What Has Genomics Ever Done for Us?��(Apart from diagnosing rare diseases, guiding cancer treatment, predicting drug responses and transforming healthcare)

Dr Katie Snape

Consultant Cancer Geneticist, South West Thames Centre for Genomics, St Georges Hospital

Honorary Reader, City St Georges

Retiring Chair UK Cancer Genetics Group

Principal Clinician in Population Health, Genomics England

Dr Katie Snape BSc(hons), MBBS, FRCP, PhD, FHEA

​

• MBBS, Guys, Kings and St Thomas’ School of Medicine, University of London 2003
• Member of Royal College of Physicians 2007, Fellow of Royal College of Physicians 2019
• PhD: Institute of Cancer Research 2012
• PGCert Healthcare and Biomedical Education 2013
• Consultant in Clinical Genetics 2014
• Current job(s):
• Consultant for Cancer Genetics, South West Thames Centre for Genomics, St George’s Hospital
• Consultant Geneticist in Haematological Medicine, Kings College Hospital
• Honorary Reader, St George’s University of London
• Principal Clinician in Population Health
• Retiring Chair of the UK Cancer Genetics group

​

Overview��What is genomics and what do we mean by genomic data?��The use of genomics in healthcare across the human life course�

By National Human Genome Research Institute (NHGRI) from Bethesda, MD, USA - Human Genome Project Timeline, CC BY 2.0, https://commons.wikimedia.org/w/index.php?curid=52360098

13 years

The Genomics Revolution

AAGTCCGATCGAT

Genes: Code for a proteins to perform a specific function in the body

2022

Genetic variation

• Makes us unique
• Is the basis for evolution
• Is the basis for disease
• Caused by copying mistakes when cells divide
• Caused by things which mutate our DNA: UV light, cigarette smoke, radiation etc. etc.

​

http://dee-annarogers.com

With genomic technologies it is possible to read our entire genetic code to identify the genetic variation within our DNA�~5,000,000 per person

AAGTCCGATCGAGTACTACTTACGATCGCATGCATGGTAT

AAGTCCGATCGAGTACTAGTTACGATCGCATGCATGGTAT

AAGTCCGATCGAGTACTACTTACGATCGCATGCATGGTAT

AAGTCCGATCGAGTACTA---TACGATCGCATGCATGGTAT

1 gene

~1 variant

4 genes

30 genes

100 genes

200 genes

400 genes

20,000 genes

~20,000 variants

~4 variants

~30 variants

~100 variants

~200 variants

~400variants

20,000 genes

~5,000,000 variants

Single Gene Gene Panels Whole Exome (all genes) Whole Genome (everything)

Genomics in healthcare

• The use of genomic information to prevent, diagnose and treat human disease

Predict the chance of developing a health condition: screening, prevention, early detection

Antenatal screening and diagnosis

Newborn screening

Diagnosis of rare genetic childhood conditions

Diagnose, treat and monitor cancer

Understand infectious diseases and how they spread

Guide medication choices

Treat genetic diseases with precision/gene therapies

Pre-implantation genetic testing

Pre-conception

testing

Pre-conception and antenatal healthcare

Washington Post

Screening embryos for genetic risk

The Week

Newborn screening�

Rare disease diagnosis and treatment�

22

What does this mean for patients with rare conditions?

No diagnosis

Diagnosis

Diagnosis

No therapy

Precision management

Precision therapy

Improved patient healthcare by increasing diagnoses and realising therapies

Risk prediction�

Nature or nurture?

25

Genetic factors

Environment/ lifestyle/

chance

​

Different types of environmental & other factors

26

Risk factors you may not be able to actively change

​

For example, height, the age you started your period, how dense your breasts are, how many children you have

Risk factors you might be able to change

​

For example, taking medication which reduces risk, having surgery to reduce risk, stopping smoking, losing weight, doing exercise

​

How common is a genetic variant in the population?

Very rare

Very Common

If you have the variant, how likely is it you will develop the condition?

Definitely have it

Low chance to have it

Rare high risk single gene conditions

Common health conditions

Intermediate risk genes increasing risk

Different types of risk contributing to development of a condition

Level of risk

Threshold for developing

the condition

Genetic risk

Environmental risk/lifestyle/chance: unlikely to change

Pt 1

Pt 2

Pt 3

Pt 4

Pt 5

High risk

gene

Environment/ lifestyle/ chance

Polygenic/

multifactorial risk

Intermediate risk

gene

Environmental risk/lifestyle: Possible to change

Patient 

Different types of risk contributing to development of a condition

Level of risk

Threshold for developing

the condition

Genetic risk

Environmental risk/lifestyle/chance: unlikely to change

Pt 1

Pt 2

Pt 3

Pt 4

High risk

gene

Environment/ lifestyle/ chance

Polygenic/

multifactorial risk

Intermediate risk

gene

Environmental risk/lifestyle: Possible to change

Actionable threshold for intervention

Patient

Pt 5

Different types of risk contributing to development of a condition

Level of risk

Threshold for developing

the condition

Genetic risk

Environmental risk/lifestyle/chance: unlikely to change

Pt 1

Pt 2

Pt 3

Pt 4

High risk

gene

Environment/ lifestyle/ chance

Polygenic/

multifactorial risk

Intermediate risk

gene

Environmental risk/lifestyle: Possible to change

Actionable threshold for intervention

Patient

Pt 5

What testing is available?

• People who meet existing eligibility criteria for gene testing

National Genomic Test Directory

Specified genetic testing in high-risk populations e.g. BRCA genes in Jewish populations

Population Testing

Expanding testing to other affected and unaffected groups to look at acceptability and feasibility for monogenic and polygenic risk e.g. BRCA-DIRECT, PROTECT-C

Research Studies

Many private tests available – including testing for monogenic and polygenic risk

Private Testing

31

What do we need to know before we could deliver at scale in the NHS?

• Who will benefit from risk testing?
• How can we assess risk accurately and explain risks properly for people to make informed decisions?
• When and where should risk testing be done?
• How do we know we can intervene to improve health outcomes?
• What type of testing and which genes?
• What age should we offer testing?
• Where should this data be held?
• How do we ensure it is delivered equitably?
• Is this wanted and acceptable to people?

​

​

​

​

32

Pharmaco-genomics�

What is Pharmacogenomics?

34

99.5% people carry a pharmacogenomic variant

Pharmacogenetics at Scale: An Analysis of the UK Biobank - PMC

35

24-28% of people are prescribed a relevant medication every year

​

Cardiac medications:

• Clopidogrel (blood-thinning)
• Statins (cholesterol-lowering)

Mental health medications:

• SSRIs (Anti-depressants)

​

Gastroenterology medications:

• Proton Pump Inhibitors (acid-lowering)

Pain-killing medications:

• Codeine

36

Why is Pharmacogenomic information different?

Most people carry a Pharmacogenomic variant

Variants predict medication effectiveness or side-effects, alongside multiple other factors

Ethical implications very different as they predict medication response not disease susceptibility

Much less significant for family members, genetic testing generally not indicated

Prescribing happens across complicated systems within multiple settings

Variants only become relevant if someone is prescribed the relevant medication (gene-drug pair)

37

What testing is available in the NHS?

• DPYD: chemotherapy treatment (Fluoropyrimidine)
• TPMT / NUDT15: purine analogue treatment

To guide cancer treatments

Specified antibiotics (aminoglycosides) in high risk groups

MT-RNR1

Retroviral treatment (Abacavir)

in people with HIV

HLA-B*5701

Targeted therapy (Mavacantem)

in people with

Hypertrophic Cardiomyopathy

CYP2C19

38

What do we need to know to deliver at scale in the NHS?

• Who will benefit from PGx testing?
• When and where should it be done?
• What type of testing and which genes?
• Should this information be available before the point of prescription (pre-emptive)?
• Where should this data be held?
• How do we ensure it is available to prescribers in electronic systems?
• How do prescribers know what action to take?
• How do we ensure it is delivered equitably?

​

​

​

​

39

Cancer

How does a cancer develop?

NOTVERYIMPORTANTPARTOFGENETICCODEIMPORTANTPART!MOREUNIMPORTANTPART

NOTVERYIMXORTANTPARTOFGENETICCODEIMPORTANTPART!MOREUNIMPORTANTPART

NOXVERYIMXORTANTPARTOFGENETIXCODEIMPORTANTPART!MOREUNXMPORTANTPXRT

NOXVERYIMXORTANXPARTOFGENETIXCODEIMPORXANTPART!MOXEUNXMPORTANTPXRT

NOXVERYIMXORXANXPARTOFXENETIXCODEIMXORXANTPXRTXMOXEUNXMPORXANTPXRT

Genetic code you are born with: germline/constitutional

Genetic code of the cancer cell:

somatic

​

Stratton et al. 2009 Apr 9;458(7239):719-24. doi: 10.1038/nature07943.

Cancer genome

• Reading the cancer genome can tell us
• What caused the mutations in the cell
• Cigarette smoke
• UV light
• Defects in DNA repair genes
• If we can target treatment to the changes within the cancer cell to kill cancer cells but not healthy cells
• We can also monitor any changes in the cancer cells with treatment

​

​

Tissue biopsies vs Liquid biopsies

• Tissue: biopsy to extract tissue
• Extract cancer cell DNA and analyse it
• Identify changes that might influence treatment

​

• Liquid biopsy: blood test
• Identify changes that might influence treatment
• Monitoring of relapse
• Screening for cancer before symptoms/imaging

Image: National Human Genome Research Institute

Targeted therapy

• Identify the genetic changes in the cancer cell driving the cancer
• Target those with a specific therapy
• BRAF mutations in melanoma treated with BRAF inhibitors

Melin et al. European Journal of Cancer, 2019, 121:109-112

Using whole genome sequencing to guide treatment and clinical trial options for patients with breast cancer

​

​

“The UK is a genuine world-leader in terms of its ability to do whole genome sequencing in the NHS through the Genomic Medicine Service. We have the potential to make a difference to thousands of patients’ lives every year”

​

Professor Serena

Nik-Zainal

​

Infectious Disease

Genomics and infectious disease

• Genome of pathogen
• Transmission and evolution
• Bacterial resistance
• Genome of host
• Susceptibility to infection
• Drug reactivity
• Microbiome analysis
• Culture and sequencing 16S rRNA sequences
• Metagenomics
• Environmental sampling

​

https://www.pnas.org/content/early/2020/04/07/2004999117

Genomic technologies and genomic data can impact healthcare across the life-course and spanning all specialties��Interpreting genomic results and acting on them in an evidence based way is complex and requires seismic system and workforce transformation as well as public and patient buy-in��There are ethical, privacy and societal issues that need to be engaged with to maximise benefit of genomic data and minimise the risks

Thanks to Jude Hayward and Ana Lisa Tavares for additional slides