sr_IDPrimer namePrimer SequenceIDT #Organismdate orderedDesigned By#bpGC%melting tempGeneGene Accession#full sequencelocation on referencepair w/sr_IDproduct sizeother notes
1805Ill_TrSq_P7_23CAAGCAGAAGACGGCATACGAGATCCACTCGTGACTGGAGTTCAGACGTGTG286930970IlluminaTruSeqPrimersForZymoPicoMethylKit20201116Karolyn Giang @Zymo52Barcode: CCACTCIlluminaTruSeqPrimersForZymoPicoMethylKit
1804Ill_TrSq_P7_25CAAGCAGAAGACGGCATACGAGATATCAGTGTGACTGGAGTTCAGACGTGTG286930971IlluminaTruSeqPrimersForZymoPicoMethylKit20201116Karolyn Giang @Zymo52Barcode: ATCAGTIlluminaTruSeqPrimersForZymoPicoMethylKit
1747SPTN1_FWDACCACTTGACTCGCACCG264700405P.generosa1/23/2020KRM1861.11159.971Spectrin alpha chain, non-erythrocytic 1 (Alpha-II spectrin) (Fodrin alpha chain)PGEN_.00g280110-vv0.74.a sequence length >68,000 bp; full sequence on OWL linked
1746SPTN1_REVAAACCCACGACCTCAGCG264700406P.generosa1/23/2020KRM1861.11159.969Spectrin alpha chain, non-erythrocytic 1 (Alpha-II spectrin) (Fodrin alpha chain)PGEN_.00g280110-vv0.74.a sequence length >68,000 bp; full sequence on OWL linked