Summer of Nanopore Sequencing Workshop

Cold Spring Harbor Laboratory

CSHL DNA Learning Center

​

Hands on education in molecular biology/bioinformatics for secondary students (Grade 6-12); secondary and undergraduate faculty training; websites/multimedia

Middle school programs

High school programs

High school programs

High school programs

Project-based and mentoring

Summer camps

Summer camps

High school programs

Faculty training

High school programs

Online education

DNALC NYC

DOLAN DNALC

HARLEM DNA LAB

DNALC REGENERON

Safety and Code of Conduct

​

• Review of code of conduct and reporting options
• No food or drink in laboratory spaces (take breaks outside)
• Location of PPE and first aid

Introductions

Please tell us

​

1. Name and institution
2. Courses/subjects you teach
3. What experience, if any do you have with Nanopore sequencing
4. The most important thing for you to leave this workshop with

​

Learning Outcomes

Technical

​

• Understand the basics of how Nanopore sequencing works
• Know how to prepare a sample for Nanopore sequencing
• Understand how to load, run, and monitor the progress of sequencing experiment
• Recognize the outputs of a sequencing experiment
• Select and configure the computing hardware and software needed to run experiments

Learning Outcomes

Pedagogical

​

• Explain Nanopore sequencing in the context of other methods
• Identify potential applications of Nanopore sequencing for student projects
• Connect with other educators and get support as you develop curricula

Learning Outcomes

Practical

​

• Know how and when to use Nanopore sequencing
• Know how to navigate the Nanopore website to find protocols, place, and manage orders
• Estimate the ease or difficulty of sequencing experiments
• Estimate the ease or difficulty of analysis options

Constraints and limitations

​

• Temporary lab space
• Choice of laboratories – focuses on an introductory teaching experience (simpler, quicker, lower-in-cost)
• Covers the two major formats for Nanopore sequencing
• Eliminates or reduces some QC steps
• Does not focus on DNA extraction quality
• Does not explore advanced bioinformatics options
• Does not explore other applications (RNA, methylation)

​

What you will need to learn after the workshop

​

• More time and practice on flow cell loading
• How to organize a lab experience in your own setting
• What experiments meet your needs
• What budget is needed (time and money)
• What concepts your teaching will emphasize
• Technical: How Nanopore works
• Biological: Questions sequence data can answer
• Application: How does this solve problems I care about

​

A quick history of DNA sequencing

https://www.timetoast.com/timelines/telescope-7f500ed9-828b-4dff-9ec6-53322e051786

First telescope 1608

(Lippershey)

Kepler telescope 2009

~400 Years

First RNA Holly sequence, 1965

Sanger Sequence 1977

Solexa Genome Analyzer 2006

~40 Years

https://www.nature.com/articles/237082a0.pdf

http://dnaftb.org/23/animation.html

Credit: Adam Nieman

1989

https://www.chron.com/local/history/medical-science/article/Mapping-life-took-a-turn-through-Houston-9558477.php

Major sequencing platforms today

Sanger

​

• 100-1000 bp
• Low-throughput
• Low error
• Declining footprint

​

illumina

​

• 100-300 bp
• High-throughput
• Low error
• Substantial startup ($10K+)

​

PacBio

​

• 1-50 kbp
• High-throughput
• Low error
• Substantial startup ($10K+)

​

Nanopore

​

• 0.5 kbp - millions
• High-throughput
• Moderate error
• Low startup ($2K+)

​

Short-read

Long-read

How does Nanopore sequencing work?

Nanopore Network

Developing Foundations for Nanopore DNA Sequencing Course-based Undergraduate Research Experiences at Minority-Serving Institutions

​

​

• Pilot (2-years)
• Simplify lab and bioinformatics protocols
• Support faculty needs and understand barriers to use

DUE# 2216349

QUBES Faculty Mentoring Network 2022 - 2024

What is Nanopore sequencing?

Nanopore sequencing is a technology that enables direct, real-time analysis of any length of DNA or RNA fragments. It works by monitoring changes to an electric current as nucleic acids are passed through a protein nanopore.

https://www.genome.gov/genetics-glossary/Nanopore-DNA-Sequencing

How Nanopore Sequencing Works

Biorender.com

How Nanopore Sequencing Works

A DNA/RNA strand is passed through a nanopore

An electrical signal is interpreted into sequence data

The advantages of nanopore sequencing

How Nanopore Sequencing Works

Where do nanopores come from?

Preparing DNA for nanopore sequencing

Example Workflow: RNA-Seq with Nanopore

Biorender.com, Massaiu et al., 2021.

An Additional Wrinkle: Duplex Sequencing

Sequence data and bioinformatics: How to get from electrical signal to ACTGs?

Further reading: https://nanoporetech.com/how-it-works/basecalling

​

Raw data from the nanopore: The shadow puppet analogy

Slide credit: Jonathan Pugh, Oxford Nanopore

The hands block the light

�Because the hands are a certain shape, �it creates a shadow we recognize

​

Each base of DNA blocks the current

�Because the bases are a certain shape and size, it creates a signal we recognize

​

How do we recognize the signal? By training (learning patterns) from known sequence data

Sequence lots of DNA with known sequence…

TACTTACTCAACAATGCGTTAAATTTCGACTGTTTA

Use patterns to interpret new signal

This is a goose

This is a cow

Current basecaller software: Dorado

We can also train the algorithm to recognize features beyond As, Cs, Ts, and Gs: Modified basecalling

Modified from Xu and Seki Journal of Human Genetics 2019

What is DNA Barcoding ?

Low in cost : $3 DNA sequencing <$2 other reagents

Barcoding – the “Do everything” lab

Ginkgo Product Fraud (2012)

Mary Acheampong, Bobby Glover, and Marisa VanBrakle

Hostos-Lincoln Academy of Science

2012 UBP Grand Prize Winners

Barcoding – the “Do everything” lab

Barcoding – the “Do everything” lab

​

2021

• Species: Duckweed (S. polyrhiza ~150 mb)
• Relevance: Biofuels and climate change
• Partners: CSHL/HudsonAlpha
• Results: ~7Gb DNA sequence and partial assembly

Sequence-a-genome camp

Two species of duckweeds (Wolffia globosa and Spirodela polyrhiza)

taken in Waimanalo, Hawai‘i by Eric Guinther

​

2022

• Species: Jamaican Broom (C. glandulosa v. mirabilis ~unknown mb)
• Relevance: Endemic/endangered
• Partners: U. Puerto Rico
• Results: +145GB and counting; in-progress

​

2023

• Species: Assorted plant chloroplasts
• Relevance: Backyard species
• Partners: Internal
• Results: 13 Genomes

​

2024

• Species: Soil bacterial isolate
• Relevance: Antibiotic resistance
• Partners: Internal
• Results: 7 microbial genomes in 6 days (sample-to-assembly)

Supported by grants from the National Science Foundation: Improving Undergraduate STEM Education (#1821657, #2216349), Advanced Technological Education (#1901984), and Arecibo Center for STEM Education and Research (#2321729); and the National Institutes of Health Science Education Partnership Award (#5R25GM137355). Equipment and supplies provided by Oxford Nanopore.

Nationwide training

• 100+ faculty from 70+ institutions in the Faculty mentoring network
• Summer training for 100+ faculty from 100+ institutions

Reach of pilot activities

This material is based upon work supported by the National Science Foundation under RCN:UBE 1827130

bit.ly/genomics-learning-framework

Understanding DNA is critical to solving

every problem of biology

Thanks!

“The illiterate of the 21^st century will not be those who cannot read and write, but those who cannot

learn, unlearn, and relearn”

– A. Toffler