Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
The Next Generation of Food Safety Case Study
Capture Sheet
Directions
Over the next few days, you will play the role of an epidemiologist and an environmental health specialist as you work to investigate a food poisoning outbreak. Follow the steps below.
Interactive Background
You are a current employee of the county health department named below. Due to budget cuts, you have the role of epidemiologist and environmental health specialist for the outbreak investigation team.
Name of your county health department:
1. What is an epidemiologist?
2. What are some responsibilities of an environmental
health specialist?
3. Have you ever experienced contact tracing?
Write what you know about contract tracing below.
4. If you were conducting the interview, what questions might you ask and why?
Over the past two days, the health department has received multiple phone calls and emails from citizens with concerns of food poisoning. Other members of your team followed up with several of the citizens and conducted interviews to contact trace.
Continues next page >
This file can be copied or downloaded for editable capabilities. To do this, login to Google, click the File menu just under the title, then select ‘Make a copy’ or ‘Download’
The copy can be shared with students, giving them the ability to enter responses digitally.
Any user who accesses the copy can edit the body text, directions, and questions as well.
Delete
before sharing with students
Interview Number | Relevant Evidence Statements or facts of interest from the interview | Possible Next Step Based on evidence |
| | |
| | |
| | |
| | |
| | |
| | |
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
The Next Generation of Food Safety Case Study Capture Sheet
Continued
Analyze the Citizen Interviews provided. Your goal on the investigation team is to identify patterns and start to determine what is causing the problem. After you have identified the problem, an infection control team will take over. Because this is a threat to public health, it is critical to act quickly. These are the only interviews your team is able to collect in the short time frame.
5. Use the organization tool below to help with taking notes on the interviews.
Interview Analysis
Citizen Interviews
Directions
The following are the important excerpts from interviews conducted by the environmental health team. An environmental health specialist (EHS) is the health department employee conducting the interviews. Insert the name of the interviewee in the space provided.
1 | Interview with Champs Restaurant Employee (CE): |
EHS | Where do you work and what is your job? |
CE | I am a line cook at Champs restaurant in town. So I help with food preparation and sometimes help with the cooking. |
EHS | What are the food safety protocols? |
CE | We wash our hands and wear gloves but we do not wear masks. Every night we use bleach to clean all the countertops and cooktops. |
EHS | Do you use a meat thermometer? |
CE | We are supposed to but sometimes we are so busy that we forget or in general just assume that the food is cooked. |
EHS | Was it busy in the restaurant last night? |
CE | Yes, I think so. It was a Sunday and there were a lot of people who liked to come and watch games and hang out. So we were definitely busy. |
EHS | Where do you get your meat and vegetables? |
CE | We normally get a food shipment two times a week, but sometimes at the end of the week if we are running low on any items we will stop by Smith’s Meat Market and Grocery to pick up any items. |
2 | Interview with Anonymous Citizen 1 (C1): |
EHS | What and where did you eat before you got sick? |
C1 | Last night I went to a potluck with my coworkers at a friend’s house. There was a lot of different food there. I know I ate some carrots off the vegetable tray but I didn’t eat that dip. I had some taco dip and buffalo chicken dip with chips. I also had a glass of water and punch with ice cream in it. |
EHS | What are your symptoms? How long did you have your symptoms and when did they start? |
C1 | I woke up at like 2 am with really bad stomach cramps. I had diarrhea and I thought I was going to puke but I didn’t. I kept getting hot and then cold and then hot again. I took my temperature, but it was normal. |
EHS | Did you wash your hands before you ate? |
C1 | Yes and no. I went to the restroom and then washed my hands. It was a lot of eating and talking so I didn’t wash them before everytime I ate. |
EHS | Do you know if anyone else at the party got sick? |
C1 | My coworker that hosted the party said that he also got sick, but I am not sure other than that. They just posted that they didn’t feel well on social media. |
Continues next page >
3 | Interview with Anonymous Citizen 2 (C2): |
EHS | What and where did you eat before you got sick? |
C2 | It was my night to host the monthly staff potluck so I was home before I got sick but there were several people at my house. I made the buffalo chicken dip so I ate a lot of that. I don’t fully remember what else I ate, but I know I had a sugar cookie. Bruce, the administrative assistant, makes the best sugar cookies. I think I also had the spinach artichoke dip. |
EHS | What are your symptoms? How long did you have your symptoms and when did they start? |
C2 | I woke up sweating, but I didn’t have a temperature. Then I got a terrible stomach ache, but the pain was sharp. Then I started to have loose stools. |
EHS | You said that you made the buffalo chicken dip— where did you get the chicken from and how do you make it? |
C2 | I got it at Smith’s Meat Market a couple of days ago. It is a really easy recipe. You just put the chicken in the slow cooker on low for eight hours and then add the buffalo sauce and the cheese. My slow cooker stopped working half-way through so that was unfortunate. |
EHS | Did you eat any fruits or vegetables? |
C2 | I probably should have, but no I don’t think I actually did. Unless you count the spinach artichoke dip. |
EHS | Any other information that would be helpful? |
C2 | Overall I think I am feeling better so I was only sick for less than 24 hours. I posted on social media that I was sick. I will go back and see if anyone else had the same problem. |
EHS | Here is my card. Call me if you find out anyone else also has issues. Thank you. |
4 | Interview with Smith’s Meat Market and Grocery Head Butcher (HB): |
EHS | Where do you work and what is your job? |
HB | I am the head butcher at Smith’s and I oversee the meat department here. I can’t talk that long. We are about to head into the after-work shopping rush. |
EHS | Thanks for meeting, I will try to be fast. What are your basic safety protocols and do you know if you have had any issues with them? |
HB | We follow the required food safety protocols set up by the health department and I am pretty sure they get their guidance from the CDC (Center for Disease Control). If we have any issues, we log them in a record book, but there haven’t been any entries since one of our freezers stopped working last summer. |
EHS | Where do you get your meat from? |
HB | One of the reasons we are able to keep prices competitive is that we buy our meat directly from Parkway Meat Distribution Center. I am sorry I have to go. I could meet tomorrow afternoon, but I can’t leave customers waiting. |
Citizen Interviews
Continued
Continues next page >
5 | Interview with Parkway Meat Distribution Manager Head of Product Safety (PMD): |
EHS | Thank you for meeting on a short notice. We believe we have a foodborne illness outbreak and we are trying to get it figured out as quickly as possible. |
PMD | No problem, I can assure you we have not had any breach of safety protocol. |
EHS | That is reassuring. But we know that in the natural meat production process, the bacteria from the animals’ outsides or insides—intestines—can sometimes make its way onto the food. What types of meats do you process at this facility? |
PMD | We have a smaller scale poultry division. Most of the products are used locally. Most of the other products that come through our facility are processed at another facility and this is the distribution center. |
EHS | Do you remember any issues with the poultry processing last week? |
PMD | No, like I said earlier there have been no deviations from the protocols. |
EHS | Who buys your meats in this area? |
PMD | Here is a list of our direct sales for last week. |
Note: Smith’s Grocery and Meat Market is on the list. | |
6 | Interview with Anonymous Citizen 3 (C3): |
EHS | Thanks for contacting me about the issue. Can you tell me where and what you ate? |
C3 | We went out for my son’s 13th birthday to Champs. We got a plate of chicken wings to share and then I ordered the chicken salad, my son had a hamburger, my daughter had a cheese quesadilla, and I think my husband ordered the grilled ham and cheese sandwich. |
EHS | Who in your family got sick? |
C3 | We all did. It was a really bad night to be at our house. Overall I think my daughter had it the worst. Everyone had runny poop and stomach pains. My daughter said she had a headache and was really dehydrated. She was finally able to keep fluids down or we were going to have to go to the hospital. |
EHS | Did anyone have a fever? |
C3 | I didn’t actually check, but I know I didn’t have one. |
EHS | What did your family eat for breakfast that morning? |
C3 | We got doughnuts and coffee from Rosie’s around the corner from our house. |
EHS | Did anyone eat any eggs? |
C3 | No, Rosie’s only serve doughnuts. |
Citizen Interviews
Continued
General Location | Specific Locations Exactly where should the DNA be collected? | Relevant Evidence Why is this location a sampling priority? Support this with information from the interviews. | Rank |
| | | |
| | | |
| | | |
| | | |
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
County Health Department, DNA Sequencing Sampling Request Form Capture Sheet
Directions
Based on the information that you collected from the interviews, fill in the table below to request DNA samples from locations of interest. Make sure you are specific in the location for your request and provide reasoning to support the request. Because the health department is under budget cuts, the employees have limited time and resources, so you will need to rank your requests (1 being most important, and 4 least).
DNA Sampling Request Form
Sequence Reference Number | Species BLAST Result Scientific Name | Bacterial Characteristics Where is it found? Does it cause illnesses? If so, what are some symptoms of the illness? |
1 | | |
2 | | |
3 | | |
4 | | |
5 | | |
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Data Analysis 1 Capture Sheet
Directions
Now you assume the role of the Lab Scientist to determine the bacterial species at the locations in the case. Follow the directions below to gather information from the Sampled DNA Sequences by Location provided by your teacher.
1. Use the Basic Local Alignment Search Tool (BLAST) to find regions of similarity between the sequences on the Sampled DNA Sequences by Location and the sequences in the database. This “downstream” analysis of the NGS data will help identify the species found at the different locations. Fill in the data table below.
2. Once you have the scientific name, finish filling in the table with characteristics of the bacteria
Sequences Identified by Species with Characteristics
Continues next page >
Claim | Evidence-Reasoning | |
Make a claim of the scientific name of the species that is causing the issues. | Explain the illness (symptoms) caused by the species in the claim from CDC’s Prevent Illness From C. perfringens. | Identify evidence from the case study interviews that are similar to the symptoms caused by the illness. |
Enter response here.
Enter response here.
Enter response here.
Data Analysis 1 Capture Sheet
Continued
3. Use the data that you generated in questions 1 and 2 to conclude which species is causing the issue. Use the Claim-Evidence-Reasoning prompts below.
Data Analysis 1 Capture Sheet
Directions
Below is a simplified version of a Next Gen sequencing (NGS) file called a FASTQ file. This is the file that scientists analyze to determine the species that are found in the samples. The following five sequences are of the samples collected at your request. Use these sequences to complete the Data Analysis 1 Capture Sheet.
Note: All the DNA from the chicken has been removed.
These are only microbe sequences.
1 | ATGCGTGTAATTGCGGGTAAGCATAAAAGTAAAGCGCTAGAAAGTTTAGAGGGGCGAAATACTCGTCCAA |
CTATGGATAAAGTTAAAGAAGGTATTTTTAATAGTTTATATGATGTTTCTGGTTTAGGATTAGACTTATT |
2 | GTGCAACGTTATTTCATAGACCAAAACGCTGATGTAAGTCAGCGTTTTTTTATTACAAAAAAAGAAGATA |
TTCATCATATAACAAATGTAATGAGATATGATGTTGGTAGTAAAATTATTTTAACTTTTAATGATCAAAC |
3 | ATGAATGCAAGAAAAATAATAGTTGAAATATTAGACAATGTCTTATTAAATGGAGCATATTCAAATATAG |
AAATAAATAAGCAATTTGCATCTAATGATATAGATCCAAAAGATAAGGGATTAATAACAGAGGTTGTTTA |
4 | ATGAAAAAACAAAATCTACGCAGCATGGCGGCCCAGGCCGTCGAGCAGGTTATCGAGCAGGGCCAGTCAC |
TGAGCAACGTCCTGCCTCCCCTGCAGCAAAAAGTCTCTGATAAAGATAAAGCCCTGCTTCAGGAGCTCTG |
5 | GTGAGTAAGACACAGCCGGGACGAGTTATCCTGGCGGGCACCCCGATTGGCGACCGTCGTAGCGCCTCGC |
CCGCCCTTATCGAGACCTTGCGGGATGCCCGCGTCATTGCCGCTGAGGATACCCGTCGGCTGCGTGACCT |
Data Analysis 2 Capture Sheet
Directions
Use the data from the table below to identify the location of the contamination.
Species Identified at Locations through NextGen sequencing
Location | Species Identified |
Parkway Meat Distribution Center | Staphylococcus epidermidis, Clostridium perfringens, Cutibacterium acnes, Staphlococcus aureus |
Champs Restaurant | Clostridium perfringens, Cutibacterium acnes |
Residence of Citizen 1 | Enterobacter roggenkampii, Cutibacterium acnes |
Smith’s Meat Market & Grocery | Clostridium perfringens, Cutibacterium acnes |
Residence of Citizen 2 | Clostridium perfringens, Enterobacter roggenkampii |
Continues next page >
Enter response here.
Enter response here.
Data Analysis 2 Capture Sheet
Continued
1. Use the NextGen Sequencing analysis to identify the initial source of the contamination.
Claim | Evidence-Reasoning | |
Claim the source of the contamination. | Explain why this is the location of the contamination using evidence from the table on the previous page. Use your notes from the Interview Analysis table (The Next Generation of Food Safety Case Study Capture Sheet) for reference as well. | |
Enter response here.
Data Analysis 2 Capture Sheet
Continued
2. The infection control team will take over from here. The last thing you need to do is to make a recommendation of the next steps. Based on your research, what is a reasonable first step for the infection control team?
Background Reading: NextGen Sequencing
What is DNA Sequencing?
DNA sequencing is used to determine the order of nucleotide bases in a DNA sample. There are four nucleotide bases: adenine, guanine, cytosine, and thymine. Determining the sequence of nucleotides allows scientists to study genes found in coding and noncoding regions of the DNA. More importantly, scientists can use sequencing to see how the expression of genes changes during development and in disease. Since the completion of the Human Genome Project, technological advancements in DNA sequencing have made this process more accessible and more efficient. It has allowed scientists to sequence over 100,000 billion bases per year and entire genomes for thousands of dollars. Many of these technologies have been developed with support from the Human Genome Research Institute (NHGRI) Genome Technology Program, which works toward developing new sequencing technology in an effort to reduce the cost of sequencing the human genome for less than $1,000. As advances in DNA sequencing technology become more common, researchers are able to generate vast sequencing libraries to analyze changes in gene expression in a variety of conditions such as cancer. Using this knowledge, researchers can more easily isolate therapeutic targets that can eventually impact human lives.
Paraphrased from National Human Genome Research Institute’s
What is NextGen Sequencing (NGS)?
Next generation sequencing is similar to Sanger sequencing, also know as dideoxy or capillary electrophoresis sequencing, in that they both rely on the incorporation of fluorescent nucleotides by DNA polymerase to determine the DNA template’s sequence. However, NGS is much higher efficiency and allows millions of DNA fragments to be sequenced simultaneously per run. NGS has much higher sensitivity to detect low-frequency variants, faster turnaround time for high sample volumes, comprehensive genome coverage, lower limit of detections, higher capacity with sample multiplexing, and the ability to sequence hundreds to thousands of genes simultaneously. The primary advantage of Sanger sequencing is that it is cost-effective for sequencing low numbers of targets, below 20.
Paraphrased from NGS vs. Sanger Sequencing from Illumina.
How does NGS work for DNA Identification?
Next-generation sequencing platforms sequence million of small fragments of DNA in parallel. Bioinformatics analyses help organize the sequencing data by comparing it to the reference human genome. Next-generation sequencing provides robust genome coverage, sequencing each base in the human genome multiple times. Additionally, NGS can be adapted to sequence entire genomes or specific regions, including all 22,000 coding genes in the exome or a subset of individual genes. Next generation sequencing has the capability to improve patient care in capturing a greater number of mutations compared to Sanger sequencing, defining genomic characteristics of pathogens, and identifying cancer causing mutations in the genome. Next-generation sequencing drastically improves on Sanger sequencings ability to identify large genomic deletions, translocations, or rearrangements. Sanger sequencing is only capable of identifying small insertions and deletions, thus requiring additional assays to detect any chromosomal changes. Next-generation sequencing also does not require prior knowledge of a gene or locus under investigation, eliminating any bias in the identification of novel genes presented in clinic. In oncology, NGS allows for cancer genomes to be sequenced for a more precise diagnosis and classification of the disease. Ultimately, NGS could provide patients with individualized treatment based on the consensus sequencing libraries. The biggest drawback is the required infrastructure, including computer capacity and personnel needed to analyze and interpret the data.
Paraphrased from Arch Dis Child
Educ Pract Ed. 2013 Dec; 98(6): 236–238.
Enter response here.
Enter response here.
Enter response here.
Enter response here.
NextGen Sequencing Check for Understanding Capture Sheet
Directions
Each numbered step below explains a part of the NextGen sequencing DNA identification technology. This case study modeled many of the steps scientists would have done when using NextGen Sequencing to identify the source of a foodborne illness.
To show your understanding, explain the part of the case study that was comparable to NextGen sequencing.
1. The DNA is collected or sampled from the area of interest. What in the case study is similar to this step?
2. The DNA is isolated and sequenced quickly in short segments. What in the case study is similar to this step?
3. The sequences are compared to a known DNA library. What in the case study is similar to this step?
Note: A DNA library is a collection of known DNA fragments that can be used for research. The sequence order and species are already identified. It acts like a reference section in a real library but for DNA.
4. The species are identified (even if there are mutations). What in the case study is similar to this step?
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Tech Lesson 2 | Sanger Sequencing | |
Describe | Summarize how this technique works | |
Discuss | List the pros and cons you identify for the technique. | Pros Cons |
Support | Provide examples. | |
Enter response here.
Enter response here.
Enter response here.
Enter response here.
Technology Overview Capture Sheet
Part 1: DNA Identification
Directions
After each technology lesson, use the corresponding table to summarize what you learned about that DNA identification technique. Save this page for comparison in Lesson 9.