R103_results_AoverB.xlsx
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWXYZAAABACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZBABBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBUBVBWBXBYBZCACBCCCDCECFCGCHCICJCKCLCMCNCOCPCQCRCSCTCU
1
DesignID
DesignPlayerPuzzle_Name
Eterna_Round
Eterna_Score
Baseline_Subscore
Folding_Subscore
Switch_Subscore
NumberOfClusters1
NumberOfClusters2
NumberOfClusters3
KDOFFKDON
FoldChange
FoldChange_err_factor
ddGddG_err
GlobalFoldChange
KDnoligand
KDA100nM
KDB100nM
KDA5nM_B100nM
KDA5nM_B5nM
KDB5nM
KDA100nM_B100nM
KDnoligand_sem_factor
KDA100nM_sem_factor
KDB100nM_sem_factor
KDA5nM_B100nM_sem_factor
KDA5nM_B5nM_sem_factor
KDB5nM_sem_factor
KDA100nM_B100nM_sem_factor
fmaxnoligand
fmaxA100nM
fmaxB100nM
fmaxA5nM_B100nM
fmaxA5nM_B5nM
fmaxB5nM
fmaxA100nM_B100nM
fmaxnoligand_std
fmaxA100nM_std
fmaxB100nM_std
fmaxA5nM_B100nM_std
fmaxA5nM_B5nM_std
fmaxB5nM_std
fmaxA100nM_B100nM_std
fmaxnoligand_sem
fmaxA100nM_sem
fmaxB100nM_sem
fmaxA5nM_B100nM_sem
fmaxA5nM_B5nM_sem
fmaxB5nM_sem
fmaxA100nM_B100nM_sem
fmaxnoligand_MAD
fmaxA100nM_MAD
fmaxB100nM_MAD
fmaxA5nM_B100nM_MAD
fmaxA5nM_B5nM_MAD
fmaxB5nM_MAD
fmaxA100nM_B100nM_MAD
dGnoligand
dGA100nMdGB100nM
dGA5nM_B100nM
dGA5nM_B5nM
dGB5nM
dGA100nM_B100nM
dGnoligand_std
dGA100nM_std
dGB100nM_std
dGA5nM_B100nM_std
dGA5nM_B5nM_std
dGB5nM_std
dGA100nM_B100nM_std
dGnoligand_sem
dGA100nM_sem
dGB100nM_sem
dGA5nM_B100nM_sem
dGA5nM_B5nM_sem
dGB5nM_sem
dGA100nM_B100nM_sem
dGnoligand_MAD
dGA100nM_MAD
dGB100nM_MAD
dGA5nM_B100nM_MAD
dGA5nM_B5nM_MAD
dGB5nM_MAD
dGA100nM_B100nM_MAD
SequenceAsCs
Gs
UsA_percC_percG_percU_perc
Sequence_Length
2
6654425MS2 control ON AzorAzorMS2 control ON10330.000.0030.00116117130177.600.47177.60206.10182.08201.39148.75134.50288.901.141.131.171.121.161.141.140.570.630.470.800.590.660.550.450.440.411.140.551.440.350.040.040.040.100.050.130.030.260.280.250.380.220.330.22-15.54-15.39-15.52-15.42-15.72-15.82-15.061.371.341.731.281.741.391.530.130.120.160.110.150.130.131.051.251.411.211.301.341.22
CAUAUAUAUAUAUAGAAAAUGUGUGUGUGUGUGACAUGAGGAUCACCCAUGUGUGUGUGUGUGUGUAAAAGAUAUAUAUAUAUAC
287203032.948.2423.5335.2985
3
66544471.2 MS2 control ON AzorAzorMS2 control ON10330.000.0030.00869711426.150.7326.1524.2727.0623.2228.8722.6730.991.081.101.091.111.081.091.070.971.040.861.180.901.110.920.451.650.864.740.601.011.520.050.180.090.440.060.110.140.350.440.300.550.340.480.43-17.46-17.53-17.43-17.58-17.36-17.60-17.290.710.920.881.070.800.800.770.080.100.090.100.070.090.070.460.490.410.670.500.590.59
GUAUAUAUAUAUUAAUAAGAGUGUGUGUGUGCAACAUGAGGAUCACCCAUGUAGUAUAUAUAUAUUGAAUAAAGUGUGUGUGUGC
287203032.948.2423.5335.2985
4
66544791.1 MS2 OFF AzorAzor
MS2 control OFF
1030.000.0050373616.700.4416.7013.896.138.2311.1130.1010.871.481.421.581.581.431.371.500.170.310.150.310.160.330.231.081.070.800.380.191.170.310.150.150.130.060.030.170.050.170.220.130.280.130.240.19-17.91-18.09-18.91-18.62-18.32-17.32-18.342.802.472.802.762.152.252.450.400.350.460.460.360.320.412.711.652.913.161.792.561.73
ACAUGAGGAUCACCCAUGUUAUAUAUAUAUAUAUAUAUAUGAAGAGUGUGUGUGUGUGUGUGUGUGAUAUGGGUGAUUUUUAUGU
235223527.065.8825.8841.1885
5
66546591.1 Sensor A MS2 ON AzAzor
Sensor A MS2 ON
10335.9717.3515.033.5910611515422.9715.601.471.25-0.390.220.7622.9715.6014.8330.6216.3525.1419.531.201.131.241.131.121.211.120.320.500.280.800.440.460.400.4374.280.423.520.4521216.400.400.047.210.040.280.042060.720.030.180.250.180.350.220.260.24-17.59-17.98-18.03-17.30-17.93-17.50-17.751.911.292.331.541.401.951.450.190.130.220.120.110.190.121.400.741.731.070.931.710.96
ACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUGCGGUAGAUGUAGUGUAGUAUUAUAUCAUGAAGAAAGGGUGUUUUUUAUGU
229203425.8810.5923.5340.0085
6
6654752AstrosMS@ControlON#1AstromonMS2 control ON103100.0070.0030.001851611864.410.804.414.504.624.094.634.385.111.041.041.071.071.041.041.041.241.411.201.491.051.391.15162.5756.825.701093.556.052.9122.6311.954.180.4580.180.440.211.660.520.670.420.890.430.590.50-19.24-19.22-19.19-19.31-19.19-19.25-19.090.560.550.820.890.550.520.570.040.040.060.070.040.040.040.380.390.360.610.420.440.42
AAUUAUAAUUAUUAUAAUUAUUUAACAUGAGGAUCACCCAUGUAAUAUAUUUUUAUAUAAGCACUAGAUAACAUUAUCUAUGUGC
331083438.8211.769.4140.0085
7
6654757AstrosMS@ControlON#2AstromonMS2 control ON103100.0070.0030.001852172283.940.763.943.943.883.934.543.674.831.051.071.051.081.051.051.060.991.030.981.020.911.010.932.242219111.740.422.492.460.8422082.960.16163152.340.030.170.160.061462.480.320.370.330.430.350.330.32-19.35-19.35-19.37-19.35-19.21-19.42-19.150.700.870.691.110.670.710.950.050.060.050.070.040.050.060.350.380.370.450.400.400.40
AAAUUUAAUUAUUAAGUUUAUUUAACAUGAGGAUCACCCAUGUAUUAUAUUUUUAUAAAAGCACUAGAUAACAUUAUCUAUGUGC
321093437.6511.7610.5940.0085
8
6654767AstrosMS@ControlON#3AstromonMS2 control ON103100.0070.0030.001591601856.740.796.746.937.046.107.306.307.741.031.041.041.081.051.041.050.951.040.961.181.001.040.982.5212.182.936.522.841.030.710.200.970.230.480.210.080.050.400.380.290.600.380.390.38-18.82-18.79-18.77-18.92-18.74-18.88-18.680.430.480.480.990.650.540.650.030.040.040.070.050.040.050.430.430.370.550.320.410.37
AAAUUUAAUUAUUAAGUUUAUUUAACAUGAGGAUCACCCAUGUAUUAUAUUUUUAUAAAAGCACUGGGUAACAUUGUCUGUGUGC
2810133432.9411.7615.2940.0085
9
6654773AstrosMS@ControlON#4AstromonMS2 control ON103100.0070.0030.002392262843.920.783.923.813.864.544.433.664.691.061.071.071.061.041.071.051.171.261.201.531.211.271.271.1816.080.78877.365.232.261.540.081.040.0552.060.310.150.090.450.570.380.770.500.520.44-19.36-19.38-19.37-19.21-19.23-19.43-19.180.970.991.060.940.701.060.830.060.060.070.060.040.070.050.350.370.400.520.440.420.42
AAAUUUAAUUAUUAAGUUUAUUUAACAUGAGGAUCACCCAUGUACAUGAGGAUCACCCAUGUACUGGGUAACAUUGUCUGUGUGC
2614162930.5916.4718.8234.1285
10
6654781AstrosMS@ControlON#5AstromonMS2 control ON10330.000.0030.0043542045079.510.7979.5189.4985.64124.89100.0383.53105.851.041.041.041.051.041.041.040.941.010.931.130.911.020.970.53236455.72160.79167183.530.762.420.820.0311337.187.857881.110.040.120.040.310.330.290.530.330.350.35-16.35-16.23-16.27-15.90-16.12-16.30-16.060.770.820.851.090.760.800.850.040.040.040.050.040.040.040.610.670.630.850.600.620.64
AAACAUGAGGAUCACCCAUGUUUAACAUGUGGUUCACCCAUGUAUUGUAUUUUUAUCGAAGCACUGGGUCACAUUGUCUGUGUGC
2117182924.7120.0021.1834.1285
11
6654786MS2 ctrl ON #01MalcolmMS2 control ON10330.000.0030.00191197226156.250.70156.25171.48193.37193.45173.75157.40223.301.111.121.131.111.091.111.100.520.610.540.770.590.670.550.40123606.670.361.740.440.730.680.038943.870.030.120.030.050.040.220.280.260.440.240.290.23-15.67-15.58-15.46-15.46-15.57-15.66-15.311.381.591.671.511.271.391.400.100.120.120.100.080.100.091.101.141.331.291.111.271.10
CAUAUAUAUAUAUGAAUAAUGUGUGUGUGUGUGACAUGAGGAUCACCCAUGUGUGUGUGUGUGUGUGAAUAAUAUAUAUAUAUAC
267203230.598.2423.5337.6585
12
6654794MS2 ctrl ON #02MalcolmMS2 control ON10330.000.0030.0078100113206.520.67206.52203.87189.70214.31232.65176.19262.531.161.151.121.151.121.151.120.740.780.700.960.680.890.771.870.700.424.810.563.090.710.210.080.040.450.050.350.070.350.360.310.640.290.420.29-15.39-15.41-15.48-15.36-15.27-15.55-15.151.351.271.151.491.191.251.160.150.140.120.140.110.140.110.791.020.821.130.970.890.98
GAUAUAUAUAUAUGAAUAAUGUGUGUGUGUCUGACAUGAGGAUCACCCAUGUGUGUGUGUGUGUGUGAAUAAUAUAUAUAUAUAC
267203230.598.2423.5337.6585
13
6654796MS2 ctrl ON #02MalcolmMS2 control ON10330.000.0030.001079312073.860.7173.8679.3456.6687.4474.6072.2868.401.111.111.111.161.101.101.120.690.810.650.990.720.830.780.540.660.443.261.030.521.340.050.060.050.300.090.050.120.290.380.240.590.290.260.28-16.42-16.35-16.69-16.25-16.41-16.44-16.501.081.091.011.631.041.011.210.100.110.100.150.100.100.110.870.990.891.280.910.891.02
GAUAUAUAUAUAUGAAUAAUGUGUGUGUGUCUGACAUGAGGAUCACCCAUGUGUAUAUAUAUAUAUGAAUAAUAUAUAUAUAUAC
327143237.658.2416.4737.6585
14
6654801MS2 ctrl ON #03MalcolmMS2 control ON103100.0070.0030.002011762036.500.886.506.906.898.377.816.917.301.081.051.101.081.041.091.040.820.930.881.200.890.930.900.385252008.320.394272.100.5410.220.650.03370448.100.03299.840.040.720.050.270.340.360.720.360.360.32-18.85-18.79-18.79-18.60-18.67-18.79-18.741.050.681.261.150.601.160.550.070.050.090.080.040.080.040.450.470.490.660.380.560.44
GAUAUAUAUAUAUGAAUAAUAUGUGUAUAUCUGACAUGAGGAUCACCCAUGUGUAUAUAUAUAUAUGAAUAAUAUAUGUGUAUAC
337133238.828.2415.2937.6585
15
6654803MS2 ctrl ON #04MalcolmMS2 control ON103100.0070.0030.001621461456.810.876.816.486.637.297.567.317.621.041.041.041.101.051.051.050.860.960.801.010.820.930.900.395.250.4915.400.472.941.480.030.410.041.280.040.230.120.270.340.230.490.290.370.27-18.80-18.86-18.83-18.74-18.70-18.73-18.690.560.550.471.190.540.630.550.040.040.040.100.040.050.050.360.400.360.660.420.430.44
GAUAUAUAUAUACGAAUAGUAUGUGUAUAUCUGACAUGAGGAUCACCCAUGUGUAUAUAUAUAUAUGAAUAAUAUAUGUGUAUAC
328143137.659.4116.4736.4785
16
6654805MS2 ctrl ON #05MalcolmMS2 control ON103100.0070.0030.002001851974.740.784.745.144.806.235.614.986.191.061.041.071.081.041.071.040.941.040.891.180.931.020.970.59864593.884.552.910.601.978.280.0461136.020.330.210.040.140.590.310.350.320.550.350.400.37-19.17-19.09-19.15-18.89-19.00-19.12-18.900.770.550.861.110.511.000.560.050.040.060.080.040.070.040.460.420.510.690.410.490.36
GAUAUAUAUAUAGGAAUACUAUGUGUAUAUCUGACAUGAGGAUCACCCAUGUGUAUAUAUAUAUAGGAAUACUAUAUGUGUAUAC
319153036.4710.5917.6535.2985
17
6654810MS2 ctrl ON #06MalcolmMS2 control ON103100.0070.0030.001992171983.770.823.773.733.523.904.033.814.271.031.051.041.071.041.041.041.161.291.191.561.111.241.191.3525.3430981.613.004002.262.982.970.101.802103.170.21284.430.210.210.430.500.500.870.460.400.49-19.40-19.41-19.47-19.36-19.33-19.39-19.270.420.720.540.980.530.620.620.030.050.040.070.040.040.040.310.380.440.530.390.450.43
GAUUAUAAUUAUUAUAAUCAUUUAACAUGAGGAUCACCCAUGUAAUAUAUUUUUAUAUAAGCACUAGAUAACAUUAUCUAUGUGC
321193337.6512.9410.5938.8285
18
6654815MS2 ctrl ON #07MalcolmMS2 control ON103100.0070.0030.00129941193.560.793.563.913.663.544.463.934.351.061.071.101.061.051.041.051.131.321.131.221.111.231.100.84784846.571.434.206.201.643.510.0769101.890.150.390.570.140.320.380.560.490.570.380.430.44-19.45-19.36-19.43-19.46-19.23-19.36-19.250.690.760.890.640.520.480.540.060.070.090.060.050.040.050.340.370.430.490.360.380.41
GAUUAUAAUUAUUAUAAUCAUUUAACAUGAGGAUCACCCAUGUAAUAUAUUUUUAUAUAAGUACUAGAUGACAUCAUCUAUGUAC
321193337.6512.9410.5938.8285
19
6654821MS2 ctrl ON #08MalcolmMS2 control ON103100.0070.0030.001601421583.960.843.963.823.573.944.073.984.261.091.071.131.091.051.101.081.081.281.141.371.071.211.130.6942.801.682.112.911.291.760.053.380.140.170.230.100.140.520.540.360.820.380.460.50-19.35-19.38-19.45-19.35-19.32-19.34-19.271.100.801.461.080.631.161.000.090.060.120.090.050.090.080.400.390.520.560.440.460.48
GAUUAUAAUUAUUAUAAUCAUUUAACAUGAGGAUCACCCAUGUAAUAUAUUUUUAUAUAAGUACCAGAUGACAUCAUCUGUGUAC
3112103236.4714.1211.7637.6585
20
6654823MS2 ctrl ON #09MalcolmMS2 control ON103100.0070.0030.002642603003.700.843.703.623.543.643.973.554.241.021.031.031.051.031.031.031.241.371.181.521.171.341.241.9426.11358534.86207.396.332.163.220.121.6122235.3911.970.370.130.190.450.650.520.790.450.520.52-19.41-19.44-19.46-19.43-19.35-19.46-19.280.360.450.490.800.520.440.540.020.030.030.050.030.030.030.370.330.370.470.360.340.39
GAUUAUAAUUAUUAUAAUCAUUUAACAUGAGGAUCACCCAUGUAAUAUAUAUUUAUAUAAGUACCAGAUGACAUCAUCUGUGUAC
3212103137.6514.1211.7636.4785
21
6654828MS2 ctrl ON #10MalcolmMS2 control ON103100.0070.0030.007869883.470.923.473.353.653.633.853.803.941.061.061.111.121.071.081.081.331.601.421.821.261.611.502.379.631606238.55185.212.24906763.958.180.271.09193368.4019.740.24102670.800.870.761.000.601.480.660.980.74-19.48-19.51-19.43-19.43-19.38-19.39-19.350.500.520.841.030.600.690.760.060.060.100.110.060.080.080.440.370.560.520.390.520.45
GAUUAUAAUUAUUAUAAUCAUAUAACAUGAGGAUCACCCAUGUAAUAUAUAUUUAUAUAAGUACCAGAUGACAUCAUCUGUGUAC
3312103038.8214.1211.7635.2985
22
6654841MS2 ctrl ON #11MalcolmMS2 control ON103100.0070.0030.007057607.630.747.639.358.049.729.338.4110.871.061.061.101.171.101.081.090.880.940.891.070.930.960.920.400.660.471.580.620.820.680.050.080.060.200.080.100.090.380.390.300.320.380.430.27-18.69-18.49-18.64-18.45-18.49-18.59-18.340.460.460.691.200.730.650.670.050.060.090.160.090.080.090.320.400.580.670.340.340.48
UGUGUGUGUGUGUGAGAGUGUGUGUGAGUGUGUACAUGAGGAUCACCCAUGUAUAUAGUUAUAUAUAAGAUUAUAUAUAUAUAUA
255223329.415.8825.8838.8285
23
6654843MS2 ctrl ON #12MalcolmMS2 control ON10399.1669.1630.001701631898.170.908.178.237.948.538.798.078.771.051.051.051.111.051.051.050.900.990.960.990.890.950.900.727.160.802.920.410.851.550.060.550.060.210.030.070.110.320.360.300.410.350.370.32-18.62-18.62-18.65-18.58-18.55-18.64-18.550.600.660.621.370.630.600.720.050.050.050.100.050.050.050.380.430.360.550.370.470.43
UGUGUGUGUGUGUGAGAGUGUGUGUGAGUGUGUACAUGAGGAUCACCCAUGUAUAUAGUUAUGUAUAAGAUUAUAUAUAUAUAUA
245233328.245.8827.0638.8285
24
6654852MS2 ctrl ON #13MalcolmMS2 control ON10395.1765.1730.001191271689.080.789.089.698.8110.1410.1010.0411.301.071.071.071.071.041.101.050.880.920.881.110.870.930.880.64333419.210.933.520.540.711.030.0630564.490.080.270.040.070.080.330.340.300.480.320.360.31-18.52-18.45-18.55-18.41-18.41-18.42-18.300.710.710.730.830.521.020.680.070.070.060.060.040.090.050.520.460.440.500.380.440.42
UGUGUGUGUGUGUGAGAGUGUGUGUGAGUGUGUACAUGAGGAUCACCCAUGUAUAUAGUUAUGUAUAAGAUUAUAUAUAAUAAUA
255233229.415.8827.0637.6585
25
6654858MS2 ctrl ON #14MalcolmMS2 control ON103100.0070.0030.003653183915.680.715.685.756.557.475.555.768.071.031.041.051.061.041.051.040.800.860.791.120.810.960.810.4316.921.566.942.361.091.250.020.890.090.350.120.060.060.300.310.310.580.320.360.34-18.99-18.97-18.84-18.71-19.01-18.97-18.630.650.710.821.110.690.890.730.030.040.050.060.030.050.040.440.450.470.640.420.470.48
UGUGUGGAUGUGUGAGAGUGUGUGUGAGUGUGUACAUGAGGAUCACCCAUGUAUAUAGUUAUGUAUAAGAUUAUAUAUCAUAAUA
256233129.417.0627.0636.4785
26
6654861MS2 ctrl ON #15MalcolmMS2 control ON103100.0070.0030.002042352235.200.705.205.486.496.586.385.447.781.051.061.061.081.051.071.050.820.870.841.000.810.930.750.43256148.451.18146312.020.680.753.360.0317933.980.089797.780.050.050.230.320.370.270.390.300.340.22-19.07-19.02-18.85-18.84-18.87-19.03-18.670.670.820.931.180.681.030.790.050.060.060.080.050.070.050.410.440.460.630.480.590.48
UAAAUAGAUGUGUGAGAGUGUGUGUGAGUGUGUACAUGAGGAUCACCCAUGUAUAUAGUUAUGUAUAAGAUUAUAUAUCAUAAUA
296203034.127.0623.5335.2985
27
6654904MS2 ctrl ON #16MalcolmMS2 control ON103100.0070.0030.009988903.680.793.683.453.733.724.063.544.461.091.051.041.061.081.071.051.021.141.111.201.091.111.1773499.324759331.142.212.054.371.154.917386.96478330.780.240.220.460.120.520.370.430.400.410.370.360.30-19.42-19.48-19.41-19.41-19.32-19.46-19.230.860.450.410.580.740.660.500.090.050.040.060.080.070.050.370.280.340.470.430.370.51
CAUAGAUAUAAAGCUAGAUGAACUGAUUAACAUGAGGAUCACCCAUGUAGAUCGAUAGGUAUUAAUGACUAGCGUUGAUAUGUAG
3111192436.4712.9422.3528.2485
28
6654906MS2 ctrl ON #17MalcolmMS2 control ON103100.0070.0030.001751842064.190.774.193.804.243.454.053.634.451.031.041.061.061.031.041.031.101.161.131.161.091.201.080.562343809.431.222.581.550.901.360.04177175.340.090.180.110.070.090.390.410.350.460.400.390.41-19.29-19.39-19.28-19.48-19.32-19.43-19.230.400.540.820.800.470.550.470.030.040.060.060.030.040.030.370.420.380.490.410.410.39
CAUAGGUAUAAAGCUAGAUGAACUGAUUAACAUGAGGAUCACCCAUGUAGAUCGAUAGGUAUUAAUGACUAGCGUUGAUAUGUAG
3011202435.2912.9423.5328.2485
29
6654911MS2 ctrl ON #18MalcolmMS2 control ON103100.0070.0030.00941271254.130.844.134.244.594.024.254.134.811.061.091.041.101.061.081.051.041.131.141.171.121.161.101.812575527.221.125.192.051.110.710.19265645.350.100.460.180.110.060.380.440.360.520.410.420.38-19.30-19.28-19.20-19.33-19.28-19.30-19.150.590.820.451.070.610.700.510.060.080.040.100.050.070.050.360.350.370.430.330.490.42
CAUAGGUAUAAAGCUAGAUGAACUGAUUAACAUGAGGAUCACCCAUGUAGAUCGAUAGGUAUUAAUGGCUAACGUUGAUAUGUAG
3011202435.2912.9423.5328.2485
30
6654916MS2 ctrl ON #19MalcolmMS2 control ON103100.0070.0030.001921862154.630.834.634.224.404.635.184.294.961.041.051.061.061.031.051.041.031.061.001.361.091.061.100.78438734.500.92195.666.591.360.680.0631662.940.0713.340.450.100.050.360.380.420.740.420.440.39-19.19-19.28-19.24-19.19-19.08-19.27-19.120.530.640.770.920.500.640.510.040.050.060.060.030.050.040.430.420.400.630.420.460.37
CAUAGGUGUAAAGCUAGAUGAACUGAUUAACAUGAGGAUCACCCAUGUAGAUCGAUAGGUAUUAAUGGCUAACGUUGAUAUGUAG
2911212434.1212.9424.7128.2485
31
6654920MS2 ctrl ON #20MalcolmMS2 control ON103100.0070.0030.008393864.200.804.204.154.324.084.763.974.941.051.041.071.071.061.041.051.031.101.051.111.111.071.080.9055.790.410.760.4847440.930.600.106.120.040.080.055207.320.060.280.320.340.390.400.360.30-19.29-19.30-19.26-19.32-19.16-19.34-19.130.450.380.620.660.550.390.440.050.040.060.070.060.040.050.410.280.320.430.460.370.32
CAUAAGUGUAAAGCUAGAUGAACUGAUUAACAUGAGGAUCACCCAUGUAGAUCGAUAGGUAUUAAUGGCUAACGUUGAUAUGUAG
3011202435.2912.9423.5328.2485
32
6654928MS2 ctrl ON #21MalcolmMS2 control ON103100.0070.0030.002252071895.380.835.385.285.535.685.895.216.261.051.031.041.061.041.041.040.981.031.001.221.111.031.0720.721.721.022.281.782.100.541.380.110.070.170.130.140.040.380.350.380.520.410.370.38-19.04-19.06-19.01-18.99-18.95-19.07-18.890.730.510.500.770.580.630.580.050.030.030.060.040.040.040.380.390.420.570.350.520.42
CAUAAGUGUAAAGCUGGAUGAACUGAUUAACAUGAGGAUCACCCAUGUAGAUCGAGAGGUAUUAAUGGCUAACGUUGAUAUGUCG
2812222332.9414.1225.8827.0685
33
6654934MS2 ctrl ON #22MalcolmMS2 control ON103100.0070.0030.002152562514.830.864.834.704.754.744.984.705.441.051.051.041.051.041.061.041.001.071.031.131.021.101.071.141.260.611.830.540.560.490.080.090.040.120.030.040.030.390.390.400.400.330.350.35-19.15-19.17-19.17-19.17-19.12-19.18-19.030.720.750.590.840.610.810.580.050.050.040.050.040.060.040.400.440.400.480.390.460.35
CAUAAGUGUAAUACUGGAUGAACUGAUUAACAUGAGGAUCACCCAUGUAGAUCGAGAGGUAUUAAUGGCUAUCGUUGAUAUGUCG
2712212531.7614.1224.7129.4185
34
6654937AstrosMS2ControlOFF#1Astromon
MS2 control OFF
1030.000.002424195.850.515.858.8222.654.524.2514.803.461.721.651.821.691.811.801.750.220.240.230.280.210.500.150.270.570.300.410.230.330.320.060.120.060.090.050.070.070.240.170.210.270.190.330.16-18.96-18.55-17.60-19.22-19.28-18.03-19.482.662.452.922.292.582.872.440.540.500.600.530.590.590.562.323.003.001.952.482.551.85
UAUAUAAAUUAUAUAUUUAUAUAUGUAAUACAUGAGGAUCACCCAUGUACACGGGUGAUUUUAUGUAUUAUAUAUAUAAAUAUAU
337103538.828.2411.7641.1885
35
6654942AstrosMS2ControlOFF#2Astromon
MS2 control OFF
1030.000.0022332419.630.4219.638.503.7710.058.9810.978.361.671.921.692.151.841.611.770.240.450.131.240.170.450.200.300.270.345.680.840.5218.580.060.060.061.160.170.113.790.250.270.111.470.190.300.20-17.75-18.58-19.40-18.42-18.53-18.33-18.602.393.063.003.762.982.242.810.510.650.520.770.610.480.572.172.012.904.923.041.662.88
UAUAUAAAUUAUAUAUUUAUUUAUGUAUUACAUGAGGAUCACCCAUGUACACGGGUGAUUUUAUGUAUUAUAUAUAUAAAUAUAU
317103736.478.2411.7643.5385
36
6654944MS2 ctrl ON #23MalcolmMS2 control ON10392.4162.4130.002402102349.710.849.719.189.499.9310.889.3011.031.041.041.071.071.071.041.050.971.060.931.210.991.051.010.5810.990.4317930.62143.921.701.900.040.710.031172.169.410.110.120.350.390.330.530.390.340.32-18.45-18.51-18.47-18.43-18.34-18.49-18.320.580.570.941.100.980.660.760.040.040.060.070.060.040.050.360.300.430.560.310.430.39
CAUAAGUGUAAUACUGGAUGAACUGAUUAACAUGAGGAUCACCCAUGUAGAUCGAGAGGUAUGUAUGGCUAUCGUAUAUAUGUCG
2712212531.7614.1224.7129.4185
37
6654946MS2 ctrl ON #24MalcolmMS2 control ON10386.3356.3330.0013914815711.090.8211.0910.2810.2711.9311.7210.3612.511.041.051.061.081.041.051.040.971.000.921.180.991.021.030.948507916.600.651.871.430.810.510.08721632.070.050.150.110.070.040.300.290.350.510.340.280.35-18.32-18.39-18.39-18.24-18.26-18.38-18.200.480.540.660.990.480.560.550.040.050.050.080.040.050.040.350.430.430.530.340.340.42
CAUAAGUGUAAUACUGGAUGAACUGAUUAACAUGAGGAUCACCCAUGUAGAUCGAGAGGUAUGUAUGGCUAUCAUAUAUAUGUCG
2812202532.9414.1223.5329.4185
38
6654948AstrosMS2ControlOFF#3Astromon
MS2 control OFF
1030.000.0033303310.940.1010.9414.163.3320.342.6713.8134.181.611.621.691.701.651.621.640.190.320.160.520.110.340.260.220.410.332.160.230.520.340.040.070.060.380.040.090.060.160.220.160.470.110.210.19-18.33-18.07-19.52-17.71-19.74-18.10-17.192.732.792.863.052.882.772.850.480.490.520.530.500.480.501.843.363.063.492.592.503.39
UAUAUAAAUUAUAUGUUUAUUUAUGUAUUACAUGAGGAUCACCCAUGUACACGGGUGAUUUUAUGUAUUAUAUAUAUAAAUAUAU
307113735.298.2412.9443.5385
39
6654950MS2 ctrl ON #25MalcolmMS2 control ON103100.0070.0030.002962832883.740.823.743.723.483.893.913.874.261.041.031.041.071.031.031.041.101.171.091.351.031.101.110.5612.200.4933.600.75232048.301.380.030.710.031.980.0413487.530.080.380.440.370.740.360.360.34-19.40-19.41-19.48-19.37-19.36-19.37-19.270.630.460.661.180.580.570.640.040.030.040.070.030.030.040.410.370.380.570.400.340.46
CAUAAGUGUAAUACUGGAUGAACUGAUUUACAUGAGGAUCACCCAUGUAGAUCGAGAGGUAUGUAUGGCUAUCAUAUAUAUGUCG
2712202631.7614.1223.5330.5985
40
6654953MS2 ctrl ON #26MalcolmMS2 control ON103100.0070.0030.003002572833.700.873.703.613.624.023.963.854.161.071.051.051.051.031.061.041.111.131.091.261.131.201.140.9037.492.024.1216.453.4213.710.052.160.130.240.980.200.810.390.400.370.560.400.470.38-19.41-19.44-19.44-19.33-19.35-19.37-19.301.090.790.850.890.540.950.680.060.050.050.050.030.050.040.400.330.390.490.410.410.37
CAUAAGUGUAAUACUGGAUGAACUGAUUUACAUGAGGAUCACCCAUGUAGAUCGAAAGGUAUGUAUGGCUAUCAUAUAUAUGUCG
2812192632.9414.1222.3530.5985
41
6654955MS2 ctrl ON #27MalcolmMS2 control ON103100.0070.0030.001871641833.710.783.713.913.604.314.313.994.631.081.081.051.091.071.071.061.071.151.101.301.111.131.120.767.482.1025.910.751.391.190.060.550.161.920.060.100.090.280.420.400.640.360.400.43-19.41-19.36-19.44-19.26-19.26-19.34-19.191.011.010.671.180.900.980.800.070.070.050.090.070.070.060.420.400.470.640.430.410.46
CAUAAGUGUAAUACUGGAUGAACUGAUUUACAUGAGGAUCACCCAUGUAGAUUGAAAGGUAUGUAUGGCUAUCAUAUAUAUGUCG
2811192732.9412.9422.3531.7685
42
6654958AstrosMS2ControlOFF#4Astromon
MS2 control OFF
1030.000.006661618.500.468.5011.565.2923.334.419.468.771.421.381.431.451.341.381.410.190.270.190.420.180.330.245.770.870.192.220.201.700.320.710.110.020.280.030.210.040.160.240.180.430.200.200.26-18.58-18.28-19.06-17.57-19.24-18.48-18.552.852.612.772.882.292.642.670.350.320.350.370.290.320.342.432.672.253.322.382.762.15
UAUAUAAAUUAUAUGUUUAUUUAUGUAUUACAUGAGGAUCACCCAUGUACACGGGUGAUUUUAUGUAUUAUAUAUAUGAAUAUAU
297123734.128.2414.1243.5385
43
6654960MS2 ctrl ON #28MalcolmMS2 control ON103100.0070.0030.002192072393.880.823.883.633.904.074.323.874.711.061.071.091.081.061.071.061.101.201.101.281.101.211.120.90258.701.682.91270253.683.29200.610.0617.480.120.1917481.260.2212.980.410.470.440.590.450.480.39-19.37-19.44-19.36-19.32-19.26-19.37-19.170.901.001.181.180.881.010.890.060.070.080.080.060.070.060.400.400.470.600.410.480.46
CAUAAGUGUAAUACUGGAUGUACUGAUUUACAUGAGGAUCACCCAUGUAGAUUGAAAGGUAUGUAUGGCUAUCAUAUAUAUGUCG
2711192831.7612.9422.3532.9485
44
6654962MS2 ctrl ON #29MalcolmMS2 control ON103100.0070.0030.001871671944.030.804.033.733.754.544.543.664.601.051.041.101.061.051.061.051.081.151.001.061.011.151.010.509.010.921210170.770.44871.490.640.040.660.0786885.200.0363.730.050.430.420.320.450.340.450.36-19.33-19.41-19.40-19.21-19.21-19.43-19.200.710.531.250.850.710.850.610.050.040.100.060.050.060.040.440.380.420.560.470.450.41
CAUAAGUGUAAUACUGGAUGUACUGAUUUACAUGAGGAUCACCCAUGUAGAUAGAAAGGUAUGUAUGGCUAUCAUAUAUAUGUCG
2811192732.9412.9422.3531.7685
45
6654967MS2 ctrl ON #30MalcolmMS2 control ON103100.0070.0030.002151612294.040.824.043.883.754.194.184.084.591.061.061.071.071.061.071.061.051.091.031.191.061.151.110.64159483.160.745.190.660.750.610.0410876.660.060.340.040.050.040.310.370.340.510.370.370.37-19.33-19.37-19.40-19.29-19.29-19.32-19.200.880.920.811.090.900.920.940.060.060.060.070.060.060.060.440.440.400.540.360.400.37
CAUAAGUGUAAUACUGGAUGUUCUGAUUUACAUGAGGAUCACCCAUGUAGAUAGAAAGGUAUGUAUGGCUAUCAUAUAUAUGUCG
2711192831.7612.9422.3532.9485
46
6654977MS2 ctrl ON #31MalcolmMS2 control ON103100.0070.0030.001591471473.500.873.503.443.403.603.653.663.891.071.061.041.081.041.061.051.051.171.121.291.051.151.080.773.860.5023.2325.391.7717.840.060.310.041.922.090.141.470.370.480.310.630.420.460.39-19.47-19.49-19.50-19.44-19.43-19.43-19.360.820.690.420.930.500.710.620.070.050.030.080.040.060.050.350.360.340.610.420.450.43
CAUAAGUGUAAUAAUGGAUGUUCUAAUUUACAUGAGGAUCACCCAUGUAGAUAGAAAGGUAUGUAUGGCUAUCAUAUAUAUGUCG
2910182834.1211.7621.1832.9485
47
6654979MS2 ctrl ON #32MalcolmMS2 control ON103100.0070.0030.001491371343.570.833.573.583.614.224.293.734.361.061.071.061.121.071.061.071.121.231.091.401.051.181.070.683085146.720.7223.25457.494.105.490.06252745.070.062.0139.520.340.470.420.590.410.730.430.520.44-19.45-19.45-19.44-19.28-19.27-19.41-19.250.660.810.651.270.780.720.750.050.070.060.110.070.060.070.390.460.410.630.500.470.41
CAUAAGUGUAAUAAUGGAUGUUCUAAUUUACAUGAGGAUCACCCAUGUAGAUAGAAAGGUAUGUAUGGCUAUCAUAUAUACGUCG
2911182734.1212.9421.1831.7685
48
6654981MS2 ctrl ON #33MalcolmMS2 control ON103100.0070.0030.002582442653.890.843.893.823.744.144.053.944.461.041.041.031.061.041.031.041.051.111.021.211.031.111.072.522496689.373.17334024.217.130.83293858.890.16155437.090.2020518.940.440.0518051.610.320.380.380.590.380.370.45-19.36-19.38-19.40-19.30-19.32-19.35-19.230.580.640.510.890.640.540.630.040.040.030.050.040.030.040.430.410.430.560.420.440.43
CAUAAGUGUAAUAAUGGAUGUUCUAAUUUACAUGAGGAUCACCCAUGUAGAUGGAAAGGUAUGUAUGGCUAUCAUAUAUACGUCG
2811192732.9412.9422.3531.7685
49
6654984MS2 ctrl ON #34MalcolmMS2 control ON103100.0070.0030.003163253566.980.906.986.917.157.807.447.377.901.041.041.041.051.031.041.031.001.080.961.140.981.081.010.4316457.860.482.340.710.672.090.02925.830.030.120.040.040.110.320.400.330.450.370.380.38-18.78-18.79-18.76-18.67-18.72-18.73-18.660.690.650.700.930.580.750.570.040.040.040.050.030.040.030.370.410.380.480.380.400.35
CAUAAGUGUAAUCAUGGAUGUUCUAAUUUACAUGAGGAUCACCCAUGUAGAUGGAAAGGUAUGUAUGGCUAUCAUAUAUACGUCG
2712192731.7614.1222.3531.7685
50
6654989...um?EizedMS2 control ON103100.0070.0030.001341371512.900.832.902.822.842.863.392.833.401.041.041.061.081.081.041.071.061.061.091.161.091.071.067.452.660.612.700.583.181.620.640.230.050.220.050.270.130.340.300.390.420.360.360.37-19.66-19.69-19.68-19.67-19.50-19.68-19.500.450.480.670.950.920.470.880.040.040.060.080.080.040.070.280.350.330.500.440.380.46
AAUAAAGCAUGUAUGAUGAAAACAUCAUACAUGCACGAGAUAUGUAAUAGCACAUGAGGAUCACCCAUGUGCUAUUACAUAUCUC
3316142238.8218.8216.4725.8885
51
6654994MS2 ctrl ON #35MalcolmMS2 control ON103100.0070.0030.001781731717.060.867.067.207.067.177.636.988.071.041.031.041.081.041.051.051.021.051.071.211.071.090.9910.3225.090.552.484.350.801.830.771.880.040.190.330.060.140.350.420.390.590.400.410.33-18.77-18.75-18.77-18.75-18.69-18.78-18.630.540.450.551.030.530.690.620.040.030.040.080.040.050.050.410.360.370.460.320.470.37
CAUAAGUGGAAUCAUGGAUGUUCUAAUUUACAUGAGGAUCACCCAUGUAGAUGGAAAGGUAUGUAUGUCUAGCAUAUAUACGUCG
2712202631.7614.1223.5330.5985
52
6654996MS2 ctrl ON #36MalcolmMS2 control ON103100.0070.0030.002922772857.100.827.106.886.968.147.496.918.451.041.051.051.071.061.051.051.011.040.981.260.951.091.040.691189082.660.492.451.641.541.770.0469585.800.030.140.100.090.100.320.410.330.660.350.430.45-18.76-18.79-18.78-18.63-18.71-18.79-18.590.750.830.741.090.910.790.850.040.050.040.060.050.050.050.390.410.400.680.380.460.49
CAUUAGUGGAAUCAUGGAUGUUCUAAUUUACAUGAGGAUCACCCAUGUAGAUGGAAAGGUAUGUAUGUCUAGCAUAUAUACGUCG
2612202730.5914.1223.5331.7685
53
6655001MS2 ctrl ON #37MalcolmMS2 control ON10393.9863.9830.001881892319.350.809.359.509.0511.5510.529.8511.311.051.051.061.061.031.061.040.940.990.971.090.961.001.011.5584.941.852.132.541.070.860.116.200.130.140.170.080.060.350.300.360.450.360.320.34-18.49-18.47-18.52-18.28-18.37-18.44-18.300.650.730.770.850.460.770.530.050.050.060.060.030.060.030.330.330.450.640.370.440.41
CAUUAGUGGAAUCAUGGAUGUUCUGGUUUACAUGAGGAUCACCCAUGUAGAAGGAAAGGUAUGUAUGUCUAGCAUAUAUACGUCG
2512222629.4114.1225.8830.5985
54
6655006MS2 ctrl ON #38MalcolmMS2 control ON10330.000.0030.00141144159353.740.46353.74363.16335.45356.74311.72220.88483.011.201.201.201.161.181.171.150.540.690.550.840.510.660.660.5411.720.443.041.600.550.540.050.990.040.240.130.050.040.300.400.280.500.200.350.29-14.85-14.83-14.91-14.85-14.98-15.33-14.542.122.132.151.872.041.881.730.180.180.180.150.160.160.141.932.041.921.731.941.891.39
CAUUAGUGGAAUCAUGGAUGAUCUGGUUUACAUGAGGAUCACCCAUGUAGAAGGAUAGGUAUGUAUGUCUAGCAUAUAUACGUCG
2512222629.4114.1225.8830.5985
55
6655011MS2 ctrl ON #39MalcolmMS2 control ON10330.000.0030.00173156169442.460.73442.46328.71320.17404.81300.62269.76368.331.171.161.191.181.181.171.160.530.650.500.860.530.670.620.468.411.534.000.691.470.680.040.640.120.310.050.110.050.300.310.300.540.290.290.31-14.63-14.93-14.95-14.72-15.02-15.13-14.812.041.992.222.162.122.041.970.150.150.180.170.160.160.152.011.851.771.741.841.561.82
CAUUAGUGGAAUCAUGGAUGAUCUGGUUUACAUGAGGAUCACCCAUGUAGAAGGAUAGGUAUGUAUGUCUAGCAUAAAUACGUCG
2612222530.5914.1225.8829.4185
56
6655013MS2 ctrl ON #40MalcolmMS2 control ON10330.000.0030.00233208221414.570.47414.57308.40296.63409.12328.89225.10483.331.141.141.161.151.161.141.150.600.650.460.890.520.680.682.442563.8863.871.550.441.280.460.16167.974.430.100.030.080.030.300.330.230.500.250.320.32-14.70-14.99-15.03-14.71-14.93-15.31-14.542.062.002.172.022.161.982.050.130.130.150.140.150.130.141.981.821.761.612.211.891.98
CAUUGGUGGAAUCAUGGAUGAUCUGGUUUACAUGAGGAUCACCCAUGUAGAAGGAUAGGUAUGUAUGUCUAGCAUAGAUACGUCG
2412242528.2414.1228.2429.4185
57
6655018AstrosMS2ControlOFF#5Astromon
MS2 control OFF
1030.000.006670736.980.356.9811.334.0025.716.549.135.331.401.421.481.431.331.431.330.150.250.140.350.150.270.160.2111.880.240.540.160.650.140.031.460.030.060.020.080.020.140.180.120.300.150.190.15-18.78-18.30-19.34-17.48-18.85-18.51-19.052.722.843.263.082.442.902.420.330.350.390.360.290.360.282.462.953.363.892.392.842.24
UAUAUAAAUUAUAUGUUUAUUUAUGUAUUACAUGAGGAUCACCCAUGUACACGGGUGAUUUUAUGUAUUAUAUAUAUGAAUAUGU
287133732.948.2415.2943.5385
58
6655042
Sequence matching my goat puzzle with a few mutations
Eized
MS2 control OFF
1030.000.0036524315.820.8015.8216.2515.4716.6818.4216.1319.271.111.091.051.151.151.141.101.111.171.131.351.261.091.200.444.520.303.620.530.650.650.070.750.040.550.080.110.100.410.520.250.450.470.400.43-17.96-17.94-17.98-17.91-17.81-17.94-17.760.620.530.370.910.930.790.640.100.090.050.140.140.130.100.340.340.320.440.310.460.35
CGCGAACCCGCAGGGUGCGCGCCAAAGGUCCGCAAACAUGAGGAUCACCCAUGUCAAAGUGGGAGCGAGGGCGAAGAAAUUUUUC
2422271228.2425.8831.7614.1285
59
6655066MS2 ctrl OFF #01Malcolm
MS2 control OFF
1030.000.0056323811.140.4911.1421.8710.7113.6710.4948.7319.191.431.411.581.541.311.321.380.150.280.190.370.230.340.320.294.930.632.530.200.270.260.040.660.110.410.030.040.040.150.240.100.330.220.240.25-18.31-17.64-18.35-18.11-18.37-16.84-17.772.662.572.572.651.682.081.990.360.340.450.430.270.280.322.562.441.772.181.962.101.89
ACAUGAGGAUCACCCAUGUUAUAUAUAUAUAUAUAUAUACGAAGAGUGUGUGUGUGUGUGUGUGUGAUAUGGGUGAUUUUUAUGU
236223427.067.0625.8840.0085
60
6655076MS2 ctrl OFF #02Malcolm
MS2 control OFF
1030.000.0075728743.070.6543.0756.3658.81128.1252.8449.1675.481.151.181.201.251.181.181.170.500.590.460.690.490.650.543.251218.240.955.130.851.030.510.38140.670.110.550.090.120.050.270.250.240.540.280.290.25-16.96-16.69-16.65-15.87-16.76-16.83-16.401.181.441.532.101.571.461.440.140.170.180.230.170.170.150.951.231.141.901.130.761.14
GCAUGAGGAUCACCCAUGUUAUAUAUAUAUAUAUAUAUAACAUGAGGAUCACCCAUGUUGUGUGAGAUAUGGGUGAUUUUUAUGC
2611183030.5912.9421.1835.2985
61
6655081MS2 ctrl OFF #03Malcolm
MS2 control OFF
1030.000.0091659155.050.6855.0549.0363.94107.2183.8857.3979.821.201.181.221.311.151.191.170.440.600.460.750.470.640.440.344.220.443.020.240.971.240.040.440.050.320.020.100.130.250.330.250.520.220.350.27-16.72-16.83-16.57-16.05-16.29-16.67-16.341.751.551.622.591.341.691.500.180.160.200.270.140.180.161.081.290.942.171.211.531.34
GCAUGAGGAUCACCCAUGUUAUAUAUAUAUAUAUAUAUAACAUGAGGAUCACCCAUGUUGUGUGCGAUAUGGGUGAUUUUUAUGC
2512183029.4114.1221.1835.2985
62
6655086MS2 ctrl OFF #04Malcolm
MS2 control OFF
10391.1491.14342283284152.520.67152.52159.58175.06240.07202.44139.39207.281.081.081.111.121.101.101.100.490.570.450.660.510.630.480.65181.356.971501.390.791.111.410.049.810.4189.090.050.060.080.230.260.250.440.260.260.24-15.70-15.65-15.56-15.24-15.41-15.79-15.391.511.391.771.891.551.691.610.080.080.110.110.090.090.101.321.221.291.481.281.351.45
GCAUGAGGAUCACCCAUGUUAUAUAUGUAUACAUAUAUAACAUGAGGAUCACCCAUGUUGUGUGCGAUAUGGGUGAUUUUUAUGC
2413192928.2415.2922.3534.1285
63
6655089MS2 ctrl OFF #05Malcolm
MS2 control OFF
103100.00100.00258240246220.190.73220.19226.50227.56322.75304.98223.41296.481.101.091.111.121.101.091.110.510.570.490.730.530.590.533666.128.930.72412.370.430.571.32228.240.560.0526.290.030.040.080.240.260.250.440.270.250.26-15.33-15.30-15.30-14.95-15.00-15.31-15.031.521.451.601.771.541.361.580.090.090.100.110.100.080.101.111.251.321.301.031.041.05
GCAUGAGGAUCACCCAUGUUAUAUAUGGAUACAUAUAUAACAUGAGGAUCACCCAUGUUGUGUGCGAUAUGGGUGAUUUUUAUGC
2413202828.2415.2923.5332.9485
64
6655096MS2 ctrl OFF #06Malcolm
MS2 control OFF
103100.00100.00143146133385.540.55385.54428.58263.21486.04338.99235.41369.251.201.191.231.231.221.181.210.400.510.310.630.420.530.470.603.250.355.180.470.530.640.050.270.030.450.040.040.060.230.350.240.460.290.260.29-14.77-14.66-15.15-14.54-14.90-15.26-14.812.222.122.472.352.292.022.240.190.180.200.200.200.170.192.121.542.252.102.741.992.17
GCAUGAGGAUCACCCAUGUUAUAUAUGGAUACAUAUAUAACAUGAGGAUCACCCAUGUUGGGUACGAUAUGGGUGAUUUUUAUGC
2513202729.4115.2923.5331.7685
65
66551011.1 Sensor A MS2 ONAzor
Sensor A MS2 ON
10361.5629.9330.001.6315413421910.148.501.191.24-0.180.220.5210.148.5012.7531.7924.4213.189.861.241.041.251.111.081.221.040.190.960.210.700.530.370.870.400.630.391.880.42283.760.810.030.050.030.130.0322.870.050.160.340.180.330.210.240.28-18.41-18.58-18.18-17.26-17.53-18.14-18.432.620.512.591.591.162.470.530.210.040.220.110.080.200.042.030.352.321.220.882.150.35
ACAUGAGGAUCACCCAUGUCUUGUUCUUUGUUGUGCGGUCUUUUAAAAGAGAAGAGGACAUAAAAGGCAUGUGUGUUUUUUAUGU
2211213125.8812.9424.7136.4785
66
6655106MS2 ctrl OFF #07Malcolm
MS2 control OFF
1030.000.0013313011629.990.2229.9957.3622.45216.7714.6165.26103.411.281.241.341.301.311.241.280.250.390.250.690.290.410.361.583.190.825.501.110.760.380.140.280.070.510.100.070.030.220.300.230.580.280.260.29-17.32-16.67-17.61-15.34-18.04-16.54-16.082.822.513.352.792.932.512.650.240.220.290.260.270.220.253.263.023.702.762.882.822.69
GCAUGAGGAUCACCCAUGUAAUAUAUGGAAACAUAUAUUACAUGAGGAUCACCCAUGUUGGGUACGAUAUGGGUGAUUUUUAUGC
2613202630.5915.2923.5330.5985
67
6655111MS2 ctrl OFF #08Malcolm
MS2 control OFF
1030.000.001141089032.650.7332.6575.4965.6455.2232.66104.1958.851.301.261.331.321.311.301.330.290.410.290.670.320.520.400.386.300.381.410.470.680.530.040.590.040.150.050.060.060.200.340.290.560.320.350.29-17.24-16.40-16.54-16.71-17.24-16.08-16.652.792.492.982.662.562.802.670.260.230.290.280.270.260.282.932.953.272.752.763.643.21
GCAUGAGGAUCACCCAUGUGAUAUAUGGAAACAUAUAUUACAUGAGGAUCACCCAUGUUGGGUACGAUAUGGGUGAUUUUUAUGC
2513212629.4115.2924.7130.5985
68
6655118MS2 ctrl OFF #09Malcolm
MS2 control OFF
1030.000.00110938672.410.4772.41153.20110.54285.43213.2099.59196.431.321.291.391.311.351.281.310.310.420.310.630.340.440.310.4814.600.301.610.330.590.510.051.390.030.170.040.060.060.240.250.220.390.240.270.19-16.44-15.69-16.02-15.07-15.36-16.12-15.442.892.633.172.482.782.592.480.280.250.330.270.300.250.273.703.253.862.583.402.953.19
GCAUGAUGAUCACCCAUGUGAUAUAUGGAAACAUAUAUUACAUGAGGAUCACCCAUGUUGGGUACGAUAUGGGUGAUUAUUAUGC
2613202630.5915.2923.5330.5985
69
6655120MS2 ctrl OFF #10Malcolm
MS2 control OFF
103100.00100.00303280274385.580.71385.58394.82353.65621.32498.84372.88471.471.111.121.131.151.141.111.130.500.620.470.840.500.630.580.455.930.7452.100.520.530.630.030.340.043.150.030.030.040.260.290.270.540.250.300.30-14.77-14.74-14.85-14.29-14.51-14.80-14.571.812.032.112.282.161.812.080.100.120.130.140.130.100.131.741.581.801.801.591.381.81
GCAUGAUGAUCACCCAUGUGAUAUAUGGAAACAUAUAUUACAUGAGGAUCACCCAUGUGGGAUACUAUAUGGGUGAUUAUUAUGC
2713192631.7615.2922.3530.5985
70
6655122MS2 ctrl OFF #11Malcolm
MS2 control OFF
103100.00100.00261258226265.740.60265.74294.62250.70319.93326.81223.35375.341.101.101.111.151.121.111.100.520.640.530.810.540.670.620.88288359.960.574.630.520.723.150.0517849.030.040.310.030.040.210.260.310.240.600.310.280.27-15.14-15.04-15.20-14.96-14.93-15.31-14.801.591.601.652.061.731.661.410.100.100.100.140.120.100.091.181.031.241.451.251.061.08
GCAUGAUGAUCACCCAUGUGAUAUAUGGAAACAUAUAUUACAUGAGGAUCACCCAUGUGCGAUAGUAUAUGGGUGAUUAUUAUGC
2713192631.7615.2922.3530.5985
71
6655131MS2 ctrl OFF #12Malcolm
MS2 control OFF
103100.00100.00143128144291.710.79291.71262.77229.79336.79262.97210.62267.111.151.141.171.161.111.131.130.530.670.580.830.620.680.640.441.980.422.220.730.556.340.040.170.040.180.060.050.530.280.270.270.490.300.280.29-15.05-15.15-15.29-14.90-15.15-15.37-15.141.661.521.801.771.231.481.420.140.130.160.150.100.120.121.201.281.181.361.181.311.06
GCAUGAUGAUCACCCAUGUGAUAUAUCGAAAGAUAUAUUACAUGAGGAUCACCCAUGUGCGAAAGUAUAUGGGUGAUUAUUAUGC
2813192532.9415.2922.3529.4185
72
6655138MS2 ctrl OFF #13Malcolm
MS2 control OFF
1030.000.001271241094.930.304.9310.003.5319.836.828.4411.701.251.261.271.321.261.291.260.180.280.170.660.260.330.3229181.1714167.780.6115.260.601.112.292589.411257.190.061.460.060.100.220.180.240.150.650.230.230.32-19.13-18.42-19.46-17.74-18.80-18.59-18.262.532.562.642.892.442.852.430.220.230.240.280.230.250.231.672.082.542.982.002.531.57
GCAUGAUGAUCUCCCAUGUGAUAUAUCGAAAGAUAUAUUACAUGAGGAUCACCCAUGUGCGAAAGUAUAUGGGUGAUUAUUAUGC
2713192631.7615.2922.3530.5985
73
6655140MS2 ctrl OFF #14Malcolm
MS2 control OFF
1030.000.005458483.740.483.746.042.949.744.388.456.181.421.471.371.511.301.431.490.190.290.160.600.270.350.340.250.850.250.813.160.390.640.030.120.030.120.460.050.090.190.230.130.570.310.320.38-19.40-18.92-19.65-18.45-19.25-18.59-18.902.572.822.422.841.792.622.780.350.380.320.410.260.360.401.622.571.792.421.252.131.85
GCAUGAUGAACUCCCAUGUGAUAUAUCGAAAGAUAUAUUACAUGAGGAUCACCCAUGUGCGAAAGUAUAUGGGUGAUUAUUAUGC
2813192532.9415.2922.3529.4185
74
6655148MS2 ctrl OFF #15Malcolm
MS2 control OFF
1030.000.008177957.900.267.9014.813.91122.497.558.6810.211.291.301.451.311.301.321.300.200.340.170.640.160.340.190.350.960.291.030.2466.160.870.040.110.030.110.027.350.090.210.280.170.520.140.260.18-18.66-18.03-19.36-15.92-18.70-18.56-18.402.312.373.272.652.562.522.580.260.260.370.270.260.280.271.942.663.043.002.722.662.31
GCAUGAUGAACUCCCAUGUGAUAUAUCGAAAGAUAUAUUACAUGAGGAUCACCCAUGUGCGAAAGUAUAUGGGUGGUUAUUAUGC
2713202531.7615.2923.5329.4185
75
6655153MS2 ctrl OFF #16Malcolm
MS2 control OFF
1030.000.004238387.300.887.308.368.6659.214.2911.879.841.601.561.461.601.521.571.380.200.240.170.380.150.290.243.612.492.992.250.392.660.270.560.380.480.360.060.410.040.210.180.150.300.130.260.25-18.74-18.60-18.56-16.64-19.27-18.25-18.443.042.902.332.912.582.911.980.470.450.380.470.420.450.322.473.102.322.821.542.471.33
GCAUGAUGAAAUCCCAUGUGAUAUAUCGAAAGAUAUAUUACAUGAGGAUCACCCAUGUGCGAAAGUAUAUGGGUGGUUAUUAUGC
2812202532.9414.1223.5329.4185
76
6655155MS2 ctrl OFF #17Malcolm
MS2 control OFF
1030.000.004750525.950.185.958.567.3090.3312.547.6440.391.441.421.521.461.421.471.390.200.310.151.230.310.350.330.400.461.633.781.430.440.960.060.070.230.520.200.060.130.200.250.151.220.370.250.38-18.94-18.58-18.74-16.22-18.19-18.69-17.022.512.402.942.712.542.632.370.370.350.420.380.350.380.331.941.823.212.751.781.502.48
GCAAUAUGUAAUCCCAUGUGAUAUAUCGAAAGAUAUAUUACAUGAGGAUCACCCAUGUGCGAAAGUAUAUGGGUGGAUAUGUUGC
2812202532.9414.1223.5329.4185
77
6655157MS2 ctrl OFF #18Malcolm
MS2 control OFF
1030.000.005872729.760.979.766.278.816.786.078.306.991.451.471.411.391.281.381.300.190.300.200.410.230.320.250.274.807.483.851.590.460.570.040.630.880.450.190.060.070.200.240.230.450.220.220.27-18.45-18.89-18.55-18.81-18.92-18.61-18.782.832.922.912.772.112.462.200.370.380.340.330.250.320.262.172.572.692.001.432.261.44
GUAAUAUGUAAUCCCAUGUGAUAUAUCGAAAGAUAUGUUACAUGAGGAUCACCCAUGUGCGAAAGUAUAUGGGUGGAUAUGUUGC
2711212631.7612.9424.7130.5985
78
66551961.1 Sensor A MS2 OFF AzorAzor
Sensor A MS2 OFF
10332.660.0030.002.66164160148118.0188.551.331.11-0.290.110.4488.55118.0178.95140.22100.5070.41158.391.071.091.121.111.071.071.110.790.880.740.910.850.800.660.447.450.541.210.420.870.370.030.580.040.100.030.070.030.290.290.270.430.290.280.31-16.24-15.95-16.35-15.78-16.11-16.47-15.660.851.061.421.280.880.901.220.070.080.110.110.070.070.100.670.810.831.130.690.690.94
ACAUGAGGAUCACCCAUGUAUGGGUACUUGUUCUUUGUUGUGAUACCCAUUGUGUGUGUGUGUGUUGAAAGAUAUAUAUAUAUAC
2111203324.7112.9423.5338.8285
79
6655230AstrosSensorAms2ON#1Astromon
Sensor A MS2 ON
10358.6526.4130.002.23261313.3410.491.271.11-0.240.110.5613.3410.4919.1316.7219.2310.7114.991.101.051.281.201.191.171.111.1413.411.592.311.171.041.140.3516.300.592.900.400.360.370.2511.520.240.800.110.260.100.3717.090.701.530.430.380.33-18.13-18.37-17.77-17.91-17.77-18.35-18.020.140.070.600.650.620.220.380.100.050.240.180.170.160.100.140.070.800.600.380.230.20
AUUAUAUAUUUUUUAUAUAAAUAUAUGUUUUAAUUAAUAUAUAUAUUCACAUGAGGAUCACCCAUGUAAUAAUUGUGGGAAUAAC
33793638.828.2410.5942.3585
80
6655278AstrosSensorAON#2Astromon
Sensor A MS2 ON
10357.6924.5230.003.1732232616.2611.551.411.14-0.340.130.9816.2611.5519.7116.0916.4517.9714.511.091.101.111.121.091.101.091.121.190.941.260.931.271.040.290.501.241.610.310.510.380.050.090.260.320.060.090.070.370.360.340.470.210.410.25-17.93-18.28-17.74-17.94-17.92-17.83-18.050.510.550.510.590.450.560.430.090.100.110.120.090.100.080.370.360.410.440.490.490.33
AUUAUAUAUUUUAUAUAUAAAUAUAUGUUUUAAUUAAUAUGUAUAUUCACAUGAGGAUCACCCAUGUAAUAAUUGUGGGAAUAAC
337103538.828.2411.7641.1885
81
6655288AstrosSensorAON#3Astromon
Sensor A MS2 ON
10351.6218.8330.002.7915171919.9414.761.351.17-0.300.160.9519.9414.7619.5319.9916.0415.5716.411.131.101.101.211.111.151.211.141.191.041.751.021.201.020.610.570.424.229.480.3952.770.160.150.100.972.180.1012.110.570.630.451.390.390.360.55-17.73-18.03-17.75-17.73-17.95-17.98-17.930.480.360.400.840.470.530.820.120.090.100.190.110.140.190.430.210.430.500.240.290.34
AUUAUAUAUUUUAUAUAUAAAUAUAUGUUUUAAUUAAUUUGUAUAUUCACAUGAGGAUCACCCAUGUAAUAAUUGUGGGAAUAAC
327103637.658.2411.7642.3585
82
6655303MS2 ctrl OFF #19Malcolm
MS2 control OFF
1030.000.005859517.350.707.355.746.4350.775.5826.939.131.421.401.421.501.471.451.580.180.280.140.370.120.300.230.152.160.491.320.300.270.520.020.280.060.190.040.040.070.150.190.140.260.130.230.20-18.73-18.98-18.86-16.80-19.00-17.43-18.512.672.572.682.902.772.843.250.350.340.350.410.390.370.462.572.282.243.552.672.943.26
GUAAUAUGCAAUCCCAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGGGUAUGUUGC
2612222530.5914.1225.8829.4185
83
6655309MS2 ctrl OFF #20Malcolm
MS2 control OFF
1030.000.003552453.550.393.558.114.61139.164.7913.0711.901.451.461.501.471.411.571.440.200.270.140.640.120.340.220.490.230.2713.5985806.600.330.620.080.040.042.0312791.290.050.090.180.190.150.470.130.220.20-19.46-18.63-19.19-15.79-19.16-18.15-18.252.202.252.922.592.292.652.460.370.380.400.390.340.450.371.551.733.392.732.262.902.90
GUAAUAUACAAUCCCAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGGGUAUGUUGC
2712212531.7614.1224.7129.4185
84
6655314MS2 ctrl OFF #21Malcolm
MS2 control OFF
1030.000.009387893.340.503.348.634.3036.327.9011.337.331.291.371.381.311.241.341.290.110.230.180.630.240.330.300.2138918.990.455.730.361.401.720.024035.710.050.610.040.150.180.100.200.160.580.200.240.21-19.52-18.57-19.27-17.13-18.66-18.30-18.732.493.002.992.532.032.802.380.260.310.320.270.220.290.252.412.872.603.031.822.851.74
GUAAUAUACAAUCCCAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGAGUAUGUUGC
2812202532.9414.1223.5329.4185
85
6655325MS2 ctrl OFF #22Malcolm
MS2 control OFF
1030.000.004738454.350.344.355.237.4720.545.2911.7721.831.531.511.521.491.331.471.430.140.200.220.520.160.320.190.21129.390.252.320.220.700.850.0318.870.040.350.030.100.130.110.150.220.430.170.280.17-19.25-19.07-18.71-17.70-19.06-18.26-17.642.902.802.562.691.942.662.390.420.410.420.400.290.390.363.202.741.972.691.402.522.50
GUAAUAUACGGUCCCAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGAAAAUGUUGC
2812212432.9414.1224.7128.2485
86
6655335MS2 ctrl OFF #23Malcolm
MS2 control OFF
1030.000.005641415.740.245.746.575.23119.566.778.7321.881.451.491.541.491.521.421.500.170.270.120.580.210.340.380.240.990.130.900.441.030.260.030.130.020.140.070.140.040.150.180.100.480.220.220.27-18.98-18.84-19.07-15.94-18.81-18.56-17.642.762.992.752.542.672.652.590.370.400.430.400.420.350.412.362.522.642.812.022.242.88
GUAAUAUACGGUCCCAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGAGAACGUUGC
2713222331.7615.2925.8827.0685
87
6655340AstrosSensorAON#4Astromon
Sensor A MS2 ON
10356.1223.1430.002.9816191717.0112.331.381.11-0.320.100.9117.0112.3318.5317.7416.0516.2917.961.071.081.141.211.351.121.251.091.340.911.290.931.351.080.290.410.800.930.360.380.860.070.100.180.220.090.100.210.290.480.360.560.430.370.54-17.89-18.21-17.80-17.85-17.95-17.93-17.840.280.310.570.791.230.450.930.070.080.130.190.300.110.230.220.170.410.490.310.410.45
GUUAUAUAUUUUAUAUAUAAAUAUAUGUUUUAAUUAAUUUGUAUAUUCACAUGAGGAUCACCCAUGUAAUAAUUGUGGGAAUAAC
317113636.478.2412.9442.3585
88
6655343MS2 ctrl OFF #24Malcolm
MS2 control OFF
1030.000.004946504.220.414.2210.794.6363.976.129.6911.431.571.521.471.561.471.491.430.200.330.160.560.150.340.230.212.450.164.251.630.480.590.030.350.020.600.230.070.080.210.170.130.450.140.240.22-19.28-18.34-19.19-16.56-18.91-18.45-18.293.142.952.613.142.732.782.530.450.420.380.440.390.400.363.312.562.873.142.082.852.52
GUAAUAUACGGACCCAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGAGAACGCCGC
2815222032.9417.6525.8823.5385
89
6655347MS2 ctrl OFF #25Malcolm
MS2 control OFF
1030.000.004948417.880.517.8812.036.1434.485.089.676.541.441.421.551.551.511.421.580.170.310.170.440.150.280.170.171.400.501.060.190.350.390.020.200.070.170.030.050.060.120.220.130.480.150.190.17-18.66-18.24-18.91-17.18-19.10-18.45-18.852.532.473.042.792.652.432.950.360.350.440.440.410.350.461.882.043.243.292.562.162.30
GUAAUAUACGGACCCAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGUGAACGCCGC
2715222131.7617.6525.8824.7185
90
6655357MS2 ctrl OFF #26Malcolm
MS2 control OFF
1030.000.004441399.930.719.937.849.7241.105.036.328.911.451.531.601.511.431.451.470.180.250.310.520.270.320.290.280.54843.020.810.781.210.680.040.08131.660.130.120.180.110.150.190.320.470.270.260.23-18.43-18.66-18.45-17.01-19.11-18.88-18.542.482.833.012.562.252.472.390.370.430.470.410.360.370.382.551.643.422.852.262.442.21
GUAAUAUACGGAUCCAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGUGAACGCCGC
2714222231.7616.4725.8825.8885
91
6655359MS2 ctrl OFF #27Malcolm
MS2 control OFF
1030.000.002016121.910.561.9135.0519.77441.342.8349.079.312.001.992.432.662.331.982.580.110.240.100.510.140.380.220.230.200.161.390.600.290.440.050.040.040.400.170.060.130.120.200.090.390.160.140.18-20.08-17.17-17.74-14.63-19.68-16.83-18.493.093.073.553.382.933.063.290.690.690.890.980.850.680.951.993.242.883.152.673.813.34
GUAAUAUACGGAUACAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGUGAACGCCGC
2813222232.9415.2925.8825.8885
92
6655366MS2 ctrl OFF #28Malcolm
MS2 control OFF
1030.000.002214295.020.435.028.295.6623.464.898.2613.221.931.631.771.721.501.841.570.280.270.150.510.200.420.250.210.240.141.240.780.300.340.050.050.040.230.140.060.060.200.160.100.410.180.300.24-19.11-18.61-18.99-17.57-19.14-18.61-18.143.072.292.142.922.172.862.420.660.490.570.540.400.610.453.112.661.973.601.673.422.05
GUAAUAUACGGAUACAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGUGAACUCCGC
2813212332.9415.2924.7127.0685
93
6655375MS2 ctrl OFF #29Malcolm
MS2 control OFF
1030.000.004133247.260.647.268.355.8731.516.9932.329.221.391.531.801.721.821.651.730.140.280.150.680.250.360.270.190.140.311.590.730.600.470.030.020.050.320.150.090.100.100.150.170.730.290.260.32-18.74-18.60-18.95-17.27-18.78-17.25-18.502.132.733.382.662.933.202.680.330.430.590.540.600.500.552.252.693.903.062.113.202.36
GUAAUAUACGGAUACAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGAGAACUCCGC
2913212234.1215.2924.7125.8885
94
66553791.1 Sensor B MS2 OFFAzor
Sensor B MS2 OFF
10325.990.0025.300.68332124156.90145.761.081.63-0.070.490.42145.76161.99156.90337.61277.91236.90375.601.221.231.561.411.251.201.280.640.780.360.780.670.820.410.401.210.372.910.370.640.250.070.210.080.590.080.110.050.300.310.240.600.290.440.28-15.74-15.64-15.67-14.90-15.10-15.26-14.791.121.212.041.701.071.051.210.200.210.440.350.220.180.251.131.052.321.530.670.860.71
ACAUGAGGAUCACCCAUGUAUGGGUAGAGUGAGAUGGAACCCAAGAUAUAUAUAUAUAUAUAGAAAUGUGUGUGUGUGUGUGUCC
2710232531.7611.7627.0629.4185
95
6655381MS2 ctrl OFF #30Malcolm
MS2 control OFF
1030.000.005135325.570.435.575.673.61201.787.957.958.351.401.451.561.731.651.391.590.160.280.160.490.180.330.180.200.310.191.070.280.240.230.030.040.030.190.050.030.040.130.210.120.390.220.150.19-19.01-18.99-19.44-15.42-18.65-18.65-18.602.382.672.623.102.832.362.610.330.370.440.550.500.330.462.252.052.693.302.442.622.35
GUAAUAUACGGAUACAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUUAGAAAUCCGC
3012202335.2914.1223.5327.0685
96
6655385MS2 ctrl OFF #31Malcolm
MS2 control OFF
1030.000.001918236.210.206.216.392.2232.747.379.2211.141.691.592.031.661.951.751.900.140.200.150.600.220.270.270.220.420.190.590.200.250.260.050.100.040.120.040.060.050.100.100.130.540.200.240.31-18.90-18.87-19.92-17.23-18.73-18.50-18.312.292.023.002.433.202.433.070.530.460.710.510.670.560.642.021.501.803.213.322.332.20
GUAAUAUACCGAUACAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUUAGAAAUCCGC
3013192335.2915.2922.3527.0685
97
6655388MS2 ctrl OFF #32Malcolm
MS2 control OFF
1030.000.003939306.370.466.3713.326.1317.2313.4413.576.151.611.591.461.671.521.511.620.220.250.160.380.170.300.210.330.850.180.910.330.240.250.050.140.030.170.060.040.050.220.180.160.420.200.250.19-18.87-18.13-18.91-17.88-18.13-18.12-18.912.972.912.362.792.312.582.650.480.470.380.510.420.410.482.973.071.962.392.582.051.77
GUAAUAUACCGAUACAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGAGAAAUCCGC
3013202235.2915.2923.5325.8885
98
6655392MS2 ctrl OFF #33Malcolm
MS2 control OFF
1030.000.004336376.060.556.065.984.4311.138.0210.837.281.561.471.461.501.501.471.500.180.270.150.480.190.360.250.249.790.140.820.220.500.240.041.490.020.140.040.080.040.190.230.100.420.160.230.19-18.92-18.93-19.23-18.31-18.64-18.34-18.742.902.512.282.482.452.542.450.440.380.380.410.400.390.402.081.532.552.952.062.711.79
GUGGUAUACCGAUACAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGAGAAAUCCGC
2813222232.9415.2925.8825.8885
99
6655398MS2 ctrl OFF #34Malcolm
MS2 control OFF
1030.000.009274586.450.316.4514.964.6240.673.0410.859.471.281.331.401.431.311.311.350.160.270.160.360.130.350.170.190.6637.341.700.290.800.780.020.074.340.220.040.080.100.140.210.160.330.130.240.16-18.86-18.02-19.19-17.02-19.61-18.34-18.472.342.752.912.742.082.562.280.240.290.340.360.270.270.302.113.403.103.231.633.131.91
GUGGUAUACCGAUACAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGGGAAAUCCGC
2713232231.7615.2927.0625.8885
100
6655406MS2 ctrl OFF #35Malcolm
MS2 control OFF
1030.000.008975785.770.155.777.623.0639.278.798.4620.591.321.271.431.371.331.341.320.140.250.130.580.230.290.290.270.500.333.700.500.641.280.030.050.040.420.060.070.140.110.240.130.440.170.210.26-18.97-18.69-19.61-17.05-18.55-18.59-17.702.592.253.082.762.552.752.450.270.240.360.310.290.290.282.622.172.673.302.022.182.49
GUGGUAUACCGAUACAUGUGAUAUAUGGAAACAUAUGUUACAUGAGGAUCACCCAUGUGGGAAACUAUAUGGGUGGGAAAUCCUC
2713222331.7615.2925.8827.0685
Loading...
Main menu