PrimerDatabase
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXY
1
sr_IDPrimer nameIDT #Organismdate orderedPrimer SequenceDesigned By#bpGC%melting tempGeneGene Accession#full sequencelocation on referencepair w/sr_IDproduct sizeother notes
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
1710P_gurneyi_2_fwdP. Gurneyi10/5/2015CGACATTATCCGCCGTTTCGJDA205559.77Luciferase RNATTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC470Created from consensus sequence
27
1709P_gurneyi_2_revP. Gurneyi10/5/2015CCGCTCGGATGATAACTGGTJDA205559.77Luciferase RNATTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC470Created from consensus sequence
28
1708P_gurneyi_1_fwdP. Gurneyi10/5/2015TATACATGGCATCGTCGGGCJDA205560.04Luciferase RNATTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC470Created from consensus sequence
29
1707P_gurneyi_1_revP. Gurneyi10/5/2015TTTCCAAAGCTCATTGCCGCJDA205060.04Luciferase RNATTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC470Created from consensus sequence
30
170640s_FWD135969753O.lurida8/12/2015CATTGCTGAGTGCTTGGCTGJH205560.11
"40S ribosomal protein S5 [Cleaved into: 40S ribosomal protein S5, N-terminally processed]"
P46782tttttttttttgacttccggcaccttcacggtacaatggctgagaactgggatgaagctgccccggcagtagaactgccagaaatcaaactcttcggcaagtggtcttcagatgatgttcaagtgaacgacatcagtttaactgattacatagctgtcaaagagaagtatgcgaaatatttgcctcactctgcgggaagataccaagtaaaaagattccgaaaatctcagtgtccaattgtggagcgcctgacctgttcactgatgatgcgtggaaggaacaatggaaagaaactgttgacaactcgtatcgtcaagcacgccttcgaaatcattcacctgctcacaggagagaaccctctccaagtactggtgaatgcgatcatcaacagtggtcctcgtgaagactccacccgtatcggacgtgctggtacagtacgtcgtcaggcggtagacgtctctcctctccggcgggttaaccaggctatctggctgctgtgtaacggagctcgtgaggcttccttcaggaacatcaagaccattgctgagtgcttggctgatgagctaatcaatgctgcaaagggatcctccaattcccatgctatcaagaagaaggatgaacttgagcgtgtagccaagtccaaccgataaatgacattatgtgttatcagtgaactgaaaataaactgtcaggcaaaaagtggtatttcttgttcctcagcacaccagattttattgatattgggttatggaggctgaaacagatatgaaaattatttaaaagagagcttgagttgtagtatatttgctcctaaaagtttg1705103Reference transcriptome Oly Transcriptome V3
31
170540s_REV135969754O.lurida8/12/2015GGACTTGGCTACACGCTCAAJH205560.32
"40S ribosomal protein S5 [Cleaved into: 40S ribosomal protein S5, N-terminally processed]"
P46782tttttttttttgacttccggcaccttcacggtacaatggctgagaactgggatgaagctgccccggcagtagaactgccagaaatcaaactcttcggcaagtggtcttcagatgatgttcaagtgaacgacatcagtttaactgattacatagctgtcaaagagaagtatgcgaaatatttgcctcactctgcgggaagataccaagtaaaaagattccgaaaatctcagtgtccaattgtggagcgcctgacctgttcactgatgatgcgtggaaggaacaatggaaagaaactgttgacaactcgtatcgtcaagcacgccttcgaaatcattcacctgctcacaggagagaaccctctccaagtactggtgaatgcgatcatcaacagtggtcctcgtgaagactccacccgtatcggacgtgctggtacagtacgtcgtcaggcggtagacgtctctcctctccggcgggttaaccaggctatctggctgctgtgtaacggagctcgtgaggcttccttcaggaacatcaagaccattgctgagtgcttggctgatgagctaatcaatgctgcaaagggatcctccaattcccatgctatcaagaagaaggatgaacttgagcgtgtagccaagtccaaccgataaatgacattatgtgttatcagtgaactgaaaataaactgtcaggcaaaaagtggtatttcttgttcctcagcacaccagattttattgatattgggttatggaggctgaaacagatatgaaaattatttaaaagagagcttgagttgtagtatatttgctcctaaaagtttg1706103Reference transcriptome Oly Transcriptome V3
32
170460s_FWD135969755O.lurida8/12/2015GTACGAGGTGATGAGAGCGGJH206059.97
60S ribosomal protein L10 (QM protein homolog) (dQM)
O61231gaggaagaaggccaaggctctttccggtagttctaattcaaaatgggacgccgaccagctcggtgttaccggtactgtaagaacaaaccttatccgaagtccagattttgtagaggtgtcccagatgcaaagatccgtatttttgatcttgggaggaagaaggccaaggtagatgacttccccctgtgtgtgcatctcgtatctgatgagtacgaacagctctcctcggaagctctagaagcaggacgtatctgtgccaacaagtatttggtcaagaactgtggtaaagatgctttccacatgcgaattcgagtgcaccccttccacgtcatcagaatcaacaagatgttgtcgtgcgctggagctgataggcttcagacgggaatgagaggagcttttggtaaaccacaaggcaccgtagcccgtgtacacataggacagccaatcatgtctgtacgtgctcgtgagagtcaccaggctgccgtgatagaagcactcaggagagccaagttcaagttccccggacgtcagaagatccacgtgtccaagaagtggggattcactaagtgggagaagcctcagtacgaggtgatgagagcggacgggcgcctgatccctgatggagttaccgtacaatataaacctaacaagggccccctgcgtgcatggaaggacagacagagggtctaaagctatttattgtgatctggacaatatgaataaaccatcatgtaggccttcaaaaaaaaaaaaaa1703105Reference transcriptome Oly Transcriptome V3
33
170360s_REV135969756O.lurida8/12/2015ACCCTCTGTCTGTCCTTCCAJH205559.89
60S ribosomal protein L10 (QM protein homolog) (dQM)
O61231gaggaagaaggccaaggctctttccggtagttctaattcaaaatgggacgccgaccagctcggtgttaccggtactgtaagaacaaaccttatccgaagtccagattttgtagaggtgtcccagatgcaaagatccgtatttttgatcttgggaggaagaaggccaaggtagatgacttccccctgtgtgtgcatctcgtatctgatgagtacgaacagctctcctcggaagctctagaagcaggacgtatctgtgccaacaagtatttggtcaagaactgtggtaaagatgctttccacatgcgaattcgagtgcaccccttccacgtcatcagaatcaacaagatgttgtcgtgcgctggagctgataggcttcagacgggaatgagaggagcttttggtaaaccacaaggcaccgtagcccgtgtacacataggacagccaatcatgtctgtacgtgctcgtgagagtcaccaggctgccgtgatagaagcactcaggagagccaagttcaagttccccggacgtcagaagatccacgtgtccaagaagtggggattcactaagtgggagaagcctcagtacgaggtgatgagagcggacgggcgcctgatccctgatggagttaccgtacaatataaacctaacaagggccccctgcgtgcatggaaggacagacagagggtctaaagctatttattgtgatctggacaatatgaataaaccatcatgtaggccttcaaaaaaaaaaaaaa1704105Reference transcriptome Oly Transcriptome V3
34
170228s_3_FWD135969757O.lurida8/12/2015TAAGGCCAGTGTGGGAGAGAJH205559.88
"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"
Q5REJ1gtgatatattcccggattgacgcagcatgagtttggcccgaatcggaactggacttcataatgcgacaaaaactttaagtttgacaaatatattgcaaggaacaggttgtccaaaatgtcccagcctactgtcggtatttgtactctcgcaccacaatcatttgcagtccaggaactacagttttgtcacaacagtctcgagtgatgaattatgggaaggtgtgacctccgtcagctcagcaggaaagaaacgaggccgagccaaatcaaccaagaaaaagattaatcttcatattggccaaagattaggacatggtaaggaaggcatgtctttccctggattaaacaccaaagttttcagcgagacttcacgagttaaatccactgttaaacgttctgaggaatttgatacaacacttgaggaacttcgacaacagcggaagtccacaaagaagacccgcagtacaacaaaatatgtcaatcctttgttaagaggttatactagtaatttcttaccaggaaccagtttaggaccaccagctcaagtacgagaggaaaactttgatggctttgattcaagattgttgcaaatcaagaaaatcaccaacattacagcggatcagggaaaggtgttctcatacagagctctggtagctgtcgggaatggaaatggtctggcaggttttgcagttgctaaagcaaagaaactaaatgctgctggaattaaggcgagagacaaagcagggcaacaactaatatttattgaaagatacaatggacatacattgtaccacaactcacattcacaagttcattgtacaaaggtgtttgccaaaagagcatatgaaggacatggagttgtggcacacagagtgattaaagacttgtgcctgctgtctggaattaaagatatttatgtcaagacagagggcaacacaaaaaataccatcaccatgacaatggctttcttcaatgcagttacacatcaggaaacacaccaagaattggccaaccgaaccaagatgcatgtactagagctctcagatgaacgaaatcagacaccagttgttgtggcatctccggaagatggaaagatacaagcaaaatactatggaagtgaaagggatgtgtatgacttagatactctgtacactaaaggcaaactccactggactcggcctaaaataaggccagtgtgggagagacttggttttacatcatttagaaggaagctagatcagcgggaaaggagacgagggcaacacgaggcacaaaaagtgaggcgattgtgtagactggagccctcgaaagaggagcggattcaacgcgatcaagctgggaaaaagaacgaggaataatgatgtgtgtgacttgttagatattattaaaataaatctatagaatatgaaatgca1701100Reference transcriptome Oly Transcriptome V3
35
170128s_3_REV135969758O.lurida8/12/2015CGCCTCACTTTTTGTGCCTCJH205560.04
"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"
Q5REJ1gtgatatattcccggattgacgcagcatgagtttggcccgaatcggaactggacttcataatgcgacaaaaactttaagtttgacaaatatattgcaaggaacaggttgtccaaaatgtcccagcctactgtcggtatttgtactctcgcaccacaatcatttgcagtccaggaactacagttttgtcacaacagtctcgagtgatgaattatgggaaggtgtgacctccgtcagctcagcaggaaagaaacgaggccgagccaaatcaaccaagaaaaagattaatcttcatattggccaaagattaggacatggtaaggaaggcatgtctttccctggattaaacaccaaagttttcagcgagacttcacgagttaaatccactgttaaacgttctgaggaatttgatacaacacttgaggaacttcgacaacagcggaagtccacaaagaagacccgcagtacaacaaaatatgtcaatcctttgttaagaggttatactagtaatttcttaccaggaaccagtttaggaccaccagctcaagtacgagaggaaaactttgatggctttgattcaagattgttgcaaatcaagaaaatcaccaacattacagcggatcagggaaaggtgttctcatacagagctctggtagctgtcgggaatggaaatggtctggcaggttttgcagttgctaaagcaaagaaactaaatgctgctggaattaaggcgagagacaaagcagggcaacaactaatatttattgaaagatacaatggacatacattgtaccacaactcacattcacaagttcattgtacaaaggtgtttgccaaaagagcatatgaaggacatggagttgtggcacacagagtgattaaagacttgtgcctgctgtctggaattaaagatatttatgtcaagacagagggcaacacaaaaaataccatcaccatgacaatggctttcttcaatgcagttacacatcaggaaacacaccaagaattggccaaccgaaccaagatgcatgtactagagctctcagatgaacgaaatcagacaccagttgttgtggcatctccggaagatggaaagatacaagcaaaatactatggaagtgaaagggatgtgtatgacttagatactctgtacactaaaggcaaactccactggactcggcctaaaataaggccagtgtgggagagacttggttttacatcatttagaaggaagctagatcagcgggaaaggagacgagggcaacacgaggcacaaaaagtgaggcgattgtgtagactggagccctcgaaagaggagcggattcaacgcgatcaagctgggaaaaagaacgaggaataatgatgtgtgtgacttgttagatattattaaaataaatctatagaatatgaaatgca1702100Reference transcriptome Oly Transcriptome V3
36
170018s_2_FWD135962637O.conchaphila8/12/2015CTCGATTCCCTTTCCCCCACJH206060.1118s Ribosomal RNAEF035117.11699218Genbank 18s ribosomal for O. conchaphila
37
169918s_2_REV135962638O.conchaphila8/12/2015GCCCGATCTCTTTCCACCTCJH206060.1818s Ribosomal RNAEF035117.11700218Genbank 18s ribosomal for O. conchaphila
38
169818s_1_FWD135962639O.conchaphila8/12/2015TTCCTTTTCCCCCACTCAGCJH205559.8918s Ribosomal RNAEF035118.11697392Genbank 18s ribosomal for O. conchaphila
39
169718s_1_REV135962640O.conchaphila8/12/2015CGCTTCACTCGCCGTTACTAJH205560.1818s Ribosomal RNAEF035118.11698392Genbank 18s ribosomal for O. conchaphila
40
1696ILL-BC1137225862NA9/18/2015CAAGCAGAAGACGGCATACGAGAT-CGTGAT-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATChttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
41
1695ILL-HT2137225861NA9/18/2015AATGATACGGCGACCACCGAGATCTACAC-CGTACG-ACACTCTTTCCCTACACGACGCTCTTCCGATCThttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
42
1694ILL-HT1137225860NA9/18/2015AATGATACGGCGACCACCGAGATCTACAC-ATGCAT-ACACTCTTTCCCTACACGACGCTCTTCCGATCThttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
43
1693ILL-Lib2137225863NA9/18/2015CAAGCAGAAGACGGCATACGAhttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
44
1692ILL-Lib1137225866NA9/18/2015AATGATACGGCGACCACCGAhttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
45
16913ILL-NR137225865NA9/18/2015CAGACGTGTGCTCTTCCGATCTNRhttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
46
1690Anti-ILL137225859NA9/18/2015AGATCGGAAGAGC/3InvdT/http://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
47
16895ILL-NR137225864NA9/18/2015CTACACGACGCTCTTCCGATCTNRhttp://people.oregonstate.edu/~meyere/docs/2bRAD_26Aug2014.pdfNANANANANANARAD library construction
48
1688GAPDH_FWDO.lurida7/22/2015TGCTCCTTGCATTTCCGTCAJH205060
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12)
Q6BMK0caattgcattaatcgacaactatatccaaactcattatcataccaggatatcaacttgatcaatttatctccatctttacttgctatttcaatgcacgccttttcgtcaaccaaactactatgcgattcatccattaccccagccaatgtcaaagaatcggtgctatcaactttcaatatatccttcaactcattcttagacgcaacttttatagcttccataacttcattcaatcctaccttcgagttttctaatgtaagtgtcaagtcaacaacagacccacaaatcgttggaactctgaatgccattccggtaagtattccgtttacttcaggcagtacttttccgacagctttggcagcacctgtcgaagcaggaattatgtttgcagctccagagaagcccattcttatgctccttgcatttccgtcaacaataggctgagaaatagtcactgaatgcactgtggtcattaaacctgtttttattttgtacttatcattgacagccttcaccaatggtgctagacagttagtagtgcaggaagcgttgctgattatactctctcctttgtactctttgtcgttcacacctttaacaaacataggaatgtctggagacttggaaggagcgctgagtacaactttggtaacgtctgaagtttggttgtattctttgaggtggtttctagctgtctctgtggttaggaaaacccctgtgcaatctacgacaactttgacgcctgttaatttccagttgattaatgatggactcttctcgtgggtgattttgatagaagatacgagattttctttagtttccttgggattcgcacagcaacgattgtagatgtttaaggattgatttgcttcgtctgctgctgcgtgatatgcaaaacgaccatgag1687221Reference transcriptome Oly Transcriptome V3
49
1687GAPDH_REVO.lurida7/22/2015CGCTCCTTCCAAGTCTCCAGJH206060
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12)
Q6BMK0caattgcattaatcgacaactatatccaaactcattatcataccaggatatcaacttgatcaatttatctccatctttacttgctatttcaatgcacgccttttcgtcaaccaaactactatgcgattcatccattaccccagccaatgtcaaagaatcggtgctatcaactttcaatatatccttcaactcattcttagacgcaacttttatagcttccataacttcattcaatcctaccttcgagttttctaatgtaagtgtcaagtcaacaacagacccacaaatcgttggaactctgaatgccattccggtaagtattccgtttacttcaggcagtacttttccgacagctttggcagcacctgtcgaagcaggaattatgtttgcagctccagagaagcccattcttatgctccttgcatttccgtcaacaataggctgagaaatagtcactgaatgcactgtggtcattaaacctgtttttattttgtacttatcattgacagccttcaccaatggtgctagacagttagtagtgcaggaagcgttgctgattatactctctcctttgtactctttgtcgttcacacctttaacaaacataggaatgtctggagacttggaaggagcgctgagtacaactttggtaacgtctgaagtttggttgtattctttgaggtggtttctagctgtctctgtggttaggaaaacccctgtgcaatctacgacaactttgacgcctgttaatttccagttgattaatgatggactcttctcgtgggtgattttgatagaagatacgagattttctttagtttccttgggattcgcacagcaacgattgtagatgtttaaggattgatttgcttcgtctgctgctgcgtgatatgcaaaacgaccatgag1688221Reference transcriptome Oly Transcriptome V3
50
1686Act_FWDO.lurida7/22/2015GTTCTCCTGTCGGGTGGAAGJH206060ActinP53498cgtcacaaactgggacgacatggaacagttatggcagtacatcttcacgggagtgctaggagtatctcccgaggaatacaatgtactgaattctgaaatctcctttataccaaaagcttgtaaggaagcaatgttacagttattaatggaaaagtttaatgtacaaggctacaacgcccagctgcagggtattttagctgccatggcctacggtcataccagcagcctcattctggaatgtggtgaaggcgttgcacaagcatttcctgtttatgagtcctacgcttttccggactcgataaaaagtatggagatcggtggaaaggacgtcacactgtcgctacagaaactcctatacgaaaagggatattcttttactacacattctgagattgatgcagtgagggagataaagggaaaatattgttctgtacgcccatataactttacttcggacaagatgtcgtcgcaatcagacggagaggacacatacacattaccagacggtcagcaaatagtcattggtgacgaaaggtttgaggctccggaagtcctttttcggtcatccttactaggttacgacacgggtgagcttggagggatccaggatttggtgcacgccgcaatccaggcctgcgattggtcctgccggcgagacctgtattggaatgttctcctgtcgggtggaagcaccttactgccaggttttaaagagaggctttcacaagaactgagcagtaaggcaccgtgtcgtgttaaagtgtgggcggatccaagtcggcgtttcatggtgtggattggcggatccatttacgcctctctgatgttttgtgagaataaatggataactaagagtgaatacaacgaatatggacccaatattattcaccgaaaatgtcaattggccgcgcagacaaacctaacttagtggactacaatactatattgtacatcatcttattttatataaaaaaaaaaaggaggg1685123Reference transcriptome Oly Transcriptome V3
51
1685Act_REVO.lurida7/22/2015CACCATGAAACGCCGACTTGJH205560ActinP53498cgtcacaaactgggacgacatggaacagttatggcagtacatcttcacgggagtgctaggagtatctcccgaggaatacaatgtactgaattctgaaatctcctttataccaaaagcttgtaaggaagcaatgttacagttattaatggaaaagtttaatgtacaaggctacaacgcccagctgcagggtattttagctgccatggcctacggtcataccagcagcctcattctggaatgtggtgaaggcgttgcacaagcatttcctgtttatgagtcctacgcttttccggactcgataaaaagtatggagatcggtggaaaggacgtcacactgtcgctacagaaactcctatacgaaaagggatattcttttactacacattctgagattgatgcagtgagggagataaagggaaaatattgttctgtacgcccatataactttacttcggacaagatgtcgtcgcaatcagacggagaggacacatacacattaccagacggtcagcaaatagtcattggtgacgaaaggtttgaggctccggaagtcctttttcggtcatccttactaggttacgacacgggtgagcttggagggatccaggatttggtgcacgccgcaatccaggcctgcgattggtcctgccggcgagacctgtattggaatgttctcctgtcgggtggaagcaccttactgccaggttttaaagagaggctttcacaagaactgagcagtaaggcaccgtgtcgtgttaaagtgtgggcggatccaagtcggcgtttcatggtgtggattggcggatccatttacgcctctctgatgttttgtgagaataaatggataactaagagtgaatacaacgaatatggacccaatattattcaccgaaaatgtcaattggccgcgcagacaaacctaacttagtggactacaatactatattgtacatcatcttattttatataaaaaaaaaaaggaggg1686123Reference transcriptome Oly Transcriptome V3
52
1684EFG_FWDO.lurida7/22/2015ACCCAAGGACAGGGAGAGTTJH205560
"Elongation factor G, mitochondrial (EF-Gmt) (Elongation factor G 1, mitochondrial) (mEF-G 1) (Elongation factor G1) (Protein iconoclast)"
B3MK91attttacgcacatgtatcgccggtggtgaatgtcaactctgccttatgatcttgtttttataacaggaaaatgacgatccttaaaagattttcaagtgttttacacctttcattaaaaaatggtatcatgttacaaaagttcacaccatgtgcagcctgttcagttaaaacatattcaacacggaaaatgggggatgtaaccttggattcctcaatgatcagaaacattggaatctcagcacacatagactcgggtaaaaccactcttacagagcgccttctgtattacaccgggaaactggcggaaatgcacgaagttcgagggaaagataacgtaggagctaaaatggacttcatggaattagaacgacagcgtggaatcacaattcaatcagcagcaacatatgtaaattggaaaggtacaaacattaacattattgacactcctgggcacgtggacttcacggtcgaggtggagcgtgctctccgcgtgttggacggtgctgtgcttgtgctttgtgcagttggaggagtgcaaagtcagaccattactgtgaatagacagatgaagagatacaacgtgccatgtttagccttcatcaataaactggatagaatgggatccaatcctgtcagagtcttaacacagctgaagtccaaactgaatcacaacgccgagttcatacagttacctataggactggaaaaagaccaagagggagtcgtagatcttattgaaatgaaggcattgtattttggagaaccctctggcctaaatattattgaagatgaaatcccagctcatttaagaacggaagccaaagagagaagacaaaggctaatagaggcagtgtctaatgtggatgatgttttgggagaaatgttcctggaagagaaagagcccacaaatgatgatatcaaggcagctatccgaagatcttgtattaagagggccttcacacccgtgttcctgggaacagctctgaagaacaagggggtacagccattattagatggggtgttagactacctcccgaaccccacagaggtccggaatgagtgtctgaacaacgatgaattggatgaaaatgggaatccatcaaaaatagtcctcagttcagagcgaacaacagataaaccatttgttggattagctttcaaactggaggctgggaagtttggtcagctgacctacatgagagtgtaccaaggggggatgaagaaaggagacaccatcatcaataccagaaacaacaaaaaagtccgggtgtccaggctggttcgaatgaacgctgatgaaatggaggacatcacagaagcctatgcgggagacatctgtgcgttgtttggagtggactgtgctgggggagatacttttgtcaacaaaggcaacacacaactctcattggagtccatgtatgtgccagaccctgttatttccatgtccatcaaactagctaacaaacaagaccaagaaaatttctccaaagggatctcaagatttaccaaggaggatccaacatttagagtggcatttgatccagagttaggagagaccattgccactggaatgggagagttacacctggatatttatgctcagagactggaaagagagtacaaaacaaagtgcattctgggaaaacctaaggtttctttcagagaaacattattacaaccttgcgagtttgattattggcataaaaagcaatcaggtggccgaggagagtacgcccgtgttattggaacagttgagcccttgcctccagacgaaaacacaaaacttatatttaaggaccacactacaggaacgaatattccaaagagctacatcccagccattgaaaggggtttcagaaagtgttatgaaaaaggacctttggcagaacaaaaagtatctggagtcttaatcaagttaaaagatggcgacgcccatgctgtggacagtagtgattgggcatttgaacaagctgccgttcaagcaggcctggacacctacacttacgactgggccatgttggagccgattatgacggtagaagttaacgcccctcaggagttccaaggttctgtcttagcaggacttaccaaaaggaatgctatatttctggggactgattctaacgaaggctacttcacctcctattgtgaggtaccactcaacatgatgttcggctattccacggaattgagaacaatgacccaaggacagggagagttcacaatggagtacagtaaatactgccccgcggcggaggacacggtcagacagctgaccgagagtctggaacaggagagcaacaaggggacacaggagaaaaagagaaagaaaaattaacaacagtgctcataggctcttaatgtttataaattatttatgttttatgaacttatgatgtgaaagatgtgatattgaatgtgtgcctgaatgaaagcaaatgcaagttaggttgttgagtctgagaacataagggatacgatacatgaaataaatggtaaaactatttag1683113Reference transcriptome Oly Transcriptome V3
53
1683EFG_REVO.lurida7/22/2015TGTGTCCCCTTGTTGCTCTCJH205560
"Elongation factor G, mitochondrial (EF-Gmt) (Elongation factor G 1, mitochondrial) (mEF-G 1) (Elongation factor G1) (Protein iconoclast)"
B3MK91attttacgcacatgtatcgccggtggtgaatgtcaactctgccttatgatcttgtttttataacaggaaaatgacgatccttaaaagattttcaagtgttttacacctttcattaaaaaatggtatcatgttacaaaagttcacaccatgtgcagcctgttcagttaaaacatattcaacacggaaaatgggggatgtaaccttggattcctcaatgatcagaaacattggaatctcagcacacatagactcgggtaaaaccactcttacagagcgccttctgtattacaccgggaaactggcggaaatgcacgaagttcgagggaaagataacgtaggagctaaaatggacttcatggaattagaacgacagcgtggaatcacaattcaatcagcagcaacatatgtaaattggaaaggtacaaacattaacattattgacactcctgggcacgtggacttcacggtcgaggtggagcgtgctctccgcgtgttggacggtgctgtgcttgtgctttgtgcagttggaggagtgcaaagtcagaccattactgtgaatagacagatgaagagatacaacgtgccatgtttagccttcatcaataaactggatagaatgggatccaatcctgtcagagtcttaacacagctgaagtccaaactgaatcacaacgccgagttcatacagttacctataggactggaaaaagaccaagagggagtcgtagatcttattgaaatgaaggcattgtattttggagaaccctctggcctaaatattattgaagatgaaatcccagctcatttaagaacggaagccaaagagagaagacaaaggctaatagaggcagtgtctaatgtggatgatgttttgggagaaatgttcctggaagagaaagagcccacaaatgatgatatcaaggcagctatccgaagatcttgtattaagagggccttcacacccgtgttcctgggaacagctctgaagaacaagggggtacagccattattagatggggtgttagactacctcccgaaccccacagaggtccggaatgagtgtctgaacaacgatgaattggatgaaaatgggaatccatcaaaaatagtcctcagttcagagcgaacaacagataaaccatttgttggattagctttcaaactggaggctgggaagtttggtcagctgacctacatgagagtgtaccaaggggggatgaagaaaggagacaccatcatcaataccagaaacaacaaaaaagtccgggtgtccaggctggttcgaatgaacgctgatgaaatggaggacatcacagaagcctatgcgggagacatctgtgcgttgtttggagtggactgtgctgggggagatacttttgtcaacaaaggcaacacacaactctcattggagtccatgtatgtgccagaccctgttatttccatgtccatcaaactagctaacaaacaagaccaagaaaatttctccaaagggatctcaagatttaccaaggaggatccaacatttagagtggcatttgatccagagttaggagagaccattgccactggaatgggagagttacacctggatatttatgctcagagactggaaagagagtacaaaacaaagtgcattctgggaaaacctaaggtttctttcagagaaacattattacaaccttgcgagtttgattattggcataaaaagcaatcaggtggccgaggagagtacgcccgtgttattggaacagttgagcccttgcctccagacgaaaacacaaaacttatatttaaggaccacactacaggaacgaatattccaaagagctacatcccagccattgaaaggggtttcagaaagtgttatgaaaaaggacctttggcagaacaaaaagtatctggagtcttaatcaagttaaaagatggcgacgcccatgctgtggacagtagtgattgggcatttgaacaagctgccgttcaagcaggcctggacacctacacttacgactgggccatgttggagccgattatgacggtagaagttaacgcccctcaggagttccaaggttctgtcttagcaggacttaccaaaaggaatgctatatttctggggactgattctaacgaaggctacttcacctcctattgtgaggtaccactcaacatgatgttcggctattccacggaattgagaacaatgacccaaggacagggagagttcacaatggagtacagtaaatactgccccgcggcggaggacacggtcagacagctgaccgagagtctggaacaggagagcaacaaggggacacaggagaaaaagagaaagaaaaattaacaacagtgctcataggctcttaatgtttataaattatttatgttttatgaacttatgatgtgaaagatgtgatattgaatgtgtgcctgaatgaaagcaaatgcaagttaggttgttgagtctgagaacataagggatacgatacatgaaataaatggtaaaactatttag1684113Reference transcriptome Oly Transcriptome V3
54
1682EF1d_FWDO.lurida7/22/2015GAACTGCCCACTGATTTGCCJH205560Elongation factor 1-delta (EF-1-delta)A5D989acaactgatctggagtttcctgataccatatccaataggcaccagtttcgattgaccccatagtagtccatctgcagtaatctttctgacttcctgatccatcttttccatatctgtttcatcatcccagggctttacatccaaaatcaaactggacttggcaataatagctggtttttttgcttttttggctgcataagctgctaatctttcctgtctgattctgtctgcttcttcatcctcctcatcactaccaaagaggtcgatatcatcatcatcctcctcatcttcggcaggagcagcagctgatttcttgggtacaggagcttgtgtagaaggggttgaacttcctccctcgagcttggatacacggttttctaatctttgaactaaactcttcatatcttccacaacctttttaagatctctgttttctttctctaaggattggactcgcttcatcatctgactactatctcccattgttcctccagatcctccagaattaagaactttttgaatttgttgtctggcttcagctatttcagttttgatagaactgcccactgatttgccactttttttgtccttagcagcttttccagaagagccagctttcgcggttcctgccaggaactcctgataatgtgtctcagcctcttcatacttctgtttgtttctccagactgaatcatgcattagaggattggccattttttggaggtttttttttaaggaaccggcgacgatacaacttcaacgtgtttcaccccacaattgctccaagtaa1681220Reference transcriptome Oly Transcriptome V3
55
1681EF1d_REVO.lurida7/22/2015TGTGGGGTGAAACACGTTGAJH205060Elongation factor 1-delta (EF-1-delta)A5D989acaactgatctggagtttcctgataccatatccaataggcaccagtttcgattgaccccatagtagtccatctgcagtaatctttctgacttcctgatccatcttttccatatctgtttcatcatcccagggctttacatccaaaatcaaactggacttggcaataatagctggtttttttgcttttttggctgcataagctgctaatctttcctgtctgattctgtctgcttcttcatcctcctcatcactaccaaagaggtcgatatcatcatcatcctcctcatcttcggcaggagcagcagctgatttcttgggtacaggagcttgtgtagaaggggttgaacttcctccctcgagcttggatacacggttttctaatctttgaactaaactcttcatatcttccacaacctttttaagatctctgttttctttctctaaggattggactcgcttcatcatctgactactatctcccattgttcctccagatcctccagaattaagaactttttgaatttgttgtctggcttcagctatttcagttttgatagaactgcccactgatttgccactttttttgtccttagcagcttttccagaagagccagctttcgcggttcctgccaggaactcctgataatgtgtctcagcctcttcatacttctgtttgtttctccagactgaatcatgcattagaggattggccattttttggaggtttttttttaaggaaccggcgacgatacaacttcaacgtgtttcaccccacaattgctccaagtaa1682220Reference transcriptome Oly Transcriptome V3
56
1680Flk_HSP70_FWD133870013O.lurida6/9/2015GACCCGGATGTCCAGAGGAAJH2060HSP70 Flankingttctctatttaaataaatttattacaacaataaacataagtaacatttgtataatttgtaaacacattcttcaacacaatatcatccaacaaactaaacgctttgagacaataatttacaaataatcttcattgaaagtactatggcaacttcaaatactagtccacctcttctacagtgggcccctgacctgagtgacccggatgtccagaggaaccgttttggtgtagtttggccatgatgggggaacacactttctgaacctccttcagtttgaattcatactcgtctatttctgccaaggcgttgttgtcgagccaggacagagtttcgctgcacactttggaaatggtctctttgtcttcagactggagtttgtcgccattttcctcgctggcttgtttgatggagaacacgtaggattccagctgatttcgtgctcctatcctctgtcgttgtttttcatcttcttctttgtatttctcagcctcattcaccattctctcgatgtcagccttactaaggcgacctttgtcgttggtgatggtgattcggttgcatttgccagtactcttgtctttggctgagacattcaggattccgttggcatcgatgtcaaattccacttcgatctgtgggacacctcggggtgctggaggaattccgttcagttcaaaagtacccagtttgttattgtctttggtcatcgctcgttcgccctcaaatacctgaatggaaactccaggctggttatcagaataggtggtaaacgtctgagatgccttggttgggattttagcatttcgttcgatgattttggtcatgacacctccggcagtttcaatgcccagagataagggagtgacatctaccaggagaacatctttaatggcatcacttctgtctccctttaaaatggcagcctgaacagcagcaccgtatgccaccgcttcgtctggattaatggacttgttcaattctttgccgcccatgaaatcttgtagcagtttttggatcttaggaattcttgtcgatcctcctaccagaaccacttcgtgaattttggacttgtccaacttggcatccctcagagctttctctaccggctccagggtggcacggaacaaatcggaacacaattcctcgaatctggctcgtgtaattttactgtaaaagtcaattccctcgaagagagagtcaatctctatgttggcttctgcgctgctggacaaagttctcttggcacgttcacaagccgtcctgagtcgtctcagggaacggttgttcttagaaatatctttactgtacttgcgtttaaattcttgaacgaagtgattcaccattcgattgtcaaaatcctcccctcccaaatgagtgtctcctgccgttgaacgaacctcaaatatggatccctcgtctattgtgaggatagacacatcaaaagttccacctcccaggtcaaagatgaggacatttttctcaccagaaatgtttttgtctagtccataagccaaagcggcggccgtgggctcgttcacgatccggagaacgttgagaccggctatcactccggcatccttggtggcctctctctgggcgttattgaaataggcgggcacagtgatgacggcgtcccgaatggactgtcctaggtaggcttctgctgtctccttcatttttgtcagtaccatagaactgatttcctcgggtgtaaatctctttctctcacctttgtgctctacttgaagtctaggttttccaccgtcgttgatgacagtaaaaggccagtgcttcatatcagactgcacgttttcgtcgttgaatttgcgtccaatcagccttttagcgtcgaagattgtattggtggcgttcatggccacctggtttttggctggatccccgatgagtctctctgtgtctgtgaatgccacataactgggcgttgttctgtttccctgatcgttagcaatgatttccactttcccatgttgaaaaacaccgacacaggaaaacgttgttccgagatcaatgccgatcgctggagctttactagccatgattgtttgtaaacacgaaagtgaaagtagctgtccgatataatataatcactcactgtttctcgtgtatcctccttggaacgctttcttctctttgatagctctcgccgatttctgcgtttgtttgacattctagagtcagagctgctcttatatatactattatcgaaagttctggacactgcgagattcatcgctct16791068Flanking primers for primer SR_ID
57
1679Flk_HSP70_REV133870014O.lurida6/9/2015TCAGGACGGCTTGTGAACGJH196016801068Flanking primers for primer SR_ID
58
1678Flk_Actin_FWD133870015O.lurida6/9/2015TCGAGGGAGGAAGAGGAAGCJH2059Actin Flankingttttttttttaattttattggtttttaattggtgatttttttcacatttttttttttcagtacaaaaaaatatcaacgattggaatcttagacaacgtcagtgtaaatcagatcttgtcttcagatctacgcaccattatgatcagtcagcgcacccagcactgcaagggactttggcgaaaaatgaccgtttgtgtgactagaaaatattggcaaataagtctaaaaacacttcctgtggacaatggatggaccagattcatcgtattcctgtttgctgatccacatctgttggaaggtggagagagaagcaaggatggaaccaccgatccagacggagtatttcctctctggtggggcaatgatcttgatcttcatggtgcttggagcaagagcggtgatttccttctgcatacggtcagcaatacctgggaacatggtggtacctccggagaggacggtgttggcgtacagatccttacggatgtcgacgtcgcacttcatgatggaattgtaggtggtttcatggataccagcagattccatacccaagaaggatggctggaagagggactctgggcaacggaatctctcgttaccgatggtgatgacctgaccgtcgggaagctcgtagctcttctcgagggaggaagaggaagcggcggtggccatttcctgctcgaagtcgagggcgacatagcagagtttctccttgatgtctctgacgatctctctctcggcggtggttgtgaatgaataaccacgctcggtgaggatcttcatgaggtagtcagtaagatcacgaccagccaaatccagacgaaggatagcgtggggaagggcgtaaccttcgtagatggggacagtgtgggtgacaccatcaccggagtcaagcacgataccagtggtacgaccggaagcgtacagggacagcacggcctggatggcgacgtacatggcgggagcgttgaaggtctcgaacatgatctgtgtcatcttttctctgttggccttggggttgagtggggcctcggtcaggaggacggggtgttcctctggggccacacggagttcattgtagaaggtgtgatgccagattttctccatgtcgtcccagttggtgacgataccgtgttcaatggggtacttgagggtgaggattcctctcttgctctgggcctcgtctcctacatagctgtctttctgtcccataccaaccattacaccctgatgtctgggtcgtccaacaatggaggggaacacggccctgggggcatcgtctccggcgaatccggccttgcacattccagatccattgtcgataactaaagctgcaacgtcttcgtcacccattatgagttctgtgtgtttgattgtcaaaaggtaagacaggtaatcgtcactattcggtctctcgaatctaag1677479Flanking primers for primer SR_ID
59
1677Flk_Actin_REV133870016O.lurida6/9/2015AACTGGGACGACATGGAGAAJH20611678479Flanking primers for primer SR_ID
60
1676Flk_TLR_FWD133561907O.lurida6/1/2015GCAATAGCTTGTCACCGCCJH2059TLR2.1 FlankingQ9DD781675425Flanking primers for primer SR_ID 1630
61
1675Flk_TLR_REV133561908O.lurida6/1/2015TCTAGTATGCGCTTCGTTTGCJH2059Q9DD781676425Flanking primers for primer SR_ID 1629
62
1674Flk_CRAF_FWD133561909O.lurida6/1/2015GGACATCCAGTGGCAACATTCJH2160CRAF1 FlankingQ608031673423Flanking primers for primer SR_ID 1636
63
1673Flk_CRAF_REV133561910O.lurida6/1/2015CCAGGACATTAGGCTTGCTGAJH2160Q608031674423Flanking primers for primer SR_ID 1635
64
1672Flk_PGRP_FWD133561911O.lurida6/1/2015AGCTGGTGCAGTCCTATCAGJH2059PGRP-S FlankingO755941671450Flanking primers for primer SR_ID 1632
65
1671Flk_PGRP_REV133561912O.lurida6/1/2015TGTGTATGAAAAGTAATGAAGAGCAJH2557O755941672450Flanking primers for primer SR_ID 1631
66
1670Flk_CARM_FWD133561913O.lurida6/1/2015TTCACACAGCCCATTGTGGATJH2160CARM1 FlankingQ6DC041669638Flanking primers for primer SR_ID 1642
67
1669Flk_CARM_REV133561914O.lurida6/1/2015TGGGATGGGTCAGATAAACCTJH2158Q6DC041670638Flanking primers for primer SR_ID 1641
68
1668Flk_BMP2_FWD133561915O.lurida6/1/2015GGCTGGCTGGATCGTCATJH1860BMP2 FlankingP126431667676Flanking primers for primer SR_ID 1640
69
1667Flk_BMP2_REV133561916O.lurida6/1/2015ATGGAGTCTGTGGACGGTTTGJH2160P126431668676Flanking primers for primer SR_ID 1639
70
1666Flk_HSPb11_FWD133561917O.lurida6/1/2015AGAATTGTCTGTGGAATCGAGCJH2259HSPb11 FlankingQ9Y5471665323Flanking primers for primer SR_ID 1650
71
1665Flk_HSPb11_REV133561918O.lurida6/1/2015ATCAACGCCAGGGGAACTTGJH2061Q9Y5471666323Flanking primers for primer SR_ID 1649
72
1664Flk_PGE/EP4_FWD133561919O.lurida6/1/2015GCTCAACGAATTGCTCTACTCCJH2259PGE/EP4 FlankingP322401663654Flanking primers for primer SR_ID 1638
73
1663Flk_PGE/EP4_REV133561920O.lurida6/1/2015TCCGTCTGCTTTTTAGAATGGTAJH2358P322401664654Flanking primers for primer SR_ID 1637
74
1662Flk_GABABR_FWD133561921O.lurida6/1/2015GAGGAGGACACGAAACTCCGJH2060GABABR FlankingQ9WV181661558Flanking primers for primer SR_ID 1620
75
1661Flk_GABABR_REV133561922O.lurida6/1/2015TGCACCACACTCCTGATGACJH2060Q9WV181662558Flanking primers for primer SR_ID 1619
76
1660Flk_GRB2_FWD133561923O.lurida6/1/2015TCAGAACTGGTTCAAAGCTGAGTJH2360GRB2 FlankingP629941659695Flanking primers for primer SR_ID 1612
77
1659Flk_GRB2_REV133561924O.lurida6/1/2015ACTGCGCTGACATACTGGACJH2060P629941660695Flanking primers for primer SR_ID 1611
78
1658Flk_H3.3_FWD133561925O.lurida6/1/2015CCAATGACAAATGAGCCACACAAJH2360H3.3 FlankingQ6P8231657552Flanking primers for primer SR_ID 1610
79
1657Flk_H3.3_REV133561926O.lurida6/1/2015TCGTACAAAGCAAACTGCACGJH2160Q6P8231658552Flanking primers for primer SR_ID 1609
80
1656Flk_H2A.V_FWD133561927O.lurida6/1/2015GCGATGGAGTTGATGAGGTGJH2059H2A.V FlankingP089911655487Flanking primers for primer SR_ID 1608
81
1655Flk_H2A.V_REV133561928O.lurida6/1/2015CAAGGCAGTTTCTCGTTCGGJH2059P089911656487Flanking primers for primer SR_ID 1607
82
1654Flk_H2A_FWD133561929O.lurida6/1/2015TGCTGGGGTTTTTCTGGGTCJH2060H2A FlankingP022701653373Flanking primers for primer SR_ID 1606
83
1653Flk_H2A_REV133561930O.lurida6/1/2015TCAGGACGTGGTAAAGGAGGAJH2160P022701654373Flanking primers for primer SR_ID 1605
84
1652Flk_p29ING_FWD133561931O.lurida6/1/2015GTGGACACACATGCACTCCTJH2060p29ING4 FlankingQ8C0D71651514Flanking primers for primer SR_ID 1624
85
1651Flk_p29ING_REV133561932O.lurida6/1/2015AAGCAGACTCAGATTCAGGCJH2058Q8C0D71652514Flanking primers for primer SR_ID 1623
86
1650Hspb11_FWD133210733O.lurida5/21/2015ATGTTTCCTGGTCTCCGTCAJH2055
Heat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25)
Q9Y547ttccataagcctcctattttattgtcaaataaatatgtttcctttccaaaatgaacaaacatgatgtagaaataatcataagggccacatcctttcactaacaattgacatcatattgacactttatttcaactttaaataccagtaaatgtatgtacacaaaacagatttctgacagaaatgaagaaagacggtatcttaaggtgtagaaatttgttcatccatgaacagcatttccagtgataccaagtctgtgcacagatacaaagtggtcataaccgctttcaatgatgactctcatgtgagtggctcttttattgtttgctgggaattcctcttgctgaagagaattgtctgtggaatcgagctctttttccaacaagtcttcaaaatttgttggatcagtttctttactggtttcaaatgatattttctttacattacaacacgctatttcaatacgctgtatactcatcatagaaggaaaggtgatgatgaattcttgtgggaaaagaccagtagatgcccaaaatgtttcctggtctccgtcaatgatgttttcaggtggatgattcccatcactagaagtcgctaagacaacctgcgctccagcacttttcagagcaacatcaaacatttcaatttgcaacaagttcccctggcgttgatggcaacaaaatatttcatcaatgttatttgggcomp9638_c0_seq11649139Reference transcriptome Oly Transcriptome V3
87
1649Hspb11_REV133210734O.lurida5/21/2015CATCAACGCCAGGGGAACTTJH2055
Heat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25)
Q9Y547ttccataagcctcctattttattgtcaaataaatatgtttcctttccaaaatgaacaaacatgatgtagaaataatcataagggccacatcctttcactaacaattgacatcatattgacactttatttcaactttaaataccagtaaatgtatgtacacaaaacagatttctgacagaaatgaagaaagacggtatcttaaggtgtagaaatttgttcatccatgaacagcatttccagtgataccaagtctgtgcacagatacaaagtggtcataaccgctttcaatgatgactctcatgtgagtggctcttttattgtttgctgggaattcctcttgctgaagagaattgtctgtggaatcgagctctttttccaacaagtcttcaaaatttgttggatcagtttctttactggtttcaaatgatattttctttacattacaacacgctatttcaatacgctgtatactcatcatagaaggaaaggtgatgatgaattcttgtgggaaaagaccagtagatgcccaaaatgtttcctggtctccgtcaatgatgttttcaggtggatgattcccatcactagaagtcgctaagacaacctgcgctccagcacttttcagagcaacatcaaacatttcaatttgcaacaagttcccctggcgttgatggcaacaaaatatttcatcaatgttatttgggcomp9638_c0_seq11650139Reference transcriptome Oly Transcriptome V3
88
1648GDF-8_FWD133210735O.lurida5/21/2015CCGTGGATGTCGCAGAAAGAJH2055
Growth/differentiation factor 8 (GDF-8) (Myostatin) (Myostatin-1) (zfMSTN-1) (Myostatin-B)
O42222aacatactaagttaaattcagctcctacaaatgaagttgaaataaaaattttcagctataaccaaatagtagaaacattaatagaatccaggacaatagatgtgagtagagatggctgggaaatatttgacattacccaagtcgtcagagactgggtcgataacccagaattaaataatggagtagaaatttatgcaggcggtctcaatgccggtcaattactttttccctccgtggatgtcgcagaaagaaagagctcaaaatataatagaacagcaaccagacacaatgttgtggtaccaattctggaaatgaagactcatgaacgttcgatattaaaacgtgtcaaacgacaaaataacattgagaggagagattgtgtcaaaggggacggagaaagcagatgctgtcgctttacaacgacaattgacttcgctgatttgggctgggacgactggatactcgcaccacaacattatgaagcgcattattgcgatggaagttgtcccgatcgctttaaaatggccaacacgttcgcgggaatacaggccagacttcacgctttatatcctagcaaatttccgaaaccgtgttgcgttccatcaaaacttagcccacttacaattcttcataaagacagcgatggaaaatatcagttcacggactatcccgacatggtcgtcgaggactgcaagtgcgcatgacaggaaccttatgcttatttgtgaattatccttttgtgttcaataattaaagccaaaaacgttcccgactttgtgtgtcaacattgctttgactcaacttcatgctcgcacaaagggtaatgaatgtaataactttcaaaatgctactgttaaaaatcgcgcaagtcaacaatctactcaatgccttttttactttgttatttctatactctgctgttgagttccaagatggctgtgttaatttcgttagagggacaatttgcaagcccagtaaaaagcaacgatccttttcgtaggtgatattttacacaagtcaattactatgtggttttcgcatatttttcgcaaatgtaattttttttatgtgttcaaacgtacaagagtctatatctttactcgtaaagagcaatgaaagtgcatatggaccaattttcggagaccgaagagaatctcatgtttgtgcacgatatctgtgatcttgatatgcgtgtatttatatgtgtgaatgttatatgaatgctatatgtatgttcagtcomp9524_c1_seq11647172Reference transcriptome Oly Transcriptome V3
89
1647GDF-8_REV133210736O.lurida5/21/2015CTGCTTTCTCCGTCCCCTTTJH2055
Growth/differentiation factor 8 (GDF-8) (Myostatin) (Myostatin-1) (zfMSTN-1) (Myostatin-B)
O42222aacatactaagttaaattcagctcctacaaatgaagttgaaataaaaattttcagctataaccaaatagtagaaacattaatagaatccaggacaatagatgtgagtagagatggctgggaaatatttgacattacccaagtcgtcagagactgggtcgataacccagaattaaataatggagtagaaatttatgcaggcggtctcaatgccggtcaattactttttccctccgtggatgtcgcagaaagaaagagctcaaaatataatagaacagcaaccagacacaatgttgtggtaccaattctggaaatgaagactcatgaacgttcgatattaaaacgtgtcaaacgacaaaataacattgagaggagagattgtgtcaaaggggacggagaaagcagatgctgtcgctttacaacgacaattgacttcgctgatttgggctgggacgactggatactcgcaccacaacattatgaagcgcattattgcgatggaagttgtcccgatcgctttaaaatggccaacacgttcgcgggaatacaggccagacttcacgctttatatcctagcaaatttccgaaaccgtgttgcgttccatcaaaacttagcccacttacaattcttcataaagacagcgatggaaaatatcagttcacggactatcccgacatggtcgtcgaggactgcaagtgcgcatgacaggaaccttatgcttatttgtgaattatccttttgtgttcaataattaaagccaaaaacgttcccgactttgtgtgtcaacattgctttgactcaacttcatgctcgcacaaagggtaatgaatgtaataactttcaaaatgctactgttaaaaatcgcgcaagtcaacaatctactcaatgccttttttactttgttatttctatactctgctgttgagttccaagatggctgtgttaatttcgttagagggacaatttgcaagcccagtaaaaagcaacgatccttttcgtaggtgatattttacacaagtcaattactatgtggttttcgcatatttttcgcaaatgtaattttttttatgtgttcaaacgtacaagagtctatatctttactcgtaaagagcaatgaaagtgcatatggaccaattttcggagaccgaagagaatctcatgtttgtgcacgatatctgtgatcttgatatgcgtgtatttatatgtgtgaatgttatatgaatgctatatgtatgttcagtcomp9524_c1_seq11648172Reference transcriptome Oly Transcriptome V3
90
1646HSP70b_FWD133210737O.lurida5/21/2015AAGTACCTTGGGGAGCTTGCJH2055Heat shock 70 kDa protein 12BQ96MM6ctccgggctccaatcggaactcctcggaatgctcgtggcgagttccgatcgcttaggcctacgcgtacgtttgcatgggcatgttttcaaaaatttcaaaaatttccacagtaaaagtattagtcaaaataatttcttatcaaaaatgagcaggtgctaaagctttcttagcgaaaacttttattagatcgaagagggaagtatatttatgtaggtcagttggccttcctaccactctttgaaccagccttaccaggattaaaatgtcagatctaaatagttccgtgagatcaaaatgcagaaagctcttcgtagcagccatcgattttggaactacttactctggttatgcattttctgccacatctgattggtccaaagttttgaccagtaactggacaggagggaaggttgtcactctgaagacgccgacagctctgctgctggattcagacaaggagttcatggcatttggatatgaggccgaggatcagtatttagacttggctcgagatgacgaacacgaggattattatttctttcatcgatttaaaatgattcttcattcagaaaaagcaccaatcagtcgaaaaacaaagctaaaggatgccacaggtaaagaaattgaagctataaaagttttcaaactctcaataaaatatcttgtgggggacttgatgaaaactttgagaaacagctacccggatttaaaggactcagatgtggagtatattatcactgttccggctatttgggacgatcgatcaaagcagttcatgagggaagctgctcgagaggctgggattgacaaatcttccttgaccattgccttagaaccagaggctgcatccattcattgtcagtatttaccagccaaaaacctcaacctgtccacttccaagtaccttggggagcttgctgttggggacaaatatttagttgccgatttaggaggtggcaccgcagatataacagtgcatcacaaagttgatgacggatctttggaggaaatgatggaagcaagcggtggaccttggggaggaaagtctgtggatgacgaatttgagaattatattcaggaaattattggagaaaaatccatgaaggagttaaagaaatcctgtttcgatgattacttggaactaatgaggaacttcgaattcaagaagagatccgctaagcctggaaaagaaggcaatacacatctgtctgttccactgggtcttgtgcaaattgttaagaaagacaaatcacgaaaatctatggagaatgccattgaaaattctccacatgcaggaaaagtcactttcgagaactggaagttgaaatggaaaaatgaagatttccttcggttctttgaaagcacaatcaagaaaattaaagaccatatacggacaatattgttcgatagtgatatgggaagtgtagaaactattctaatggttgggggttttgccgaatgcgaagtggtccaaaagtcggtgagagagtctttcaagatgaaacgcgttgttgttccagaagatgctggtatttctgtattaaaaggcgccgtatattttggacacattccagatgcaatatctagacgaacagctcgatatacgtatggtatccaaagctggcccgcattcaacgcaaccaaacatcccgaaaacaagaaagttgaagtgaacggtaaagctagatgtaaagatgttttcttcaaatacataactaagggacaacatttaactgttggatatcagaaatcacagatttttcaagccttaaacccgaaagagaaaaaactggagtgtgcaatatacatctccgacagcaaagatccccaattcgtagacgatcctggatgtcatcgacttggcgttttggttatccccttgccggatctaccagatggcgcatcgatcgaattagaggaaagtatgatttttggcgaaacagaattgcaacttcaagctaaagatatatactctggaaagtcgtacgaagtacagttagatcttttagcagaaccttcagaggagaccgattagagatacagtattcaatatgaatttacacaatgttggagatttacgtgtctaacttagaattggcgagtttttgacatactaaaggcagtaaagactaataaatgttagctcattagaccaaaatcgttcaaactaaatatgtattcatagtatgcatgttctacctactattagaatacattgattgaatgtgctctatgtgaaataaatgtattaaatgttaaaacgtactgtttgtagtttgtctttcccatctttactagacgtattgttatagaaaattatttaaatgacgatgcatacaagaaaagttgcacattgtttattaataaagtggggtcttggtggagtggaggatacattgacttcacaattgttagaaaaatctttagagatgttataatccctaccctcaaaattgtaccttggaaaggggaggagaaggctcatattcctttactacataggtttaattcctctgttcaagcttaaatttgtaccattcaattctaatatgcomp9280_c0_seq11645155Reference transcriptome Oly Transcriptome V3
91
1645HSP70b_REV133210738O.lurida5/21/2015TCCACAGACTTTCCTCCCCAJH2055Heat shock 70 kDa protein 12BQ96MM6ctccgggctccaatcggaactcctcggaatgctcgtggcgagttccgatcgcttaggcctacgcgtacgtttgcatgggcatgttttcaaaaatttcaaaaatttccacagtaaaagtattagtcaaaataatttcttatcaaaaatgagcaggtgctaaagctttcttagcgaaaacttttattagatcgaagagggaagtatatttatgtaggtcagttggccttcctaccactctttgaaccagccttaccaggattaaaatgtcagatctaaatagttccgtgagatcaaaatgcagaaagctcttcgtagcagccatcgattttggaactacttactctggttatgcattttctgccacatctgattggtccaaagttttgaccagtaactggacaggagggaaggttgtcactctgaagacgccgacagctctgctgctggattcagacaaggagttcatggcatttggatatgaggccgaggatcagtatttagacttggctcgagatgacgaacacgaggattattatttctttcatcgatttaaaatgattcttcattcagaaaaagcaccaatcagtcgaaaaacaaagctaaaggatgccacaggtaaagaaattgaagctataaaagttttcaaactctcaataaaatatcttgtgggggacttgatgaaaactttgagaaacagctacccggatttaaaggactcagatgtggagtatattatcactgttccggctatttgggacgatcgatcaaagcagttcatgagggaagctgctcgagaggctgggattgacaaatcttccttgaccattgccttagaaccagaggctgcatccattcattgtcagtatttaccagccaaaaacctcaacctgtccacttccaagtaccttggggagcttgctgttggggacaaatatttagttgccgatttaggaggtggcaccgcagatataacagtgcatcacaaagttgatgacggatctttggaggaaatgatggaagcaagcggtggaccttggggaggaaagtctgtggatgacgaatttgagaattatattcaggaaattattggagaaaaatccatgaaggagttaaagaaatcctgtttcgatgattacttggaactaatgaggaacttcgaattcaagaagagatccgctaagcctggaaaagaaggcaatacacatctgtctgttccactgggtcttgtgcaaattgttaagaaagacaaatcacgaaaatctatggagaatgccattgaaaattctccacatgcaggaaaagtcactttcgagaactggaagttgaaatggaaaaatgaagatttccttcggttctttgaaagcacaatcaagaaaattaaagaccatatacggacaatattgttcgatagtgatatgggaagtgtagaaactattctaatggttgggggttttgccgaatgcgaagtggtccaaaagtcggtgagagagtctttcaagatgaaacgcgttgttgttccagaagatgctggtatttctgtattaaaaggcgccgtatattttggacacattccagatgcaatatctagacgaacagctcgatatacgtatggtatccaaagctggcccgcattcaacgcaaccaaacatcccgaaaacaagaaagttgaagtgaacggtaaagctagatgtaaagatgttttcttcaaatacataactaagggacaacatttaactgttggatatcagaaatcacagatttttcaagccttaaacccgaaagagaaaaaactggagtgtgcaatatacatctccgacagcaaagatccccaattcgtagacgatcctggatgtcatcgacttggcgttttggttatccccttgccggatctaccagatggcgcatcgatcgaattagaggaaagtatgatttttggcgaaacagaattgcaacttcaagctaaagatatatactctggaaagtcgtacgaagtacagttagatcttttagcagaaccttcagaggagaccgattagagatacagtattcaatatgaatttacacaatgttggagatttacgtgtctaacttagaattggcgagtttttgacatactaaaggcagtaaagactaataaatgttagctcattagaccaaaatcgttcaaactaaatatgtattcatagtatgcatgttctacctactattagaatacattgattgaatgtgctctatgtgaaataaatgtattaaatgttaaaacgtactgtttgtagtttgtctttcccatctttactagacgtattgttatagaaaattatttaaatgacgatgcatacaagaaaagttgcacattgtttattaataaagtggggtcttggtggagtggaggatacattgacttcacaattgttagaaaaatctttagagatgttataatccctaccctcaaaattgtaccttggaaaggggaggagaaggctcatattcctttactacataggtttaattcctctgttcaagcttaaatttgtaccattcaattctaatatgcomp9280_c0_seq11646155Reference transcriptome Oly Transcriptome V3
92
1644GRP-78_FWD133210739O.lurida5/21/2015GAGAAACCACGCAGGGAGAAJH2055
78 kDa glucose-regulated protein (GRP-78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP)
Q90593atcaaccaaagacgaatttatagactaacttcaacgaaattaccaaattgttttccattgtccatttacagaacagataatacatatcaaactgaactatagctaggatacaatatacggcattaagttacaatcatcataaaaatgagaaaccacgcagggagaatggtggtcagcctaattctaacattggcgctgctaactgccgccgcatcaacgtcatcttccgacgatagggcggatcccgtgataggaatagacctgggaaccacatattcttgtgttggaatattcaaagacggccatgttgaaatccttccgaatgagcaaggaaaccgaataacgccatcttacgttgccttcgatgctgatggcgacagacttataggagacgccgctaaaaatcaactgacgtcaaaccccaaaaatacaatctttgacgttaaacgattcattggacgagaatgggacgatccaacagtacagaaagatgtgcaatattatccgttcagcctcttgaagaaacacaacaagccctacatccgagtacttgtaggcgaacaagaaagagtgtttgcaccagaagaaatttccgccatggtgctggggaaaatgaaggaaatagccgaggggtatctgaagcaaaacgtcacgcgtgctgtaatcaccgtcccggcgtattttaacgacgctcaacgtcaggcaacgaaggatgctggtacaatagcagggttagaggtgctccgaatcatcaatgaaccaaccgcggctgccatcgcttatggtctaaacaaaaacggaggagaaaagaccgtcttggtatttgacttgggaggaggtacgttcgatgtgtcgcttttgacaattgaccaaggagtgttcgaagttgttgcaaccaatggcaacaaccatcttggaggagaagacttcgaccagagagtaatggatttcctgatcaagaaacacaagaaatctacaaatatggatttacgaaaggacgcccgtgccctacagaagttacgccgagaggtagaaaaggccaagcgaacactctcctatcgtcacgaagcacgtattgaaatagagtctctaatgaatggcgaagacttcttttacactctcacgagagccaagtttgaggaactgaacatggatttattccgatcaactttaaatcccgttaaacaagttctgaaggacggtgatatgaaagcctccgatgttgatgaaatcatactcgtgggcggatccacacgtattcccaaaatacagcaacttgtcaaggaattcttcggcggaaaggagcccagtcgtggtgttaacccagacgaatcggtggcctatggtgctgctgttcagggggcagttctaagtggagcagatgaaactggtgacgtgcttgttgtggacgttaaccctctcaccctgggaatagagacagttggtggcgtcatgactaaactgattccacgtaactcccccattcctaaccggaagtcacaaatattttctacagcagccgacaaccagccaacagtgaccattcaggtattcgaaggtgaacgacccatgacaaaacataaccaccttttggggacattcgagttgactgggataccacctgctccgagaggagttcctcaaattgaagtcacttttgaaatagatgcaaacagtattttgacagtatcagcagaagacaaggggaccggaagtaagaataagattacaattcaaaatgacaacaatagaatatctccggatgaaatagaaaaaatgattaaagacgctgaaaagtttggcgacgaagacaaaaaagccaaagaaatcattgacgctaagaatgaactagagcattttgcatattcgcttaaaaaccagttaagtgataaagggcaactcaaagataaactcggtgatgaagataaaactacaatccgagaggcagtggagtctacgattggctggattgagtccaatcctgacgcggaacttgatgatctcaaggcaaagaaggccgagttagagaatatagtacaaccaatcacgagcaaactttaccaaggaaatccaagttcaaaggccgacgaccgagaggggctttaatgaaaggctttcctttatacaatcggctgggccctgatctgtgatattgataagaaaatgtcccgtcactatttattgccatatctcatttatatcattccgtgcaatgctgtacattgttgattttattgtttgttcagtattttttatattaataaataaaacggtgaacomp8243_c0_seq11643227Reference transcriptome Oly Transcriptome V3
93
1643GRP-78_REV133210740O.lurida5/21/2015CATCAGCATCGAAGGCAACGJH2055
78 kDa glucose-regulated protein (GRP-78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP)
Q90593atcaaccaaagacgaatttatagactaacttcaacgaaattaccaaattgttttccattgtccatttacagaacagataatacatatcaaactgaactatagctaggatacaatatacggcattaagttacaatcatcataaaaatgagaaaccacgcagggagaatggtggtcagcctaattctaacattggcgctgctaactgccgccgcatcaacgtcatcttccgacgatagggcggatcccgtgataggaatagacctgggaaccacatattcttgtgttggaatattcaaagacggccatgttgaaatccttccgaatgagcaaggaaaccgaataacgccatcttacgttgccttcgatgctgatggcgacagacttataggagacgccgctaaaaatcaactgacgtcaaaccccaaaaatacaatctttgacgttaaacgattcattggacgagaatgggacgatccaacagtacagaaagatgtgcaatattatccgttcagcctcttgaagaaacacaacaagccctacatccgagtacttgtaggcgaacaagaaagagtgtttgcaccagaagaaatttccgccatggtgctggggaaaatgaaggaaatagccgaggggtatctgaagcaaaacgtcacgcgtgctgtaatcaccgtcccggcgtattttaacgacgctcaacgtcaggcaacgaaggatgctggtacaatagcagggttagaggtgctccgaatcatcaatgaaccaaccgcggctgccatcgcttatggtctaaacaaaaacggaggagaaaagaccgtcttggtatttgacttgggaggaggtacgttcgatgtgtcgcttttgacaattgaccaaggagtgttcgaagttgttgcaaccaatggcaacaaccatcttggaggagaagacttcgaccagagagtaatggatttcctgatcaagaaacacaagaaatctacaaatatggatttacgaaaggacgcccgtgccctacagaagttacgccgagaggtagaaaaggccaagcgaacactctcctatcgtcacgaagcacgtattgaaatagagtctctaatgaatggcgaagacttcttttacactctcacgagagccaagtttgaggaactgaacatggatttattccgatcaactttaaatcccgttaaacaagttctgaaggacggtgatatgaaagcctccgatgttgatgaaatcatactcgtgggcggatccacacgtattcccaaaatacagcaacttgtcaaggaattcttcggcggaaaggagcccagtcgtggtgttaacccagacgaatcggtggcctatggtgctgctgttcagggggcagttctaagtggagcagatgaaactggtgacgtgcttgttgtggacgttaaccctctcaccctgggaatagagacagttggtggcgtcatgactaaactgattccacgtaactcccccattcctaaccggaagtcacaaatattttctacagcagccgacaaccagccaacagtgaccattcaggtattcgaaggtgaacgacccatgacaaaacataaccaccttttggggacattcgagttgactgggataccacctgctccgagaggagttcctcaaattgaagtcacttttgaaatagatgcaaacagtattttgacagtatcagcagaagacaaggggaccggaagtaagaataagattacaattcaaaatgacaacaatagaatatctccggatgaaatagaaaaaatgattaaagacgctgaaaagtttggcgacgaagacaaaaaagccaaagaaatcattgacgctaagaatgaactagagcattttgcatattcgcttaaaaaccagttaagtgataaagggcaactcaaagataaactcggtgatgaagataaaactacaatccgagaggcagtggagtctacgattggctggattgagtccaatcctgacgcggaacttgatgatctcaaggcaaagaaggccgagttagagaatatagtacaaccaatcacgagcaaactttaccaaggaaatccaagttcaaaggccgacgaccgagaggggctttaatgaaaggctttcctttatacaatcggctgggccctgatctgtgatattgataagaaaatgtcccgtcactatttattgccatatctcatttatatcattccgtgcaatgctgtacattgttgattttattgtttgttcagtattttttatattaataaataaaacggtgaacomp8243_c0_seq11644227Reference transcriptome Oly Transcriptome V3
94
1642CARM1_FWD133210741O.lurida5/21/2015TGGTTATCAACAGCCCCGACJH2055
Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
Q6DC04gagaaaatggcgtcaacttttgacaacgtgcaagtcgccgttctcacagaaaagtacaatttcaagtttctcacagatgatccgctcattcttgatatatcacaccaaggagactgtgttatgctccagtttcacaaagacaaagttcctgtacacaccttgtcagtaaacaacgacacagaacatgccaggatgggatcacagagtatcatcttcacacgagacaaggacacaacactggtccattttcctagtgttcacaatatgaaacagtttcagtttcgactgaatgaactgaaagatggattaaaatctgtcttcagtgatagaacagatgcagcctcagcagttcaatatttccaattttatggatacctctcacagcaacagaacatgatgcaagactatatcagaacgtccacgtaccagagggcaatgctggcaaacttaatagatttccatgacaaggttgtgttagatgttggtgctggatcaggaattctgtcgttttttgccgtccaggctggagcaagaaaagtgtacgccatagaggccagcagtatggctacacactgtcagacactggttgcacagaataaattgtccgacaaaattgttgtgatccctggtaaggtggaagatgtggagatccctgagccggtggacaccattatatcagaacccatggggtacatgctgtttaacgagagaatgctggaaagctaccttcacgccaaaaaatggctgaagcccagaggaaagatgtttccttctcagggagatttacatatagctccgttcacagatgaagccctctatctggagcagttctctaaggctaatttttggtatcagcaatcattccatggaattgatttgtctagtttacgcagtgcagctgtcaaagaatacttcacacagcccattgtggatactttcgatgtaaggatatgtctggcaaaatctgtcaaacacaccgtggacttccagacggcggaggagactgacctacacaacattgagatccccctcacgttcagcatgcacgagtcggggctcgttcacggtctcgccttctggtttgatgtggcctttttgggatcagtagagcctgtttggttatcaacagccccgacagagactctgacacattggtatcaggttaggtgtctggtggaaacaccggtcctcgtcaaacaaggacagactctcaatggaaaatgtgtgctcaggtgcaacaaaagacagagttatgatgttgatattgaactgaacatcccaggaacaacctcaaagtccacaaacacactggatcttaaaaatccattttttcgttacacgggtcagacaccacctgctcctcctggggtcaacaactcttcccccacggaaacctactggaataatctggcgacaggccagactgtatacatgaatggactggttaatggggacaccaatgctgcacagcttctaagccaccagggagttattcaacaaaatctcatcccagtctgtacgttgatttcaggtttatctgacccatcccaaagactttattgaatactttacagaacaacagatttttacattacagaacaacagatttttatctgtttatttaataatgaaatacttgtacaatgtatatatgtgtatgaaaattttctatcaaataaagcomp7220_c0_seq21641261Reference transcriptome Oly Transcriptome V3
95
1641CARM1_REV133210742O.lurida5/21/2015GTTGTTGACCCCAGGAGGAGJH2055
Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
Q6DC04gagaaaatggcgtcaacttttgacaacgtgcaagtcgccgttctcacagaaaagtacaatttcaagtttctcacagatgatccgctcattcttgatatatcacaccaaggagactgtgttatgctccagtttcacaaagacaaagttcctgtacacaccttgtcagtaaacaacgacacagaacatgccaggatgggatcacagagtatcatcttcacacgagacaaggacacaacactggtccattttcctagtgttcacaatatgaaacagtttcagtttcgactgaatgaactgaaagatggattaaaatctgtcttcagtgatagaacagatgcagcctcagcagttcaatatttccaattttatggatacctctcacagcaacagaacatgatgcaagactatatcagaacgtccacgtaccagagggcaatgctggcaaacttaatagatttccatgacaaggttgtgttagatgttggtgctggatcaggaattctgtcgttttttgccgtccaggctggagcaagaaaagtgtacgccatagaggccagcagtatggctacacactgtcagacactggttgcacagaataaattgtccgacaaaattgttgtgatccctggtaaggtggaagatgtggagatccctgagccggtggacaccattatatcagaacccatggggtacatgctgtttaacgagagaatgctggaaagctaccttcacgccaaaaaatggctgaagcccagaggaaagatgtttccttctcagggagatttacatatagctccgttcacagatgaagccctctatctggagcagttctctaaggctaatttttggtatcagcaatcattccatggaattgatttgtctagtttacgcagtgcagctgtcaaagaatacttcacacagcccattgtggatactttcgatgtaaggatatgtctggcaaaatctgtcaaacacaccgtggacttccagacggcggaggagactgacctacacaacattgagatccccctcacgttcagcatgcacgagtcggggctcgttcacggtctcgccttctggtttgatgtggcctttttgggatcagtagagcctgtttggttatcaacagccccgacagagactctgacacattggtatcaggttaggtgtctggtggaaacaccggtcctcgtcaaacaaggacagactctcaatggaaaatgtgtgctcaggtgcaacaaaagacagagttatgatgttgatattgaactgaacatcccaggaacaacctcaaagtccacaaacacactggatcttaaaaatccattttttcgttacacgggtcagacaccacctgctcctcctggggtcaacaactcttcccccacggaaacctactggaataatctggcgacaggccagactgtatacatgaatggactggttaatggggacaccaatgctgcacagcttctaagccaccagggagttattcaacaaaatctcatcccagtctgtacgttgatttcaggtttatctgacccatcccaaagactttattgaatactttacagaacaacagatttttacattacagaacaacagatttttatctgtttatttaataatgaaatacttgtacaatgtatatatgtgtatgaaaattttctatcaaataaagcomp7220_c0_seq21642261Reference transcriptome Oly Transcriptome V3
96
1640BMP-2_FWD133210743O.lurida5/21/2015TGAAGGAACGACCAAAGCCAJH2055
Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
P12643aaattgacattaagggattatacgtgcaacgagtttttcattaataagtaaacgattatctcttttgaccggaacatataatgaagttttcaagaccaagtatttaaagtgttgttattttcaccagaaagtttaaaggaatcggagtgcagttagacgaggacagcgatactatataagctggaacttattaatacacacgtactctcgtctcagtataaaccacctgttccaccataaacatgatttattaatacggttatttaaaccttatccggttgagaatgtgtgtgcaatcagagctattttcgttgaggagcaaatttagaatcgggatttactgactgaacaagcggttgggaaaacaatctcttgcacacaaggatcatttactttcagtctatttggaatttatagaagaatgtgctatgacattaaataggggaattaacaaactaatggaagaccgtgcaggaaccaagctctatattcgtgcattttcacaatgagtttctgtcgatttggttttctactgttgctagcgtgcaccgggctggctggatcgtcatcgccttctcttctagaatcggcttttccttctcactacgacgaaaatcgaagaagagaaataatacaggcttttgagaaaaccttcttgcatctgtttggattgaaggaacgaccaaagccaaagaaagacacttttattccacaatatttgttagagttatatgaaaaacatagcgaggacccagattctcttggagatagcgtcaatgtcaaaagacgaggcgcgggttccgccaacactgttagaagttttcttcataaagaattgaccactgacgtcattagtatggcaggatgcggggagcacaactgtgcccatttctacttcaacgtatcatccattcctatggaggaatcattaactggtgctgagctaagactctttattgatcaaaataacgacacaaaaaatccagtcggaaacaggaaacagtttagacataaaatagaaattcacgaggttcttcaaccggaaacccaacattctgaagccataactaggctgctggatgtgcgtcacgtgggaggaagaaatgcatcttgggaatcttttgacattcacccagcagtattaaaatggaaaaagaatcctcatttaaaccatggattaaaagttcgtgtattacaatttaaaaacaaaccgtccacagactccattaaacatgtacgtttacgacgtgacgtagatagtgtggaggaagagaggcacacgagacctctgttggtgactttcacggacgataaccgtgggtcaaggactaaaagatccaccagtgataaaacaaaaaaaggtagaaaaaataggaaaaatagaaaaaataaaaagcgaaggagaaatagaaagaaaaacaatagaaagaataaaacaaagaggaaaaagtataacgaccagtgtcgcaggaaggagttaaatgtagattttaaagccgttgggtggaacgattggatattcgcgccacccggctataatgcgtattactgtgatggttcatgtcactggccttatgatgaccatatgaatgtgacaaaccatgcgatagtccaagacttagtgaactctatagaccctagggcggccccgaagccctgttgtgtacccacagaactcagttcgctttccttattatatactgacgaacatggcatagttgtgctgaaggtctatcaagacatggttgtagaaggatgcgggtgccggtagccatgataactctttaaattgttattgttatttgttgtgatattatttatttgcgaaaatggatgaaaaagtgtgtgtgttccgaaatatggctgttcggaagttagcttcatatttgctcatttccaatctcccattcattgacaatcatatcattattttcattttgcataaattgcatcomp7183_c0_seq11639373Reference transcriptome Oly Transcriptome V3
97
1639BMP-2_REV133210744O.lurida5/21/2015TCCGGTTGAAGAACCTCGTGJH2055
Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
P12643aaattgacattaagggattatacgtgcaacgagtttttcattaataagtaaacgattatctcttttgaccggaacatataatgaagttttcaagaccaagtatttaaagtgttgttattttcaccagaaagtttaaaggaatcggagtgcagttagacgaggacagcgatactatataagctggaacttattaatacacacgtactctcgtctcagtataaaccacctgttccaccataaacatgatttattaatacggttatttaaaccttatccggttgagaatgtgtgtgcaatcagagctattttcgttgaggagcaaatttagaatcgggatttactgactgaacaagcggttgggaaaacaatctcttgcacacaaggatcatttactttcagtctatttggaatttatagaagaatgtgctatgacattaaataggggaattaacaaactaatggaagaccgtgcaggaaccaagctctatattcgtgcattttcacaatgagtttctgtcgatttggttttctactgttgctagcgtgcaccgggctggctggatcgtcatcgccttctcttctagaatcggcttttccttctcactacgacgaaaatcgaagaagagaaataatacaggcttttgagaaaaccttcttgcatctgtttggattgaaggaacgaccaaagccaaagaaagacacttttattccacaatatttgttagagttatatgaaaaacatagcgaggacccagattctcttggagatagcgtcaatgtcaaaagacgaggcgcgggttccgccaacactgttagaagttttcttcataaagaattgaccactgacgtcattagtatggcaggatgcggggagcacaactgtgcccatttctacttcaacgtatcatccattcctatggaggaatcattaactggtgctgagctaagactctttattgatcaaaataacgacacaaaaaatccagtcggaaacaggaaacagtttagacataaaatagaaattcacgaggttcttcaaccggaaacccaacattctgaagccataactaggctgctggatgtgcgtcacgtgggaggaagaaatgcatcttgggaatcttttgacattcacccagcagtattaaaatggaaaaagaatcctcatttaaaccatggattaaaagttcgtgtattacaatttaaaaacaaaccgtccacagactccattaaacatgtacgtttacgacgtgacgtagatagtgtggaggaagagaggcacacgagacctctgttggtgactttcacggacgataaccgtgggtcaaggactaaaagatccaccagtgataaaacaaaaaaaggtagaaaaaataggaaaaatagaaaaaataaaaagcgaaggagaaatagaaagaaaaacaatagaaagaataaaacaaagaggaaaaagtataacgaccagtgtcgcaggaaggagttaaatgtagattttaaagccgttgggtggaacgattggatattcgcgccacccggctataatgcgtattactgtgatggttcatgtcactggccttatgatgaccatatgaatgtgacaaaccatgcgatagtccaagacttagtgaactctatagaccctagggcggccccgaagccctgttgtgtacccacagaactcagttcgctttccttattatatactgacgaacatggcatagttgtgctgaaggtctatcaagacatggttgtagaaggatgcgggtgccggtagccatgataactctttaaattgttattgttatttgttgtgatattatttatttgcgaaaatggatgaaaaagtgtgtgtgttccgaaatatggctgttcggaagttagcttcatatttgctcatttccaatctcccattcattgacaatcatatcattattttcattttgcataaattgcatcomp7183_c0_seq11640373Reference transcriptome Oly Transcriptome V3
98
1638PGE/EP4_FWD133210745O.lurida5/21/2015ACAGCGACGGACGATTTTCTJH2055
Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
P32240tggcgctggaaaatcgatagtcaagagcctgtacttcagtatttactttggacggggttaactagtccctagtgaccatatcgagagtgaatatgtattcaatggcaggcatacaacacggtagaagattcacgtcggattagcagatatatcattaaggacaattgttaccgccctcactgattacccacctttgttttgtgagcaaacatttattaagcaacacaccgccctacgccagaaacaaccaagattctatcatctatacaaaatcaatgcaccctgcgcatgtcacaaaacgttgccatgattttataatcatgcgacattaggaggcatggctctccacatgtaaactctggatcggggtaaaaaaaatctttttttaaaaagcaggaaactatgagtcttgtgtgcggattttccggacatattgaccgaaatgaaacgaatacctcaaattgctcaacgaattgctctactccaaattgggtgggcacggctctcatgagctggattagtacgaaaaatgtagttaattctggagtgatgtttgcctgtggattttttgggaatttgttagctttaattgtgttaataaggtctagtaaggaacagcgacggacgattttctaccgtttggttgctggactgaccatcacagatttaattggcaccaccttgacctctcctgtcgtgataacagtgtacgtaaagagacgctggatagggggcgacttcctgtgttcttactttggatttatgatgatcatggcgtgtttctccacgatgacaattgtatgtgctatgtctatagaacggatattgtgcataagacacccatatatctattatacccgattatcgaagaagcacgccaccattattttagcatcgtgttgggtaacgtctgccattatagcttcgttgcctcttttaggatttggggaaattgtcagaaaatacccaggaacgtggtgttattttgattattactcaaaagagccgatccatatagtatttaactatttcatcagtatcttagccatgagtattatcattgtgaccatttgctgtaatttgacagtcatttataccattctaaaaagcagacggaaacagggaatactccggaaagaggacggtacttcacgctccatccatggtgccagcaagcgttacgcagaatgtcagatgctgattcttttggtagggatcaccatcgttttcacctcctgctacactccgctatacgttcgagttatcatgaatcaaacaggcctcgtttgcaataccctcttggacttacaactgatccggctagcctcttataatcaaattctggatccttgggtttatatactcctccggagagaactcttgtggaagataatatctggcgtgaagtacatttgtaatcgaggtcagacagacctaaattcattaccccagaaacaatttgacgtagacaatgccaactgctgcgtgttttgtttccactgtttgtgcgaccctccggtgactgctagacagcgatgtgggtcaattttctctcaggacggccaatacatacatgcatgtccaggaagaagcacaatgaacgcctctagtttttcaaacctcaaaagcacctctctgacttctttgaacggaaggcaatcgggccctctgcgagtttgctctgcgaatgacgtccatatgctactgcttaataacacgctgaagaaacatggagtgacaaagagtacaagcacacgttttgtggatgacattgagaacgactgattcattcacaaatatttttacacgtgtttcatttccaatcaagtgatgtacaatcaatatttaaggattttatatacatttttactacttattagccttacaatttttcatactgtatgtgttatcatgtttatctaacattccacaatcttgaatgcgagatcatatattttaacactgatgaggcaaaacaacgtacatgagattactagaggattcccatttttattggcttgctttacttttgtggcaaccagtacatgtaccagtggattttttcaaattttgttgttgtgtaaaaaatcaacatattttccttactatcaaaactggcacomp6939_c0_seq11637303Reference transcriptome Oly Transcriptome V3
99
1637PGE/EP4_REV133210746O.lurida5/21/2015ATGGCAGACGTTACCCAACAJH2055
Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
P32240tggcgctggaaaatcgatagtcaagagcctgtacttcagtatttactttggacggggttaactagtccctagtgaccatatcgagagtgaatatgtattcaatggcaggcatacaacacggtagaagattcacgtcggattagcagatatatcattaaggacaattgttaccgccctcactgattacccacctttgttttgtgagcaaacatttattaagcaacacaccgccctacgccagaaacaaccaagattctatcatctatacaaaatcaatgcaccctgcgcatgtcacaaaacgttgccatgattttataatcatgcgacattaggaggcatggctctccacatgtaaactctggatcggggtaaaaaaaatctttttttaaaaagcaggaaactatgagtcttgtgtgcggattttccggacatattgaccgaaatgaaacgaatacctcaaattgctcaacgaattgctctactccaaattgggtgggcacggctctcatgagctggattagtacgaaaaatgtagttaattctggagtgatgtttgcctgtggattttttgggaatttgttagctttaattgtgttaataaggtctagtaaggaacagcgacggacgattttctaccgtttggttgctggactgaccatcacagatttaattggcaccaccttgacctctcctgtcgtgataacagtgtacgtaaagagacgctggatagggggcgacttcctgtgttcttactttggatttatgatgatcatggcgtgtttctccacgatgacaattgtatgtgctatgtctatagaacggatattgtgcataagacacccatatatctattatacccgattatcgaagaagcacgccaccattattttagcatcgtgttgggtaacgtctgccattatagcttcgttgcctcttttaggatttggggaaattgtcagaaaatacccaggaacgtggtgttattttgattattactcaaaagagccgatccatatagtatttaactatttcatcagtatcttagccatgagtattatcattgtgaccatttgctgtaatttgacagtcatttataccattctaaaaagcagacggaaacagggaatactccggaaagaggacggtacttcacgctccatccatggtgccagcaagcgttacgcagaatgtcagatgctgattcttttggtagggatcaccatcgttttcacctcctgctacactccgctatacgttcgagttatcatgaatcaaacaggcctcgtttgcaataccctcttggacttacaactgatccggctagcctcttataatcaaattctggatccttgggtttatatactcctccggagagaactcttgtggaagataatatctggcgtgaagtacatttgtaatcgaggtcagacagacctaaattcattaccccagaaacaatttgacgtagacaatgccaactgctgcgtgttttgtttccactgtttgtgcgaccctccggtgactgctagacagcgatgtgggtcaattttctctcaggacggccaatacatacatgcatgtccaggaagaagcacaatgaacgcctctagtttttcaaacctcaaaagcacctctctgacttctttgaacggaaggcaatcgggccctctgcgagtttgctctgcgaatgacgtccatatgctactgcttaataacacgctgaagaaacatggagtgacaaagagtacaagcacacgttttgtggatgacattgagaacgactgattcattcacaaatatttttacacgtgtttcatttccaatcaagtgatgtacaatcaatatttaaggattttatatacatttttactacttattagccttacaatttttcatactgtatgtgttatcatgtttatctaacattccacaatcttgaatgcgagatcatatattttaacactgatgaggcaaaacaacgtacatgagattactagaggattcccatttttattggcttgctttacttttgtggcaaccagtacatgtaccagtggattttttcaaattttgttgttgtgtaaaaaatcaacatattttccttactatcaaaactggcacomp6939_c0_seq11638303Reference transcriptome Oly Transcriptome V3
100
1636CRAF1_FWD133210747O.lurida5/21/2015AGCAGGGCATCAAACTCTCCJH2055
TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)
Q60803atggtaaccctgaaaggcaggttacccacgagttatttgcccctgatccaaaataaaattaagtcgtacgtgtgtcatttactcaaaccgtagaaactgcagtgtgtgcacagggactcgtcacgaattgacctcattaaaatatagaatagacggtgtcaaattttaataagacaaaaagttcgtgacgagcccctgtggccagagctcccatcccctttactagctccttcaacataactgtcagtataagaccctggtacttattatacttggaacttttgctaaactggtcagtatcttcattatatacatgcaatgagaatggatctaaatcatgcattgacatatagagtatccatactaaactacccctatactggcctatagtgaccagcccacctagtgtgacttctggtgaaatattgagcccgaatataaacgataaattttcttcaacacaattactgacgagcagatgtaccgaatacaactatcccataatagctagagttacgataactaatttgattttaaactgagaaggtatttctaaatgaggaaatttgacaaacatctatgattctgtacatgtttctgtttctttcatggaattggtatgttacttgtgtcaactttaactttgatgaatattgtatcttctttgagatatgtctttgtttcgagcacactatgggagataaaaagaggacatccagtggcaacattcatctctgtagttggtctcttgaagctgctacttgttgtgtcaggctggaaagtatcacagacatgtcttctgttgaagtcttgatccaacagcatcagggaaactttctgctggaaaggccatggaagcagggcatcaaactctcctctcatcaccacaaagaacaaggacagatgagtgcctttacccattccatccccattcaggtacactctggcacacatcttgtagccagtgcgacttgtgtaaaatggctggctgtacagggagagggttctcccacttttggcctcctcctttcttctggagtaatctcttatcttccacattaaaatgccatcataactagcagtctccagcacttggaatctcaggtctaactcagcaagcctaatgtcctggatcgccatctgcttctcattactcttcagttgattcctcacctcttgagacacccctgcctgtgaccctccacctccgggccccgctcgctctagctgagttatctgctcctgactgactcgcaagtcctctctcagcacatttaaaacttgctcctgcttttcaaggacttctcgctttggctggtgttcaatcaacctctccaaatttattaacctttctgtcaatgacactaacttttttttcatatcctttgtgatcgatttcactaagggtgtaatttcttcttttaacctttgattttcctgatgcaattcttgaacaattctttgcatttctactgcctctgtcttgcttttctcaatctcagtctgcagagcttgattctgatcgcttgtttgattggaaaatgacataactaacatcagatggtgatctgtcgctgttgtctgatgcttctccacttctttgactacatcaacaaactgacaccctatgcttttgtatccacaagggattgatcgttttgggcaagattgcaggtgactatccatctcacttcgacgcagtattatattttcacacccatttggacagttcagttgatattccaaacactcatggtcaatgtgactctgcatctgacagaagggaacatcccttgagcagtggctgcatacagcaattcgatggctgcactctaatttctgatgactggacagcttattctgaggtattttttcatgacattcaccacattccacgggtttaaactcgcattcctcagcgtgtatcataaggtttctccatattggtgtctctttacacccatgattgtgataggaacagaaaactggaagtaacatcatctctcgacgagtgcacatatctttatatatctcatttttggagaaagactccttacactcctcatccaactgtaggggacaggttgctgtgtcattttctccaaacaatggatcaatacaggactcacagatctgatgtccacactgtagttgcatggcattccttagtactgttccacacacagagcaaatgtatttatccgctactttattgacaaactgtggcaagtctgctgataataagcttgttcccaaagaagccatagaggaatccatgttgagatagcaaatttcagcttacgcggtattcaaaatattttaacaaaatacagagttttatatgcaaatgttttttaaatttacaagaatatttttttaagtcactgacagaagttgctatgtattcaaggttattattatatttcctattttttatcctatcacatctaatattctgtatagcaacagtaaaggaagaaatgatcaatatatcactccaaaaagaatcatgttttatccaatactgtagaaatacagttttttcatatagtgctgataatttacaacccatacacccctggctttgcaatcattttcatttttactgtatgtttctgcattcttaaacacaactcatctgaaataggcctacagtccgtgagccaagggcgtcgcttctaaaatggcgttgtactttactcattcggcgaacomp25313_c0_seq11635119Reference transcriptome Oly Transcriptome V3
Loading...
 
 
 
primers
 
 
Main menu