2013_10_14 Gibson - make pCM66TE - electroporation only pCM66
The version of the browser you are using is no longer supported. Please upgrade to a supported browser.Dismiss

View only
2013_10_14 Gibson - make pCM66TE - electroporation only pCM66
REMOVING IncP origin of transfer.agctccgcgaagtcgctcttcttgatggagcgcatggggacgtgcttggcaatcacgcgcaccccccggccgttttagcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgaccttgccaagctcgtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgcgcgggtcgtcggtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatgcgggccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagcaggtaggcctacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaag
Oligo Design:
PCR band descriptionforward primerreverse primerforward Tmreverse Tmbp expectedtemplate
oriV insert26327070.369.1843pCM66T
267trfA_end-FCACCCTCCTTGCGGGATTG 70.31910/10/2013
268OriV-FCGGCCACCGCTAACCTGTC 70.31910/10/2013
Main menu