1 of 35

Session 5 (February 25, 2026)

How to make transgenic organisms�and recombinant viruses

Lecturer: Michael Jeltsch, Faculty of Pharmacy, University of Helsinki

Course: FARM-409, Recombinant DNA technology in therapeutic protein engineering - lecture course

Spring semester 2026

Most recent version of this presentation: mjlab.fi/PROV-409-5

Slide 1 of 35

All material in this presentation is�licensed under the CC BY-NC-SA 4.0 by�the creator except if differently indicated.

Faculty of Pharmacy

2 of 35

3D structure

Slide 2 of 34

https://www.uniprot.org/uniprotkb/P49767
Many proteins are more flexible than you think!
Do I have a model (Alphafold3) or an experimentally determined structure? How was the structure determined?
The most accurately experimentally determined structures are frozen in time (Xray) → cryo-EM, NMR: many structures
https://www.youtube.com/watch?v=jPhvic-eqbc
We do research on the easy proteins!

Jeltsch Lab

Faculty of Pharmacy

3 of 35

Primer design

Slide 3 of 34

DNA vs. cDNA (coding DNA): TAGCTGTAGGCCACCATGCGGGTG… …TAGGTGCAAG
Where does my protein start and where does it end? SnapGene makes that easy, Uniprot
Remember Marilyn Kozak when designing the primers!
You have not choice where to place the primer!

Jeltsch Lab

Faculty of Pharmacy

4 of 35

Why transgenic animals?

Slide 4 of 34

Why to make transgenic animals?

Biomedical research (target discovery)
Drug discovery (antibodies)
Drug development
Drug production

Jeltsch Lab

Faculty of Pharmacy

5 of 35

Expression in GMOs

Slide 5 of 34

Silk-

worm larvae

https://procube.sysmex.co.jp/eng/p/e_silkworm_outline/

https://commons.wikimedia.org/wiki/File:Barley_Seeds_with_Husk.jpg

Earth-

worms

Farm animals

Goat milk: thrombin inhibitor (ATryn), ⍺-EGFR cetuximab

Rabbit milk: C1 esterase inhibitor (Ruconest)

Egg white: Sebelipase alfa (Kanuma)

Barley

expression

system

Jeltsch Lab

Faculty of Pharmacy

6 of 35

Transgenic mice since 1982

Slide 6 of 34

1982: MT-hGH

1997: K14-hVEGF-C

MT metallothionein (promoter)

GH= growth hormone (gene)

h= human (species)

Jeltsch Lab

Faculty of Pharmacy

7 of 35

Consumer market GMO animals

Slide 7 of 34

GloFish
Developed in Taiwan (available in Taiwan and�the US since 2003/2004)
Banned in the EU,�but still sold
“Hypoallergenic” pets are�not yet available, e.g.�CH1^-/- (Feld1A^-/-) cats

Jeltsch Lab

Faculty of Pharmacy

8 of 35

Microinjection method

Slide 8 of 34

promoter

polyA

GOI ORF

In vitro fertilization
Injection of purified, linear DNA into male pronucleus
Implantation into pseudopregnant females
F1 offspring is screened by PCR for DNA integration
Success rate: 5-20% of F1 are positive
Transfer of large DNA fragments possible
Transgene integrates randomly as a tandem array

Jeltsch Lab

Faculty of Pharmacy

9 of 35

Embryonic stem cell method

Slide 9 of 34

Transgene is inserted into ES cells (linearized DNA, different methods: mostly electroporation)
Injection of transgenic ES cells into blastocyst
Chimeric mice are borne, some of which have the transgene in their germ line (transgene marker: fur color)

promoter

polyA

GOI ORF

Jeltsch Lab

Faculty of Pharmacy

10 of 35

Retroviral method

Slide 10 of 34

Infection of developing embryo at 8-cell-stage with recombinant retrovirus
Implantation into pseudopregnant females
“Retrovirus-infected” mouse
Cargo-limit ~8kb

Jeltsch Lab

Faculty of Pharmacy

11 of 35

Issues with transgenics #1

Slide 11 of 34

PCR-screening vs. protein screening vs. RT-PCR screening (insertion is random and can happen into a transcriptionally inactive region), screening of mice (pronucleus injection) or screening/selection of ES cells (blastocyst injection); optional copy-number determination (qPCR, Southern blot)
DNA insertion results in heterozygous transgenic animals: breeding can result in homozygous animals with increased expression levels
Multiple insertions can happen into different locations, e.g. on different chromosomes (can segregate in subsequent generations)
Insertion can happen after nuclear fusion and mitosis resulting in mosaic animals which may or may not transmit the transgene to the next generation

Jeltsch Lab

Faculty of Pharmacy

12 of 35

Issues with transgenics #2

Slide 12 of 34

Phenotype can be due to insertional inactivation of a gene
Expression levels: Analysis of several different founder mice to find the one with the right expression levels
BAC (Bacterial Artificial Chromosome) transgenesis: Insertion of large fragments (>100kb) with entire genes and regulatory sequences
To overcome the random-insertion drawbacks of traditional transgenes: Targeted insertion

Jeltsch Lab

Faculty of Pharmacy

13 of 35

Conventional gene targeting (“knock-outs and knock-ins”)

Jeltsch Lab

Faculty of Pharmacy

14 of 35

Southern blot and PCR screening

Slide 14 of 34

Jeltsch Lab

Faculty of Pharmacy

15 of 35

Targeting Rosa26

Slide 15 of 34

Rosa26: RNA gene on mouse chromosome 6
Rosa26 promoter* is ubiquitously active in all tissues of the developing embryo and in most tissues of the adult mouse. The locus (location) contributes to uniformness of expression.
β-Gal retroviral GeneTrap, which did not affect development or viability of the mice (Reverse Orientation Splice Acceptor)
Used for many reporter genes with ubiquitous expression (e.g. for transplant tracing, chimera analysis)
Many other transgenes were targeted (“knocked-in”) to the Rosa26 locus.
Conditional Rosa26 if you want reporter gene expression only in a (tissue/time)-specific fashion.

* expresses normally a non-essential RNA

commons.wikimedia.org/wiki/File:Lab_mouse_mg_3204.jpg

Jeltsch Lab

Faculty of Pharmacy

16 of 35

Conditional transgenes and knock-outs

Slide 16 of 34

Cre-Lox recombination

(from P1 bacteriophage)

13 bp - 8 bp - 13 bp

ATAACTTCGTATA-NNNTANNN-TATACGAAGTTAT

Jeltsch Lab

Faculty of Pharmacy

17 of 35

Conditional knock-outs (example: liver-specific knock-out)

Slide 17 of 34

Jeltsch Lab

Faculty of Pharmacy

18 of 35

Cre/Flp: knockouts without neo insertion

Slide 18 of 34

Jeltsch Lab

Faculty of Pharmacy

19 of 35

Tet-on

Slide 19 of 34

Jeltsch Lab

Faculty of Pharmacy

20 of 35

Tet-off

Slide 20 of 34

Jeltsch Lab

Faculty of Pharmacy

21 of 35

CRISPR/Cas9 gene editing

Slide 21 of 34

Older literature is pretty useless because CRISPR/Cas gene editing (e.g. in ES cells) is simpler than older methods. However, you still need to understand the old technologies since many mouse lines were created using them.

Jeltsch Lab

Faculty of Pharmacy

22 of 35

Slide 22 of 34

Figure by Sigma

Jeltsch Lab

Faculty of Pharmacy

23 of 35

Slide 23 of 34

Image by: Ran et al. Nat Protocols (2013)

Jeltsch Lab

Faculty of Pharmacy

24 of 35

Recombinant Viruses

Slide 24 of 34

Viruses produced by recombinant DNA technology
Naturally occuring recombinant virus (= when two different viruses infect the same cell and exchange genetic information)
Common recombinant viruses used in biomedical research

Baculovirus
Adenovirus (AV)
Adeno-associated virus (AAV)
Lentivirus/Retrovirus
Many more: Vaccinia virus, Semliki Forest virus

Jeltsch Lab

Faculty of Pharmacy

25 of 35

Viruses as gene delivery vectors

Slide 25 of 34

Gene delivery for difficult-to-transfect cells; making overexpression or knockdown cell lines or transgenic animals (lenti- & retrovirus)
Recombinant protein expression (HPV vaccine)
As vaccines (perhaps the oldest biopharma- ceutical since Jenner & others in the late 18^th century: mild cowpox infection protects against serious smallpox infection); increased safety due to more control over virulence

“1st vaccination” performed by Edward Jenner (1796)

As therapeutics, e.g. oncolytic viruses, still experimental
To express proteins in-situ in animal models

Jeltsch Lab

Faculty of Pharmacy

26 of 35

Baculoviruses

Slide 26 of 34

Improvements

More than one gene

2 GOIs: pFastBac Dual (LifeTechnologies/TF)
Dozens of genes: MultiBac & MultiBacMam (Geneva Biotech),�the cargo of most other viruses�is limited!

Mammalian-type glycosylation

SweetBac™ (Geneva Biotech)
Sf9 Mimic™ (LifeTechnologies)

Enhanced protein quality/folding

Adding enzymes (chaperones/ protein disulfide isomerases): ProFold™ (AB Vector)
Deleting viral proteases: flashBAC (Oxford Expression Technologies)

Jeltsch Lab

Faculty of Pharmacy

27 of 35

Adenovirus and Adeno-associated virus

Slide 27 of 34

	AV	AAV
type	pathogenic	non-pathogenic
	non-enveloped	non-enveloped
	replicating	replication-defective
genome	26-48 kb dsDNA	4.8 kb ssDNA
immune response	strong	mild
expression	short-lived	long-lived (possible integration into host genome)
diameter (nm)	~90	~20
receptor	coxsackievirus adenovirus receptor (CAR)/α5 integrin	different (dependent on serotype)
cargo (kb)	up to 10	~4.8
biosafety level (BSL)	2	1 (in absence of helper virus)

Jeltsch Lab

Faculty of Pharmacy

28 of 35

Adenovirus and Adeno-associated virus

Slide 28 of 34

Crystal et al. Adenovirus: The First Effective In Vivo Gene Delivery Vector.�Human Gene Therapy 25, 2014: 3-11.

Sandmair et al. Adenoviruses as Gene Delivery Vectors.�Advances in Experimental Medicine and Biology 465, 2002: 423-429.

AdEasy System (developed in Bert Vogelstein's Lab)�He et al. A simplified system for generating recombinant adenoviruses. PNAS 95, 1998: 2509–14.

Works similar to the Bac-to-Bac system
Modified adenoviral DNA maintained as a plasmid in E. coli (AdEasier-1 or BJ5183 cells)
Recombination with a shuttle vector to generate recombinant virus
DNA prep to isolate viral DNA
Transfection of 293 cells (packaging cells) to generate virus
Non-proprietary (Addgene), Kit from Agilent

Jeltsch Lab

Faculty of Pharmacy

29 of 35

Adenovirus and Adeno-associated virus

Slide 29 of 34

Heart, lung: AAV4, AAV9

Liver: AAV4, AAV7,

AAV8, AAV9

Retina: AAV7, AAV8

Brain: AAV8, AAV9, AAVrh10

Pancreas: AAV8

Systemic delivery, skeletal�muscle: AAV8, AAV9

Jeltsch Lab

Faculty of Pharmacy

30 of 35

AAV

Slide 30 of 34

Jeltsch Lab

Faculty of Pharmacy

31 of 35

Recombinant Retroviruses

Slide 31 of 34

Recombinant Retroviruses

Enveloped, ssRNA (= mRNA) genome
Most commonly used recombinant retroviruses�- Moloney murine leukemia virus (MMLV)�- Murine stem cell virus (MSCV)
Narrow host range (ecotropic) vs wide host range (amphotroic)
Host range is determined by the packaging cell line
Infects efficiently only dividing cells
BSL-2 (some experiments require BSL-3)
Cargo up to ~8 kb
Gene therapy: X-SCID, insertional activation of proto-oncogenes resulted in acute T-cell leukemia in a substantial proportion of patients
Services available from UH: FUGU

Jeltsch Lab

Faculty of Pharmacy

32 of 35

Recombinant Lentiviruses

Slide 32 of 34

Recombinant Lentiviruses (subgroup of retroviruses)

Enveloped, ssRNA (= mRNA) genome
Most commonly used recombinant lentivirus: HIV-1-based
Transduces dividing and non-dividing cells
BSL-2 (some experiments require BSL-3)
Cargo up to ~8 kb
Services available from UH: FUGU

Jeltsch Lab

Faculty of Pharmacy

33 of 35

How to make recombinant retroviruses

Slide 33 of 34

Jeltsch Lab

Faculty of Pharmacy

34 of 35

Moodle Exam

Slide 34 of 34

Jeltsch Lab

Faculty of Pharmacy

35 of 35

Questions, contact

Slide 35 of 34

My laboratory: mjlab.fi (https://www.helsinki.fi/en/researchgroups/lymphangiogenesis-research-and-antibody-development)
jeltsch.org (private rumblings)
Questions to: michael@jeltsch.org or via Whatsapp: 050-3200235
Consultation hours every Friday 9-12: Zoom link or IRL
This presentation: https://mjlab.fi/PROV-409-5

Jeltsch Lab

Faculty of Pharmacy