OH_New_Strain_Collection
 Share
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

 
View only
 
 
ABCDEFGHIJKLMNOPQRSTUVWX
1
W i l l i n c l u d e n e w O H n u m b e r
2
Use These Buttons to Create New Strain Entries6342Oh8click this ONLY if you don't need Ex, Is, Ti, otNote about requests!!: request strain from the collection ONLY if you see "Box ..: ..-.." in the 'Location' and 'New Location' columns.
3
otEx7311otIs716otTi53ot931
eg for CGC strains
OH15728
4
! Double check new strain names for duplicates !! --see FAQ -help
5
6
alleles / transgenesgenotypestrain backgroundDNA on arrayRecord creation datestrain creation date strain created byLOCATIONNEW LOCATIONline #notes (strain ordered by, record created by, aliases)remarks (constructs, primers, backcross, inj. mix, purpose)strain maintenanceexpression
7
OH1872unc-30(e191); oxIs12genotypeNAOH
8
unc-30(e191); lim-6(nr2073); oxIs12unc-30(e191); lim-6(nr2073); oxIs12NAOH1-4-4-5COULDN'T RECOVER - 1/05
9
lim-6(nr2073); juIs8TM321NAOHBOX 1: 10-6juIs8 = GAD::GFP integrant from Yishi Jin; probably on LGV (him-5 double not possible)
10
OH1554otEx821 Ex[lim-4fl::gfp; rol-6]N2Ex[lim-4fl::gfp; rol-6]NA11/2/2016OH in Ruvkun labBox 70: 2-1#6 out of many; #1 also in the strain collectionsee Sagasti paper; this is one of two lines in our strain collection; is probably not the one sent to Cori for ID
11
Ex[lim-4fl::gfp; rol-6]N2Ex[lim-4fl::gfp; rol-6]NAOH in Ruvkun labBox 1: 2-9#1 out of many; t#6 is also in collectionsee Sagasti paper; this is the 1 of two lines in our strain collection; is probably not the one sent to Cori for ID
12
NC198wdEx62dpy-20pDH2(del-1::YFP) + pMH86 (dpy-20)NADavid MillerBOX 4: 1-7
13
NC199wdEx63lin-15pDH2(del-1::YFP) + lin-15NADavid MillerBOX 4: 1-8
14
OH175unc-79(e1068) ot16III; otIs76 mgIs18IVotIs76mgIs18+GS1367NA2/1/2001HBBox 10: 6-5
15
OH174unc-79(e1068) emb-5(hc61) dpy-17(e164)III; otIs76 mgIs18IVotIs76mgIs18 + GS1367NA2/1/2001HBBox 10: 6-3
16
OH281mgIs18; lon-2(e678)ot17XNA4/1/2001HBBox 8: 4-4
17
OH283ot18; mgIs18NA4/1/2001HBBox 10: 7-1
18
OH284ot18; dpy-17(e164)III; otIs76mgIs18IVNA4/1/2001HBBox 10: 6-2
19
OH289otEx116CB1282 (dpy-20(e1282))pAIY-RFP 50ng/ul pdpy-20 50ng/ulNAHBBox 10: 7-9somewhat mosaicsomewhat mosaic but comparable to otIs33 (GFP line)
20
ZG16phif-1::GFPWTiaEx07=pR19 3.7KB hif-1 promoter fused to GFPNAPowell-Coffman
21
OH282otIs76mgIs18IV; exc-2(rh90)XNA4/1/2001HBBox 10: 6-7dominant suppressor of kal-1 gf; maps close to ot17
22
OH285otIs33IV; him-5(e1490)VNA2001HBBox 117: 3-3
23
OH286otIs76mgIs18; exc-3(rh186)XNA4/1/2001HBBox 10: 7-6weak suppressor of kal-1 gf
24
OH287unc-86(n846); otIs33IVNA2001HBBox 10: 7-7
25
OH288lin-11(n389); otIs33IVNA2001BHBox 10: 8-3
26
OH304otIs76 mgIs18IV; unc-70(e524)VNA4/1/2001HBweak suppr. of kal-1 gf phenotype
27
OH372otIs76 mgIs18; mig-15(rh326)NA8/1/2001HBBox 13: 2-8
28
OH285otIs33IV; him-5(e1490)VNA2001HB4-6-3-5
29
OH816otEx457mgIs18pttx-3::kal-1S241K @ 10ng/µl; pRF4@ 100ng/µlNA3/2/2016HBBox 73: 9-71no phenotype in AIY
30
OH817otEx458mgIs18pttx-3::kal-1S241K @ 10ng/µl; pRF4@ 100ng/µlNA3/2/2016HBBox 73: 9-53no phenotype in AIY
31
OH818otEx459mgIs18pttx-3::kal-1S241K @ 10ng/µl; pRF4@ 100ng/µlNA3/2/2016HBBox 73: 9-36no phenotype in AIY
32
OH819otEx460mgIs18pttx-3::kal-1mWAP @ 10ng/µl; pRF4@ 100ng/µlNA3/2/2016HBBox 73: 8-106arborization phenotype in branching AIY
33
OH820otEx461mgIs18pttx-3::kal-1mWAP @ 10ng/µl; pRF4@ 100ng/µlNA3/2/2016HBBox 73: 8-98arborization phenotype in branching AIY
34
OH821otEx462mgIs18pttx-3::kal-1 @ 10ng/µl; pRF4@ 100ng/µlNA3/2/2016HBBox 73: 8-87intermediate strong branching phenotype in AIY interneurons. this line was integrated to yield otIs35X..
35
OH1111oyIs14; hst-6(ok273) slt-1(eh15)NA7/2/2016HB 20027-9-1-3hst-6(ok273) backcrossed 1x
36
OH1421hst-6(ok273)XNA3/31/2015KO consort. & HB 2002Box 82: 5-34x backcrossed
37
OH1573jcIs1IV; egl-15(n1477)XNA12/2/2016HB 2002egl-15 class III allele
38
OH1574evIs111IV; egl-15(n1456)/+ XNA12/2/2016HB 2002Box 74: 3-9egl-15 class II null allele, larval lethal, maintain by picking WT that throw dead larvae. Strain not balanced!!
39
VC294sdhb-1(gk165)/mIn1[mIs14 dpy-10(e128)] II.NA11/23/2015BJ AllanF42A8.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- gk165 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. This strain was provided by the C. elegans Reverse Genetics Core Facility at UBC, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URLs: URL: aceserver.biotech.ubc.ca/cgi-bin/stable/strain.pl?cl ass=Strain;name=VC294, URL: www.celeganskoconsortium.omrf.org/
40
otEx1711; evIs82bIVdpy-7::hst-6NA9/24/2014HB2004BOX 6: 10-6
41
ZG265unc-119(ed3); iaIs16NA4/1/2015Powell-Coffman labBox 83: 5-9isIs16 = pHJ06 and pDPMM016 (unc-119+) phif-1::hif-1::GFP
42
BW1747dpy-18(e364)/eT1 III; unc-46(e177) let-427(s1057)/eT1 V.NA10/23/2008CGCHeterozygotes are WT and segregate WT, Unc-46, Sterile DpyUncs and dead eggs. Maintain by picking WT. Bill Wood, CGC
43
OH3105ceh-14(ch3) egl-15(n484)NAClaireBox 62: 3-7
44
OH3106ceh-14(ch3) egl-15(n484); oyIs14NAClaireBox 62: 3-5
45
OH3107ceh-14(ch3) zig-4(gk34) egl-15(n484)NAClaireBox 62: 3-6
46
OH3109ceh-14(ch3) zig-4(gk34) egl-15(n484);oyIs14NAClaire BenardBox 62: 3-8
47
OH3110ceh-14(ch3) zig-4(gk34) egl-15(n484);hdIs26NAClaire BenardBox 62: 3-9
48
OH4296lsy-6(ot71) dpy-11; otEx2409 (gcy-4::gfp)otEx2409 crossed into lsy-6 dpy-11gcy-4(prom1)::gfp;cc::gfpNA10.15.05ChrisBox 120: 10-61/1/2016primer A gaagtttcagtggtacttgc primer A* gattgattcagaattcgagatc primer B agtcgacctgcaggcatgcaagctGAGTATCATAATTCATGGAAGTAG2-ON in ASE
49
OH5032otIs151, otEx2945 (ins-22::gfp)ins-22prom1::gfp,elt-2::gfpNA12/6/2016Chris /HarshaBox 74: 10-11/3/2016gfp fusion made to 2kb upstream promoter region of ins-22 2 other lines in Chris' strain collection
50
mgIs29lin-15pAFD-VAMP::GFPNAOHBox 114: 10-11/1/2016induces sprouting; no clear synapsesAFD
51
OH479 & OH1137otIs18N2zig-4::GFP PCR 100 ng/ul rol-6NAONABox 69: 7-61/6/2016don't know who/why double-named the strain
52
NC120wdIs1dpy-20pNC4-22Lz (unc-4lacZ) + pMH86 (dpy20)NADavid MillerBOX 4: 1-9
53
N2; Ex[ZC64::GFP, rol-6]N2ZC64::GFP 50 ng/ul (ZC64 = lim-4) rol-6 100 ng/ulNAOHBox 1: 2-8line #9 (Best line)
54
55
GR1308daf-16(mg54); daf-2(e1370)NA4/1/2015RuvkunBox 83: 5-2
56
pha-1; Ex[lim-6prom::GFP]pha-1pBX 100 ng/ul lim-6prom::GFP 50 ng/ulNAOH/KTBox 67: 10-8#1 (of a total of 3 lines)
57
OH1691lim-6(nr2073); oxIs12NAOHBox 50: 3-9
58
OH2832unc-25(e156); oxIs12NA11/19/2015OHBox 93: 7-1
59
OH118daf-7(e1372); lim-6(nr2073); him-5NAOHBOX 4: 8-3
60
OH2923otEx1725N2gcy-5.3up (50ng/ul); rol-6 (100ng/ul)01.29.04JohnBox 63: 9-51/3/2016truncated gcy-5HindIIIASER, de-repression in ASEL
61
OH2924otEx1726N2gcy-5.3up (50ng/ul); rol-6 (100ng/ul)01.29.04JohnBox 63: 9-42/3/2016truncated gcy-5HindIIIASER, de-repression in ASEL
62
OH2925otEx1727N2gcy-5.3up (50ng/ul); rol-6 (100ng/ul)01.29.04JohnBox 63: 9-33/3/2016truncated gcy-5HindIIIASER, de-repression in ASEL
63
OH3620otIs151; otEx2098otIs151gcy-5HindIII-gcy-7HindIII::gfp; elt-2::gfp01.29.054/6/2015JohnBox 86: 4-61/2/2016ASEL/R
64
OH3621otIs151; otEx2099otIs151gcy-5HindIII-gcy-7HindIII::gfp; elt-2::gfp01.29.054/6/2015JohnBox 86: 1-62/2/2016ASEL/R
65
OH3622otIs151; otEx2100otIs151gcy-5.del.upstream::gfp, elt-2::gfp01.29.05JohnBOX 2: 6-31/2/2016gcy-5HindIII sequence upstream of del.6 sequence deleted.no expression
66
OH3623otIs151; otEx2101otIs151gcy-5.del.upstream::gfp, elt-2::gfp01.29.05JohnBOX 2: 6-22/2/2016gcy-5HindIII sequence upstream of del.6 sequence deleted.no expression
67
OH4435otEx2544; otIs151otIs151gcy-5.scan11.3::gfp, elt-2::gfp01.30.06JohnBox 67: 6-11/3/2016ASER
68
OH4436otEx2545; otIs151otIs151gcy-5.scan11.3::gfp, elt-2::gfp01.30.06JohnBox 67: 6-52/3/2016ASER
69
OH4434otEx2543; otIs151otIs151unc-8::gfp, elt-2::gfp01.30.067/6/2015John6-2-5-81/2/2016GFP cloned into unc-8::LacZ construct given to Oliver by Monica Driscollno ASE expression
70
OH4437otEx2546; otIs151otIs151ceh36.scan.1::gfp; elt-2::gfp01.31.06JohnBox 14: 2-31/3/2016Dimmed expression in ASE versus AWC
71
OH4438otEx2547; otIs151otIs151ceh36.scan.1::gfp; elt-2::gfp01.31.06JohnBox 14: 3-12/3/2016Dimmed expression in ASE versus AWC
72
OH4439otEx2548; otIs151otIs151ceh36.scan.1::gfp; elt-2::gfp01.31.06JohnBox 14: 3-83/3/2016Dimmed expression in ASE versus AWC
73
OH4440otEx2549; otIs151otIs151ceh36.scan.2::gfp; elt-2::gfp01.31.06JohnBox 67: 6-91/3/2016ASE off, AWC on
74
OH4441otEx2550; otIs151otIs151ceh36.scan.2::gfp; elt-2::gfp01.31.06JohnBox 67: 7-52/3/2016ASE off, AWC on
75
OH4442otEx2551; otIs151otIs151ceh36.scan.2::gfp; elt-2::gfp01.31.06JohnBox 67: 8-13/3/2016ASE off, AWC on
76
OH4443otEx2552; otIs151otIs151gcy-7scan2.4::gfp; elt-2::gfp01.31.06JohnBox 67: 6-31/3/2016
77
OH4444otEx2553; otIs151otIs151gcy-7scan2.4::gfp; elt-2::gfp01.31.06JohnBox 67: 6-22/3/2016
78
OH4445otEx2554; otIs151otIs151gcy-7scan2.4::gfp; elt-2::gfp01.31.06JohnBox 67: 6-103/3/2016
79
OH4446otEx2555; otIs151otIs151lsy-6scan1::gfp; elt-2::gfp01.31.06JohnBox 67: 7-61/3/2016ASEL
80
OH4447otEx2556; otIs151otIs151lsy-6scan1::gfp; elt-2::gfp01.31.06JohnBox 67: 6-42/3/2016ASEL
81
OH4448otEx2557; otIs151otIs151lim-6scan6.2::gfp; elt-2::gfp01.31.06JohnBox 67: 6-81/3/2016
82
OH4449otEx2558; otIs151otIs151srg-30prom1::gfp; elt-2::gfp01.31.06JohnBox 67: 7-21/3/2016ASE
83
OH4450otEx2559; otIs151otIs151srg-30prom1::gfp; elt-2::gfp01.31.06JohnBox 67: 7-82/3/2016ASE
84
OH4451otEx2560; otIs151otIs151gcy-5scan11.3::gfp; elt-2::gfp01.31.06JohnBox 67: 6-63/3/2016
85
OH4452otEx2561; otIs151otIs151unc-8::gfp; elt-2::gfp01.31.06John5-7-2-82/2/2016GFP cloned into unc-8::LacZ construct given to Oliver by Monica Driscollno ASE expression
86
OH4453otEx2562; otIs151otIs151srg-30prom1::gfp; elt-2::gfp02.01.06JohnBox 67: 7-33/3/2016
87
OH4454otEx2563; otIs151otIs151lim-6scan6.2::gfp; elt-2::gfp02.01.06JohnBox 67: 7-92/3/2016
88
OH6038otIs151; otEx3020otis151srt-63prom::GFP; elt-2::GFP02.04.075/5/2015johnBox 93: 5-71/2/2016
89
OH6039otIs151; otEx3021otis151srt-63prom::GFP; elt-2::GFP02.04.074/15/2015johnBox 92: 9-22/2/2016
90
OH6040otIs151; otEx3022otis151cog-1prom8::GFP; elt-2::GFP02.04.074/15/2015johnBox 92: 9-9
91
OH6041otIs151; otEx3023otis151srt-63(ASE-gcy-5)prom::GFP; elt-2::GFP02.04.074/15/2015johnBox 92: 10-81/2/2016
92
OH6042otIs151; otEx3024otis151gcy-5(ASE-srw-85)prom::GFP; elt-2::GFP02.04.073/6/2016john8-11-4-61/2/2016
93
OH6043otEx3025; lin-15lin-15nslo-2::GFP; lin-15(+)02.05.075/5/2015johnBox 93: 4-711received from another lab. See Etchberger et al. Mat.&Meth.
94
OH4462otIs151; otEx2566otIs151srd-33prom1::GFP; elt-2::GFP02.07.06John6-3-4-21/3/2016ASE
95
OH4463otIs151; otEx2567otIs151srd-33prom1::GFP; elt-2::GFP02.07.06JohnBox 73: 1-52/3/2016ASE
96
OH4464otIs151; otEx2568otIs151srd-33prom1::GFP; elt-2::GFP02.07.06JohnBox 70: 9-53/3/2016ASE
97
OH4465otIs151; otEx2569otIs151sru-27prom1::GFP; elt-2::GFP02.07.06JohnBox 70: 10-22/3/2016no ASE
98
OH4466otIs151; otEx2570otIs151sru-27prom1::GFP; elt-2::GFP02.07.06JohnBox 70: 10-93/3/2016no ASE
99
OH4474lim-6(nr2073); Ex[gcy-3::gfp]02.15.06John6-3-4-4For otEx# ask Chris Ortiz. Strain used in Ortiz et al gcy genome paper.
100
OH3661otIs151; otEx2126otIs151flp-13prom2::gfp; elt-2::gfp02.21.053/6/2016JohnBOX 2: 7-32/2/2016promoter according to Li et al.ASEL/R
Loading...
 
 
 
ALLRECORDS
Sheet9
FAQ -help
appendix:transgenes and alleles
Sheet7
Requests