgcaatgacgaaatcccaaccgaattctatgaagctaacggttaaaggatatcgacagcaagcctcaaactgattctgctcgtcgcacgtcaaagctgtcgatcgttttcgacgaacgtgggctgtggttgtcgtacgtaaatccaagttaggttcatatccttcgtttattccagtggtgggtggaagaacaattaaattttcattattagcatcgaacgcctccaccaccagccccaagttagtagaaggatccgaagcccacttatgggccaaaccagtaatatcaaaacomp23265_c1_seq11628126Reference transcriptome Oly Transcriptome V3
85
1628GDF-8b_FWD133210755O.lurida5/21/2015AACTGATTCTGCTCGTCGCAJH2055Growth/differentiation factor 8 (GDF-8) (Myostatin)Q8AVB2cctttgtttggtttaaccagattttaaaaagccctgatttcatttttgaaatcagatgggtgttgtgaacatagatctttctagtctgatctatgacgaatgacctcaacagtttagtcggtgtcatattcaacaaactgaaagactcccagccttgtggatctttgatccagccacactacaaacgaaaacaaacgcgaccattttctccctctatccttttctctcgccatcttttgcctttaagagcaaccacaccgcacgactcgcattctcggtaatgttgttaactgtaatctagaagtatggtcaaagtacagcattcttaagtttgccattctaacgggtgaacaacaaggaccaggattatttccgatcattcttgactcgggaacctgttgtacaactgacgaatgtccgtggttactaagagcctcgtttcgacattctcccgcgcagtagtaggcgtcataccatttgggtgcaatgacgaaatcccaaccgaattctatgaagctaacggttaaaggatatcgacagcaagcctcaaactgattctgctcgtcgcacgtcaaagctgtcgatcgttttcgacgaacgtgggctgtggttgtcgtacgtaaatccaagttaggttcatatccttcgtttattccagtggtgggtggaagaacaattaaattttcattattagcatcgaacgcctccaccaccagccccaagttagtagaaggatccgaagcccacttatgggccaaaccagtaatatcaaaacomp23265_c1_seq11627126Reference transcriptome Oly Transcriptome V3
86
1629TLR2.1_REV133210754O.lurida5/21/2015ACACCAACGACAGGAAGTGGJH2055Toll-like receptor 2 type-1Q9DD78tcaaaacagattttggagtgtaacgtctttaaaaattactaatacagcaacaatgaaatcattttgccatgaattgcttcacgatttgccagaacagcttctggccatttctattcattgtccactctacatgagatgctgacttgagaagcaccttcagagattgattaatatgttcagaacgaatatcttgtaatatgatcagcaatagcttgtcaccgcctccgtcagccaaagtgtggttggcaatggcggcttcgtacttacaccattgatcgtccaagaaattattggacagcaccaaaatgaattttctgctgacttcaatgctttccagaaagtcatccacaaagattccacccggcaagatatctctctcgtgcaaacaaagcttgtacttgtttctctctaccatctgaacaagttcagacattatccacttcctgtcgttggtgttgtaagcaacaaaaccatcatagaggaattcatcatctgtaaatcttttataccccatgggttttctgtttttgcatgtgtatatataatacttaatgtcccaacgaaactttctcaacagaacaatggtcaaaatcaccaaggacactaatgcaaacgaagcgcatactagaatgacataggggcttattttgtgacattcggacgcaggatcaaagtgtgttatactttttcctttcaagtctgacggggaagcacagatgtattgatgaggatatccaacagtcctattttggttgttttcaacccagagtcggaaccattccagttggcatccacagtccaatggattcaaggacacatcaattcgaaaatcttttttcttccaaaggaaagcaggcagagaagattcattgatactgctcaaacgattgccacgaaaaatcaattcattcaatctagtcaaattttgaacaccgctctttcgaatttctgttattcggttaacactgtagtcaacggacgttagctgtgaaaaatcagtcagtgtagtcatttgatcgatttcgccattaacaatagccaaaactgacagatcctttagaggtgatagcatctctgcaacatcagtgttggatagatcggtgttcattattttcaatgcttttatatttctacattcagaaaagatgtatttgaagcctcctacgcttttttccaccatacgtccgatagagagtgttcggagggaattggatgataatgacctaccatctaaagcgactccatgcaagttatcaatgatcaaagtttgcaaacgattcatattcaaaaaggaatacaaggaaatgtcatgaattgatgtgtgtgaaacattaaaaaattcaagggatttcaggcagtagccctcttgtatgaaatttgttgtttcccgaataccattcactgccaggtgcaattgttgcaagtttgggaaggcggctatacgtttctcattggataaacaaaactcgggaatcttctcaaaagaattgttagtaaaatacagttcttttaaagaaggaactgagctatttggcaatttataccttgagattaggttgcttcctaaatcgattttgtggatattgattaatttagcgaaggatttaaaagcomp23747_c0_seq11630109Reference transcriptome Oly Transcriptome V3
87
1630TLR2.1_FWD133210753O.lurida5/21/2015ACAAAGATTCCACCCGGCAAJH2055Toll-like receptor 2 type-1Q9DD78tcaaaacagattttggagtgtaacgtctttaaaaattactaatacagcaacaatgaaatcattttgccatgaattgcttcacgatttgccagaacagcttctggccatttctattcattgtccactctacatgagatgctgacttgagaagcaccttcagagattgattaatatgttcagaacgaatatcttgtaatatgatcagcaatagcttgtcaccgcctccgtcagccaaagtgtggttggcaatggcggcttcgtacttacaccattgatcgtccaagaaattattggacagcaccaaaatgaattttctgctgacttcaatgctttccagaaagtcatccacaaagattccacccggcaagatatctctctcgtgcaaacaaagcttgtacttgtttctctctaccatctgaacaagttcagacattatccacttcctgtcgttggtgttgtaagcaacaaaaccatcatagaggaattcatcatctgtaaatcttttataccccatgggttttctgtttttgcatgtgtatatataatacttaatgtcccaacgaaactttctcaacagaacaatggtcaaaatcaccaaggacactaatgcaaacgaagcgcatactagaatgacataggggcttattttgtgacattcggacgcaggatcaaagtgtgttatactttttcctttcaagtctgacggggaagcacagatgtattgatgaggatatccaacagtcctattttggttgttttcaacccagagtcggaaccattccagttggcatccacagtccaatggattcaaggacacatcaattcgaaaatcttttttcttccaaaggaaagcaggcagagaagattcattgatactgctcaaacgattgccacgaaaaatcaattcattcaatctagtcaaattttgaacaccgctctttcgaatttctgttattcggttaacactgtagtcaacggacgttagctgtgaaaaatcagtcagtgtagtcatttgatcgatttcgccattaacaatagccaaaactgacagatcctttagaggtgatagcatctctgcaacatcagtgttggatagatcggtgttcattattttcaatgcttttatatttctacattcagaaaagatgtatttgaagcctcctacgcttttttccaccatacgtccgatagagagtgttcggagggaattggatgataatgacctaccatctaaagcgactccatgcaagttatcaatgatcaaagtttgcaaacgattcatattcaaaaaggaatacaaggaaatgtcatgaattgatgtgtgtgaaacattaaaaaattcaagggatttcaggcagtagccctcttgtatgaaatttgttgtttcccgaataccattcactgccaggtgcaattgttgcaagtttgggaaggcggctatacgtttctcattggataaacaaaactcgggaatcttctcaaaagaattgttagtaaaatacagttcttttaaagaaggaactgagctatttggcaatttataccttgagattaggttgcttcctaaatcgattttgtggatattgattaatttagcgaaggatttaaaagcomp23747_c0_seq11629109Reference transcriptome Oly Transcriptome V3
88
1631PGRP-S_REV133210752O.lurida5/21/2015AACTGGTTTGCCCGACATCAJH2055
Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)
O75594gtgaacgtatataaacgaacttcatttactcggctttaacagtggtatcagagcaaagtctgaagtttgtattgagtttcagcatgaaagcgattgccgcttctttccttcctgtatttctattgttcttggccaattcaaatgccgaggaatgcgcatgtgccactaccaacgttcacgtcagatccggtgctggtgtaggtcacggaattctgggaactttaagcacagattcttgcctcgccttcaaaggtcacctgacttctgtcaatggagctcattgggccaacgtagactataacggacaggatggttggatctcatctacctacctcgcattcaaaccatgctcgttatcaggatctcataacagcggcgcaggcacgcattctacttccggctgtcccccgatcgtaagtcgaagtgaatggcatgcgcgtgcgcctaagcatcacattggtcctcttccggcagtgcccggaaacgtatacattcaccatggcgccacgcacggctgtttcacaaaggcagactgcatcaagctggtgcagtcctatcagaattaccatatggacacccacggttggccagatatcggatacagcttcatcattggagaagacggaaatatctatgaggggcggggctggaacactataggggcgcatacatataaccacaattatgatggtctaggattctgcgtcatgggagacttcacctcgcaccaaccaaacgccctagctataaacgcagtgaagagcctgattagctgcggagtaaacagcggaaggataactcataactacgtgttgaaaggtcaccgtgatgtcgggcaaaccagttgtccaggggacaaattctatgcccttatcaagacatggccgcattatcatcattgagggattttcactgaagaccctatgattgtacaatgtaatttataaagcaatcaatgacacatttgctcttcattacttttcatacacagcomp24065_c0_seq11632135Reference transcriptome Oly Transcriptome V3
89
1632PGRP-S_FWD133210751O.lurida5/21/2015GAGACTTCACCTCGCACCAAJH2055
Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)
O75594gtgaacgtatataaacgaacttcatttactcggctttaacagtggtatcagagcaaagtctgaagtttgtattgagtttcagcatgaaagcgattgccgcttctttccttcctgtatttctattgttcttggccaattcaaatgccgaggaatgcgcatgtgccactaccaacgttcacgtcagatccggtgctggtgtaggtcacggaattctgggaactttaagcacagattcttgcctcgccttcaaaggtcacctgacttctgtcaatggagctcattgggccaacgtagactataacggacaggatggttggatctcatctacctacctcgcattcaaaccatgctcgttatcaggatctcataacagcggcgcaggcacgcattctacttccggctgtcccccgatcgtaagtcgaagtgaatggcatgcgcgtgcgcctaagcatcacattggtcctcttccggcagtgcccggaaacgtatacattcaccatggcgccacgcacggctgtttcacaaaggcagactgcatcaagctggtgcagtcctatcagaattaccatatggacacccacggttggccagatatcggatacagcttcatcattggagaagacggaaatatctatgaggggcggggctggaacactataggggcgcatacatataaccacaattatgatggtctaggattctgcgtcatgggagacttcacctcgcaccaaccaaacgccctagctataaacgcagtgaagagcctgattagctgcggagtaaacagcggaaggataactcataactacgtgttgaaaggtcaccgtgatgtcgggcaaaccagttgtccaggggacaaattctatgcccttatcaagacatggccgcattatcatcattgagggattttcactgaagaccctatgattgtacaatgtaatttataaagcaatcaatgacacatttgctcttcattacttttcatacacagcomp24065_c0_seq11631135Reference transcriptome Oly Transcriptome V3
90
1633NFKBina_REV133210750O.lurida5/21/2015CGAGGAGAACCTTGTGCAGTJH2055
NF-kappa-B inhibitor alpha (I-kappa-B-alpha) (IkB-alpha) (IkappaBalpha) (REL-associated protein pp40)
Q91974gtaaattctatttcaccgtttccataaaatcggccaatggatcctaaaggaatagatacccacatcaataagctctcccatcttaatttggaaactgatggcggtgcatgtgttagcgaaagtaatagatatcaagaagaagcatatgattcagcgtatttttctgcttctttatctgagtttccttccactgagtccacaattaaaacagaaatcttaccacaagatcattatcccgtaccatccatcatttgctctccacatgtaagtgctcaggccacagaaactgcacaagccacagaaactgcacaaggttctcctcggtcttctcttcaactgcagacttcacgatgtcactttataccctatgttacgacacaagaaagaaactttcagaatatcaaaatttcggatccaaatgttcaaaaaatgatacatgctgacaaagacggcgatacacagctccatatggcgatcatcgaaaaccatgtttctgttgcaatttacataatacggtgtctggccgctgtagatgtcaatcttctgaaccatcaaaataacttacttgaaacacctctctggttggccatttacgaacaacaattagatgttgttgagatgttgattagaagtggcgcagatgttactgctgcagatagaaatggcgatactccgttgcatgttgcctgtaaatatggacgagatgaagcccttgatattcttcttcaaaatacaaaagcaacaactgtcaggcattgcctatctcttccaaattacggtggacaaacatgtctccatttagctgcagacagaatgcatttttctgtcataagacttctgtttagatatggaatggacgtaaatgaaaaagagaaagttcacggaatgacaattttacacaaggctgcaaaattagggaataaggtattgttagaattcattttgaatttacagggattagatttgaacacagaaacttatgctgggtatacccctattttgttagcttactttgaaggtcattttgatatcgttcttttactcaaacaagagggttgcgattttcaagatctgtcttagcaatgtgcaatgttttgcttttcactggaaatattacgtatttctatttgaatggctcggtaggagggaagttctttgggtaacaccgaaagacagagtgaaaagaagtatgtctattttgatatgctgccacttgaattgtaatcomp24195_c0_seq11634227Reference transcriptome Oly Transcriptome V3
91
1634NFKBina_FWD133210749O.lurida5/21/2015GATGGCGGTGCATGTGTTAGJH2055
NF-kappa-B inhibitor alpha (I-kappa-B-alpha) (IkB-alpha) (IkappaBalpha) (REL-associated protein pp40)
Q91974gtaaattctatttcaccgtttccataaaatcggccaatggatcctaaaggaatagatacccacatcaataagctctcccatcttaatttggaaactgatggcggtgcatgtgttagcgaaagtaatagatatcaagaagaagcatatgattcagcgtatttttctgcttctttatctgagtttccttccactgagtccacaattaaaacagaaatcttaccacaagatcattatcccgtaccatccatcatttgctctccacatgtaagtgctcaggccacagaaactgcacaagccacagaaactgcacaaggttctcctcggtcttctcttcaactgcagacttcacgatgtcactttataccctatgttacgacacaagaaagaaactttcagaatatcaaaatttcggatccaaatgttcaaaaaatgatacatgctgacaaagacggcgatacacagctccatatggcgatcatcgaaaaccatgtttctgttgcaatttacataatacggtgtctggccgctgtagatgtcaatcttctgaaccatcaaaataacttacttgaaacacctctctggttggccatttacgaacaacaattagatgttgttgagatgttgattagaagtggcgcagatgttactgctgcagatagaaatggcgatactccgttgcatgttgcctgtaaatatggacgagatgaagcccttgatattcttcttcaaaatacaaaagcaacaactgtcaggcattgcctatctcttccaaattacggtggacaaacatgtctccatttagctgcagacagaatgcatttttctgtcataagacttctgtttagatatggaatggacgtaaatgaaaaagagaaagttcacggaatgacaattttacacaaggctgcaaaattagggaataaggtattgttagaattcattttgaatttacagggattagatttgaacacagaaacttatgctgggtatacccctattttgttagcttactttgaaggtcattttgatatcgttcttttactcaaacaagagggttgcgattttcaagatctgtcttagcaatgtgcaatgttttgcttttcactggaaatattacgtatttctatttgaatggctcggtaggagggaagttctttgggtaacaccgaaagacagagtgaaaagaagtatgtctattttgatatgctgccacttgaattgtaatcomp24195_c0_seq11633227Reference transcriptome Oly Transcriptome V3
92
1635CRAF1_REV133210748O.lurida5/21/2015ACAAGTCGCACTGGCTACAAJH2055
TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)
Q60803atggtaaccctgaaaggcaggttacccacgagttatttgcccctgatccaaaataaaattaagtcgtacgtgtgtcatttactcaaaccgtagaaactgcagtgtgtgcacagggactcgtcacgaattgacctcattaaaatatagaatagacggtgtcaaattttaataagacaaaaagttcgtgacgagcccctgtggccagagctcccatcccctttactagctccttcaacataactgtcagtataagaccctggtacttattatacttggaacttttgctaaactggtcagtatcttcattatatacatgcaatgagaatggatctaaatcatgcattgacatatagagtatccatactaaactacccctatactggcctatagtgaccagcccacctagtgtgacttctggtgaaatattgagcccgaatataaacgataaattttcttcaacacaattactgacgagcagatgtaccgaatacaactatcccataatagctagagttacgataactaatttgattttaaactgagaaggtatttctaaatgaggaaatttgacaaacatctatgattctgtacatgtttctgtttctttcatggaattggtatgttacttgtgtcaactttaactttgatgaatattgtatcttctttgagatatgtctttgtttcgagcacactatgggagataaaaagaggacatccagtggcaacattcatctctgtagttggtctcttgaagctgctacttgttgtgtcaggctggaaagtatcacagacatgtcttctgttgaagtcttgatccaacagcatcagggaaactttctgctggaaaggccatggaagcagggcatcaaactctcctctcatcaccacaaagaacaaggacagatgagtgcctttacccattccatccccattcaggtacactctggcacacatcttgtagccagtgcgacttgtgtaaaatggctggctgtacagggagagggttctcccacttttggcctcctcctttcttctggagtaatctcttatcttccacattaaaatgccatcataactagcagtctccagcacttggaatctcaggtctaactcagcaagcctaatgtcctggatcgccatctgcttctcattactcttcagttgattcctcacctcttgagacacccctgcctgtgaccctccacctccgggccccgctcgctctagctgagttatctgctcctgactgactcgcaagtcctctctcagcacatttaaaacttgctcctgcttttcaaggacttctcgctttggctggtgttcaatcaacctctccaaatttattaacctttctgtcaatgacactaacttttttttcatatcctttgtgatcgatttcactaagggtgtaatttcttcttttaacctttgattttcctgatgcaattcttgaacaattctttgcatttctactgcctctgtcttgcttttctcaatctcagtctgcagagcttgattctgatcgcttgtttgattggaaaatgacataactaacatcagatggtgatctgtcgctgttgtctgatgcttctccacttctttgactacatcaacaaactgacaccctatgcttttgtatccacaagggattgatcgttttgggcaagattgcaggtgactatccatctcacttcgacgcagtattatattttcacacccatttggacagttcagttgatattccaaacactcatggtcaatgtgactctgcatctgacagaagggaacatcccttgagcagtggctgcatacagcaattcgatggctgcactctaatttctgatgactggacagcttattctgaggtattttttcatgacattcaccacattccacgggtttaaactcgcattcctcagcgtgtatcataaggtttctccatattggtgtctctttacacccatgattgtgataggaacagaaaactggaagtaacatcatctctcgacgagtgcacatatctttatatatctcatttttggagaaagactccttacactcctcatccaactgtaggggacaggttgctgtgtcattttctccaaacaatggatcaatacaggactcacagatctgatgtccacactgtagttgcatggcattccttagtactgttccacacacagagcaaatgtatttatccgctactttattgacaaactgtggcaagtctgctgataataagcttgttcccaaagaagccatagaggaatccatgttgagatagcaaatttcagcttacgcggtattcaaaatattttaacaaaatacagagttttatatgcaaatgttttttaaatttacaagaatatttttttaagtcactgacagaagttgctatgtattcaaggttattattatatttcctattttttatcctatcacatctaatattctgtatagcaacagtaaaggaagaaatgatcaatatatcactccaaaaagaatcatgttttatccaatactgtagaaatacagttttttcatatagtgctgataatttacaacccatacacccctggctttgcaatcattttcatttttactgtatgtttctgcattcttaaacacaactcatctgaaataggcctacagtccgtgagccaagggcgtcgcttctaaaatggcgttgtactttactcattcggcgaacomp25313_c0_seq11636119Reference transcriptome Oly Transcriptome V3
93
1636CRAF1_FWD133210747O.lurida5/21/2015AGCAGGGCATCAAACTCTCCJH2055
TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)
Q60803atggtaaccctgaaaggcaggttacccacgagttatttgcccctgatccaaaataaaattaagtcgtacgtgtgtcatttactcaaaccgtagaaactgcagtgtgtgcacagggactcgtcacgaattgacctcattaaaatatagaatagacggtgtcaaattttaataagacaaaaagttcgtgacgagcccctgtggccagagctcccatcccctttactagctccttcaacataactgtcagtataagaccctggtacttattatacttggaacttttgctaaactggtcagtatcttcattatatacatgcaatgagaatggatctaaatcatgcattgacatatagagtatccatactaaactacccctatactggcctatagtgaccagcccacctagtgtgacttctggtgaaatattgagcccgaatataaacgataaattttcttcaacacaattactgacgagcagatgtaccgaatacaactatcccataatagctagagttacgataactaatttgattttaaactgagaaggtatttctaaatgaggaaatttgacaaacatctatgattctgtacatgtttctgtttctttcatggaattggtatgttacttgtgtcaactttaactttgatgaatattgtatcttctttgagatatgtctttgtttcgagcacactatgggagataaaaagaggacatccagtggcaacattcatctctgtagttggtctcttgaagctgctacttgttgtgtcaggctggaaagtatcacagacatgtcttctgttgaagtcttgatccaacagcatcagggaaactttctgctggaaaggccatggaagcagggcatcaaactctcctctcatcaccacaaagaacaaggacagatgagtgcctttacccattccatccccattcaggtacactctggcacacatcttgtagccagtgcgacttgtgtaaaatggctggctgtacagggagagggttctcccacttttggcctcctcctttcttctggagtaatctcttatcttccacattaaaatgccatcataactagcagtctccagcacttggaatctcaggtctaactcagcaagcctaatgtcctggatcgccatctgcttctcattactcttcagttgattcctcacctcttgagacacccctgcctgtgaccctccacctccgggccccgctcgctctagctgagttatctgctcctgactgactcgcaagtcctctctcagcacatttaaaacttgctcctgcttttcaaggacttctcgctttggctggtgttcaatcaacctctccaaatttattaacctttctgtcaatgacactaacttttttttcatatcctttgtgatcgatttcactaagggtgtaatttcttcttttaacctttgattttcctgatgcaattcttgaacaattctttgcatttctactgcctctgtcttgcttttctcaatctcagtctgcagagcttgattctgatcgcttgtttgattggaaaatgacataactaacatcagatggtgatctgtcgctgttgtctgatgcttctccacttctttgactacatcaacaaactgacaccctatgcttttgtatccacaagggattgatcgttttgggcaagattgcaggtgactatccatctcacttcgacgcagtattatattttcacacccatttggacagttcagttgatattccaaacactcatggtcaatgtgactctgcatctgacagaagggaacatcccttgagcagtggctgcatacagcaattcgatggctgcactctaatttctgatgactggacagcttattctgaggtattttttcatgacattcaccacattccacgggtttaaactcgcattcctcagcgtgtatcataaggtttctccatattggtgtctctttacacccatgattgtgataggaacagaaaactggaagtaacatcatctctcgacgagtgcacatatctttatatatctcatttttggagaaagactccttacactcctcatccaactgtaggggacaggttgctgtgtcattttctccaaacaatggatcaatacaggactcacagatctgatgtccacactgtagttgcatggcattccttagtactgttccacacacagagcaaatgtatttatccgctactttattgacaaactgtggcaagtctgctgataataagcttgttcccaaagaagccatagaggaatccatgttgagatagcaaatttcagcttacgcggtattcaaaatattttaacaaaatacagagttttatatgcaaatgttttttaaatttacaagaatatttttttaagtcactgacagaagttgctatgtattcaaggttattattatatttcctattttttatcctatcacatctaatattctgtatagcaacagtaaaggaagaaatgatcaatatatcactccaaaaagaatcatgttttatccaatactgtagaaatacagttttttcatatagtgctgataatttacaacccatacacccctggctttgcaatcattttcatttttactgtatgtttctgcattcttaaacacaactcatctgaaataggcctacagtccgtgagccaagggcgtcgcttctaaaatggcgttgtactttactcattcggcgaacomp25313_c0_seq11635119Reference transcriptome Oly Transcriptome V3
94
1637PGE/EP4_REV133210746O.lurida5/21/2015ATGGCAGACGTTACCCAACAJH2055
Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
P32240tggcgctggaaaatcgatagtcaagagcctgtacttcagtatttactttggacggggttaactagtccctagtgaccatatcgagagtgaatatgtattcaatggcaggcatacaacacggtagaagattcacgtcggattagcagatatatcattaaggacaattgttaccgccctcactgattacccacctttgttttgtgagcaaacatttattaagcaacacaccgccctacgccagaaacaaccaagattctatcatctatacaaaatcaatgcaccctgcgcatgtcacaaaacgttgccatgattttataatcatgcgacattaggaggcatggctctccacatgtaaactctggatcggggtaaaaaaaatctttttttaaaaagcaggaaactatgagtcttgtgtgcggattttccggacatattgaccgaaatgaaacgaatacctcaaattgctcaacgaattgctctactccaaattgggtgggcacggctctcatgagctggattagtacgaaaaatgtagttaattctggagtgatgtttgcctgtggattttttgggaatttgttagctttaattgtgttaataaggtctagtaaggaacagcgacggacgattttctaccgtttggttgctggactgaccatcacagatttaattggcaccaccttgacctctcctgtcgtgataacagtgtacgtaaagagacgctggatagggggcgacttcctgtgttcttactttggatttatgatgatcatggcgtgtttctccacgatgacaattgtatgtgctatgtctatagaacggatattgtgcataagacacccatatatctattatacccgattatcgaagaagcacgccaccattattttagcatcgtgttgggtaacgtctgccattatagcttcgttgcctcttttaggatttggggaaattgtcagaaaatacccaggaacgtggtgttattttgattattactcaaaagagccgatccatatagtatttaactatttcatcagtatcttagccatgagtattatcattgtgaccatttgctgtaatttgacagtcatttataccattctaaaaagcagacggaaacagggaatactccggaaagaggacggtacttcacgctccatccatggtgccagcaagcgttacgcagaatgtcagatgctgattcttttggtagggatcaccatcgttttcacctcctgctacactccgctatacgttcgagttatcatgaatcaaacaggcctcgtttgcaataccctcttggacttacaactgatccggctagcctcttataatcaaattctggatccttgggtttatatactcctccggagagaactcttgtggaagataatatctggcgtgaagtacatttgtaatcgaggtcagacagacctaaattcattaccccagaaacaatttgacgtagacaatgccaactgctgcgtgttttgtttccactgtttgtgcgaccctccggtgactgctagacagcgatgtgggtcaattttctctcaggacggccaatacatacatgcatgtccaggaagaagcacaatgaacgcctctagtttttcaaacctcaaaagcacctctctgacttctttgaacggaaggcaatcgggccctctgcgagtttgctctgcgaatgacgtccatatgctactgcttaataacacgctgaagaaacatggagtgacaaagagtacaagcacacgttttgtggatgacattgagaacgactgattcattcacaaatatttttacacgtgtttcatttccaatcaagtgatgtacaatcaatatttaaggattttatatacatttttactacttattagccttacaatttttcatactgtatgtgttatcatgtttatctaacattccacaatcttgaatgcgagatcatatattttaacactgatgaggcaaaacaacgtacatgagattactagaggattcccatttttattggcttgctttacttttgtggcaaccagtacatgtaccagtggattttttcaaattttgttgttgtgtaaaaaatcaacatattttccttactatcaaaactggcacomp6939_c0_seq11638303Reference transcriptome Oly Transcriptome V3
95
1638PGE/EP4_FWD133210745O.lurida5/21/2015ACAGCGACGGACGATTTTCTJH2055
Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
P32240tggcgctggaaaatcgatagtcaagagcctgtacttcagtatttactttggacggggttaactagtccctagtgaccatatcgagagtgaatatgtattcaatggcaggcatacaacacggtagaagattcacgtcggattagcagatatatcattaaggacaattgttaccgccctcactgattacccacctttgttttgtgagcaaacatttattaagcaacacaccgccctacgccagaaacaaccaagattctatcatctatacaaaatcaatgcaccctgcgcatgtcacaaaacgttgccatgattttataatcatgcgacattaggaggcatggctctccacatgtaaactctggatcggggtaaaaaaaatctttttttaaaaagcaggaaactatgagtcttgtgtgcggattttccggacatattgaccgaaatgaaacgaatacctcaaattgctcaacgaattgctctactccaaattgggtgggcacggctctcatgagctggattagtacgaaaaatgtagttaattctggagtgatgtttgcctgtggattttttgggaatttgttagctttaattgtgttaataaggtctagtaaggaacagcgacggacgattttctaccgtttggttgctggactgaccatcacagatttaattggcaccaccttgacctctcctgtcgtgataacagtgtacgtaaagagacgctggatagggggcgacttcctgtgttcttactttggatttatgatgatcatggcgtgtttctccacgatgacaattgtatgtgctatgtctatagaacggatattgtgcataagacacccatatatctattatacccgattatcgaagaagcacgccaccattattttagcatcgtgttgggtaacgtctgccattatagcttcgttgcctcttttaggatttggggaaattgtcagaaaatacccaggaacgtggtgttattttgattattactcaaaagagccgatccatatagtatttaactatttcatcagtatcttagccatgagtattatcattgtgaccatttgctgtaatttgacagtcatttataccattctaaaaagcagacggaaacagggaatactccggaaagaggacggtacttcacgctccatccatggtgccagcaagcgttacgcagaatgtcagatgctgattcttttggtagggatcaccatcgttttcacctcctgctacactccgctatacgttcgagttatcatgaatcaaacaggcctcgtttgcaataccctcttggacttacaactgatccggctagcctcttataatcaaattctggatccttgggtttatatactcctccggagagaactcttgtggaagataatatctggcgtgaagtacatttgtaatcgaggtcagacagacctaaattcattaccccagaaacaatttgacgtagacaatgccaactgctgcgtgttttgtttccactgtttgtgcgaccctccggtgactgctagacagcgatgtgggtcaattttctctcaggacggccaatacatacatgcatgtccaggaagaagcacaatgaacgcctctagtttttcaaacctcaaaagcacctctctgacttctttgaacggaaggcaatcgggccctctgcgagtttgctctgcgaatgacgtccatatgctactgcttaataacacgctgaagaaacatggagtgacaaagagtacaagcacacgttttgtggatgacattgagaacgactgattcattcacaaatatttttacacgtgtttcatttccaatcaagtgatgtacaatcaatatttaaggattttatatacatttttactacttattagccttacaatttttcatactgtatgtgttatcatgtttatctaacattccacaatcttgaatgcgagatcatatattttaacactgatgaggcaaaacaacgtacatgagattactagaggattcccatttttattggcttgctttacttttgtggcaaccagtacatgtaccagtggattttttcaaattttgttgttgtgtaaaaaatcaacatattttccttactatcaaaactggcacomp6939_c0_seq11637303Reference transcriptome Oly Transcriptome V3
96
1639BMP-2_REV133210744O.lurida5/21/2015TCCGGTTGAAGAACCTCGTGJH2055
Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
P12643aaattgacattaagggattatacgtgcaacgagtttttcattaataagtaaacgattatctcttttgaccggaacatataatgaagttttcaagaccaagtatttaaagtgttgttattttcaccagaaagtttaaaggaatcggagtgcagttagacgaggacagcgatactatataagctggaacttattaatacacacgtactctcgtctcagtataaaccacctgttccaccataaacatgatttattaatacggttatttaaaccttatccggttgagaatgtgtgtgcaatcagagctattttcgttgaggagcaaatttagaatcgggatttactgactgaacaagcggttgggaaaacaatctcttgcacacaaggatcatttactttcagtctatttggaatttatagaagaatgtgctatgacattaaataggggaattaacaaactaatggaagaccgtgcaggaaccaagctctatattcgtgcattttcacaatgagtttctgtcgatttggttttctactgttgctagcgtgcaccgggctggctggatcgtcatcgccttctcttctagaatcggcttttccttctcactacgacgaaaatcgaagaagagaaataatacaggcttttgagaaaaccttcttgcatctgtttggattgaaggaacgaccaaagccaaagaaagacacttttattccacaatatttgttagagttatatgaaaaacatagcgaggacccagattctcttggagatagcgtcaatgtcaaaagacgaggcgcgggttccgccaacactgttagaagttttcttcataaagaattgaccactgacgtcattagtatggcaggatgcggggagcacaactgtgcccatttctacttcaacgtatcatccattcctatggaggaatcattaactggtgctgagctaagactctttattgatcaaaataacgacacaaaaaatccagtcggaaacaggaaacagtttagacataaaatagaaattcacgaggttcttcaaccggaaacccaacattctgaagccataactaggctgctggatgtgcgtcacgtgggaggaagaaatgcatcttgggaatcttttgacattcacccagcagtattaaaatggaaaaagaatcctcatttaaaccatggattaaaagttcgtgtattacaatttaaaaacaaaccgtccacagactccattaaacatgtacgtttacgacgtgacgtagatagtgtggaggaagagaggcacacgagacctctgttggtgactttcacggacgataaccgtgggtcaaggactaaaagatccaccagtgataaaacaaaaaaaggtagaaaaaataggaaaaatagaaaaaataaaaagcgaaggagaaatagaaagaaaaacaatagaaagaataaaacaaagaggaaaaagtataacgaccagtgtcgcaggaaggagttaaatgtagattttaaagccgttgggtggaacgattggatattcgcgccacccggctataatgcgtattactgtgatggttcatgtcactggccttatgatgaccatatgaatgtgacaaaccatgcgatagtccaagacttagtgaactctatagaccctagggcggccccgaagccctgttgtgtacccacagaactcagttcgctttccttattatatactgacgaacatggcatagttgtgctgaaggtctatcaagacatggttgtagaaggatgcgggtgccggtagccatgataactctttaaattgttattgttatttgttgtgatattatttatttgcgaaaatggatgaaaaagtgtgtgtgttccgaaatatggctgttcggaagttagcttcatatttgctcatttccaatctcccattcattgacaatcatatcattattttcattttgcataaattgcatcomp7183_c0_seq11640373Reference transcriptome Oly Transcriptome V3
97
1640BMP-2_FWD133210743O.lurida5/21/2015TGAAGGAACGACCAAAGCCAJH2055
Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
P12643aaattgacattaagggattatacgtgcaacgagtttttcattaataagtaaacgattatctcttttgaccggaacatataatgaagttttcaagaccaagtatttaaagtgttgttattttcaccagaaagtttaaaggaatcggagtgcagttagacgaggacagcgatactatataagctggaacttattaatacacacgtactctcgtctcagtataaaccacctgttccaccataaacatgatttattaatacggttatttaaaccttatccggttgagaatgtgtgtgcaatcagagctattttcgttgaggagcaaatttagaatcgggatttactgactgaacaagcggttgggaaaacaatctcttgcacacaaggatcatttactttcagtctatttggaatttatagaagaatgtgctatgacattaaataggggaattaacaaactaatggaagaccgtgcaggaaccaagctctatattcgtgcattttcacaatgagtttctgtcgatttggttttctactgttgctagcgtgcaccgggctggctggatcgtcatcgccttctcttctagaatcggcttttccttctcactacgacgaaaatcgaagaagagaaataatacaggcttttgagaaaaccttcttgcatctgtttggattgaaggaacgaccaaagccaaagaaagacacttttattccacaatatttgttagagttatatgaaaaacatagcgaggacccagattctcttggagatagcgtcaatgtcaaaagacgaggcgcgggttccgccaacactgttagaagttttcttcataaagaattgaccactgacgtcattagtatggcaggatgcggggagcacaactgtgcccatttctacttcaacgtatcatccattcctatggaggaatcattaactggtgctgagctaagactctttattgatcaaaataacgacacaaaaaatccagtcggaaacaggaaacagtttagacataaaatagaaattcacgaggttcttcaaccggaaacccaacattctgaagccataactaggctgctggatgtgcgtcacgtgggaggaagaaatgcatcttgggaatcttttgacattcacccagcagtattaaaatggaaaaagaatcctcatttaaaccatggattaaaagttcgtgtattacaatttaaaaacaaaccgtccacagactccattaaacatgtacgtttacgacgtgacgtagatagtgtggaggaagagaggcacacgagacctctgttggtgactttcacggacgataaccgtgggtcaaggactaaaagatccaccagtgataaaacaaaaaaaggtagaaaaaataggaaaaatagaaaaaataaaaagcgaaggagaaatagaaagaaaaacaatagaaagaataaaacaaagaggaaaaagtataacgaccagtgtcgcaggaaggagttaaatgtagattttaaagccgttgggtggaacgattggatattcgcgccacccggctataatgcgtattactgtgatggttcatgtcactggccttatgatgaccatatgaatgtgacaaaccatgcgatagtccaagacttagtgaactctatagaccctagggcggccccgaagccctgttgtgtacccacagaactcagttcgctttccttattatatactgacgaacatggcatagttgtgctgaaggtctatcaagacatggttgtagaaggatgcgggtgccggtagccatgataactctttaaattgttattgttatttgttgtgatattatttatttgcgaaaatggatgaaaaagtgtgtgtgttccgaaatatggctgttcggaagttagcttcatatttgctcatttccaatctcccattcattgacaatcatatcattattttcattttgcataaattgcatcomp7183_c0_seq11639373Reference transcriptome Oly Transcriptome V3
98
1641CARM1_REV133210742O.lurida5/21/2015GTTGTTGACCCCAGGAGGAGJH2055
Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
Q6DC04gagaaaatggcgtcaacttttgacaacgtgcaagtcgccgttctcacagaaaagtacaatttcaagtttctcacagatgatccgctcattcttgatatatcacaccaaggagactgtgttatgctccagtttcacaaagacaaagttcctgtacacaccttgtcagtaaacaacgacacagaacatgccaggatgggatcacagagtatcatcttcacacgagacaaggacacaacactggtccattttcctagtgttcacaatatgaaacagtttcagtttcgactgaatgaactgaaagatggattaaaatctgtcttcagtgatagaacagatgcagcctcagcagttcaatatttccaattttatggatacctctcacagcaacagaacatgatgcaagactatatcagaacgtccacgtaccagagggcaatgctggcaaacttaatagatttccatgacaaggttgtgttagatgttggtgctggatcaggaattctgtcgttttttgccgtccaggctggagcaagaaaagtgtacgccatagaggccagcagtatggctacacactgtcagacactggttgcacagaataaattgtccgacaaaattgttgtgatccctggtaaggtggaagatgtggagatccctgagccggtggacaccattatatcagaacccatggggtacatgctgtttaacgagagaatgctggaaagctaccttcacgccaaaaaatggctgaagcccagaggaaagatgtttccttctcagggagatttacatatagctccgttcacagatgaagccctctatctggagcagttctctaaggctaatttttggtatcagcaatcattccatggaattgatttgtctagtttacgcagtgcagctgtcaaagaatacttcacacagcccattgtggatactttcgatgtaaggatatgtctggcaaaatctgtcaaacacaccgtggacttccagacggcggaggagactgacctacacaacattgagatccccctcacgttcagcatgcacgagtcggggctcgttcacggtctcgccttctggtttgatgtggcctttttgggatcagtagagcctgtttggttatcaacagccccgacagagactctgacacattggtatcaggttaggtgtctggtggaaacaccggtcctcgtcaaacaaggacagactctcaatggaaaatgtgtgctcaggtgcaacaaaagacagagttatgatgttgatattgaactgaacatcccaggaacaacctcaaagtccacaaacacactggatcttaaaaatccattttttcgttacacgggtcagacaccacctgctcctcctggggtcaacaactcttcccccacggaaacctactggaataatctggcgacaggccagactgtatacatgaatggactggttaatggggacaccaatgctgcacagcttctaagccaccagggagttattcaacaaaatctcatcccagtctgtacgttgatttcaggtttatctgacccatcccaaagactttattgaatactttacagaacaacagatttttacattacagaacaacagatttttatctgtttatttaataatgaaatacttgtacaatgtatatatgtgtatgaaaattttctatcaaataaagcomp7220_c0_seq21642261Reference transcriptome Oly Transcriptome V3
99
1642CARM1_FWD133210741O.lurida5/21/2015TGGTTATCAACAGCCCCGACJH2055
Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
Q6DC04gagaaaatggcgtcaacttttgacaacgtgcaagtcgccgttctcacagaaaagtacaatttcaagtttctcacagatgatccgctcattcttgatatatcacaccaaggagactgtgttatgctccagtttcacaaagacaaagttcctgtacacaccttgtcagtaaacaacgacacagaacatgccaggatgggatcacagagtatcatcttcacacgagacaaggacacaacactggtccattttcctagtgttcacaatatgaaacagtttcagtttcgactgaatgaactgaaagatggattaaaatctgtcttcagtgatagaacagatgcagcctcagcagttcaatatttccaattttatggatacctctcacagcaacagaacatgatgcaagactatatcagaacgtccacgtaccagagggcaatgctggcaaacttaatagatttccatgacaaggttgtgttagatgttggtgctggatcaggaattctgtcgttttttgccgtccaggctggagcaagaaaagtgtacgccatagaggccagcagtatggctacacactgtcagacactggttgcacagaataaattgtccgacaaaattgttgtgatccctggtaaggtggaagatgtggagatccctgagccggtggacaccattatatcagaacccatggggtacatgctgtttaacgagagaatgctggaaagctaccttcacgccaaaaaatggctgaagcccagaggaaagatgtttccttctcagggagatttacatatagctccgttcacagatgaagccctctatctggagcagttctctaaggctaatttttggtatcagcaatcattccatggaattgatttgtctagtttacgcagtgcagctgtcaaagaatacttcacacagcccattgtggatactttcgatgtaaggatatgtctggcaaaatctgtcaaacacaccgtggacttccagacggcggaggagactgacctacacaacattgagatccccctcacgttcagcatgcacgagtcggggctcgttcacggtctcgccttctggtttgatgtggcctttttgggatcagtagagcctgtttggttatcaacagccccgacagagactctgacacattggtatcaggttaggtgtctggtggaaacaccggtcctcgtcaaacaaggacagactctcaatggaaaatgtgtgctcaggtgcaacaaaagacagagttatgatgttgatattgaactgaacatcccaggaacaacctcaaagtccacaaacacactggatcttaaaaatccattttttcgttacacgggtcagacaccacctgctcctcctggggtcaacaactcttcccccacggaaacctactggaataatctggcgacaggccagactgtatacatgaatggactggttaatggggacaccaatgctgcacagcttctaagccaccagggagttattcaacaaaatctcatcccagtctgtacgttgatttcaggtttatctgacccatcccaaagactttattgaatactttacagaacaacagatttttacattacagaacaacagatttttatctgtttatttaataatgaaatacttgtacaatgtatatatgtgtatgaaaattttctatcaaataaagcomp7220_c0_seq21641261Reference transcriptome Oly Transcriptome V3
100
1643GRP-78_REV133210740O.lurida5/21/2015CATCAGCATCGAAGGCAACGJH2055
78 kDa glucose-regulated protein (GRP-78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP)
Q90593atcaaccaaagacgaatttatagactaacttcaacgaaattaccaaattgttttccattgtccatttacagaacagataatacatatcaaactgaactatagctaggatacaatatacggcattaagttacaatcatcataaaaatgagaaaccacgcagggagaatggtggtcagcctaattctaacattggcgctgctaactgccgccgcatcaacgtcatcttccgacgatagggcggatcccgtgataggaatagacctgggaaccacatattcttgtgttggaatattcaaagacggccatgttgaaatccttccgaatgagcaaggaaaccgaataacgccatcttacgttgccttcgatgctgatggcgacagacttataggagacgccgctaaaaatcaactgacgtcaaaccccaaaaatacaatctttgacgttaaacgattcattggacgagaatgggacgatccaacagtacagaaagatgtgcaatattatccgttcagcctcttgaagaaacacaacaagccctacatccgagtacttgtaggcgaacaagaaagagtgtttgcaccagaagaaatttccgccatggtgctggggaaaatgaaggaaatagccgaggggtatctgaagcaaaacgtcacgcgtgctgtaatcaccgtcccggcgtattttaacgacgctcaacgtcaggcaacgaaggatgctggtacaatagcagggttagaggtgctccgaatcatcaatgaaccaaccgcggctgccatcgcttatggtctaaacaaaaacggaggagaaaagaccgtcttggtatttgacttgggaggaggtacgttcgatgtgtcgcttttgacaattgaccaaggagtgttcgaagttgttgcaaccaatggcaacaaccatcttggaggagaagacttcgaccagagagtaatggatttcctgatcaagaaacacaagaaatctacaaatatggatttacgaaaggacgcccgtgccctacagaagttacgccgagaggtagaaaaggccaagcgaacactctcctatcgtcacgaagcacgtattgaaatagagtctctaatgaatggcgaagacttcttttacactctcacgagagccaagtttgaggaactgaacatggatttattccgatcaactttaaatcccgttaaacaagttctgaaggacggtgatatgaaagcctccgatgttgatgaaatcatactcgtgggcggatccacacgtattcccaaaatacagcaacttgtcaaggaattcttcggcggaaaggagcccagtcgtggtgttaacccagacgaatcggtggcctatggtgctgctgttcagggggcagttctaagtggagcagatgaaactggtgacgtgcttgttgtggacgttaaccctctcaccctgggaatagagacagttggtggcgtcatgactaaactgattccacgtaactcccccattcctaaccggaagtcacaaatattttctacagcagccgacaaccagccaacagtgaccattcaggtattcgaaggtgaacgacccatgacaaaacataaccaccttttggggacattcgagttgactgggataccacctgctccgagaggagttcctcaaattgaagtcacttttgaaatagatgcaaacagtattttgacagtatcagcagaagacaaggggaccggaagtaagaataagattacaattcaaaatgacaacaatagaatatctccggatgaaatagaaaaaatgattaaagacgctgaaaagtttggcgacgaagacaaaaaagccaaagaaatcattgacgctaagaatgaactagagcattttgcatattcgcttaaaaaccagttaagtgataaagggcaactcaaagataaactcggtgatgaagataaaactacaatccgagaggcagtggagtctacgattggctggattgagtccaatcctgacgcggaacttgatgatctcaaggcaaagaaggccgagttagagaatatagtacaaccaatcacgagcaaactttaccaaggaaatccaagttcaaaggccgacgaccgagaggggctttaatgaaaggctttcctttatacaatcggctgggccctgatctgtgatattgataagaaaatgtcccgtcactatttattgccatatctcatttatatcattccgtgcaatgctgtacattgttgattttattgtttgttcagtattttttatattaataaataaaacggtgaacomp8243_c0_seq11644227Reference transcriptome Oly Transcriptome V3
Loading...
Main menu