Effects of FEN1 knockout on BRCA1/2 deficient cancer cell survival and chemotherapeutic drug resistance

By Jorden Lewis, Jennifer Bass and Tanya Todd

Section 2

Public Views on Breast Cancer (90 Participants)

​

​

Cancer Research

• What is Cancer?
• The result of abnormal proliferation of any of the different cells in the body, meaning there are over a hundred distinct types of cancer, which can vary in behavior and response to treatment.
• Tumors:
• In tumor initiation a genetic alteration leads to abnormal proliferation of a single cell. This leads to the outgrowth of a population of clones of that cell: “clonally derived tumor cells.”
• In tumor progression additional mutations occur.
• Mutations vary...if it’s rapid growth, clones becomes dominant with that mutation
• Clonal selection. That keeps going in tumor development. Tumors continuously become more rapid-growing and increasingly malignant. Malignant tumors invade surrounding tissue and spread throughout the body to distant body sites, frequently. This makes them resistant to localized treatment.

​

Cancer Research Continued...

• In the United States, over 1 million people are diagnosed per year... and 500,000 Americans die of cancer each year.
• Four most common cancers, accounting for more than half of all cancer cases, are those of the breast, prostate, lung, and colon/rectum (Cooper, 2000).
• In 2016, nearly 246,660 new cases of invasive breast cancer and 61,000 cases of noninvasive (in situ) breast cancer were diagnosed in the US (Haque, 2018)
• Roughly 3% to 6% of these invasive breast cancer cases occurred in women who had a germline BRCA1 or BRCA2 gene mutation (Haque, 2018).
• That’s 7,399-14.799 people with invasive Breast cancer and 1,830-3,660 people with noninvasive Breast cancer with mutations in those genes.

Previous Studies: Why the FEN1 Gene Matters

• A previous study conducted at the University of Oslo, Norway, analyzed the FEN1 gene
• FEN1: “DNA flap endonuclease 1”
• Based on its function
• Researchers analyzed the its role in DNA repair and replication
• They first generated mice lacking a functional Fen1 gene into two groups: Heterozygous (FEN1 +/− ) and homozygous FEN1 (− /− )
• Results: Heterozygous mice appeared normal. Homozygous mice, completely negative for FEN1 (Fen1−/−), underwent early embryonic lethality. The Fen1−/− blastocysts failed “to form inner cell mass during cellular outgrowth,” and a “complete inactivation of DNA synthesis” was observed. In addition, exposure of the homozygous (Fen1−/−) blastocysts to gamma radiation caused extensive cell death (apoptosis) (compared to cells with the active FEN1 gene) (Larson, 2003).

Functions of FEN1

How FEN1 operates in the body:

• FEN1 plays a major role in maintaining genome stability by participating in both DNA replication and repair (He, 2016).
• The FEN1 gene’s 5′ flap endonuclease (FEN) activity (most dominant function) helps to remove both RNA primers from Okazaki fragments in the maturing lagging strands (DNA replication) and 5’ flap structures formed during long-patch (LP) base excision repair (BER) (He, 2016).
• FEN1 is normally expressed at minimal levels, but recent studies have discovered correlations between FEN1 overexpression and the onset/progression of certain types of cancers (ex: breast, gastric, lung, pancreatic, prostate) (He, 2016).
• Due to the high efficiency of DNA repair brought on by FEN1 overexpression, DNA damage (cell apoptosis) evoked from most chemotherapeutic drugs are rendered largely ineffective against cancer cells (He, 2016).
• However, it has been observed that cancer patients with DNA repair efficiency defects have had increased sensitivity to chemotherapeutic drugs (He, 2016).

Function of BRCA1 & BRCA2

• BRCA1 and BRCA2 (BReast Cancer Genes 1&2 ) help to repair DNA damages (homologous recombination) and create tumor suppressor proteins (Dhillon, 2011).
• Despite only 5-10% of breast cancer cases being inherited (rare), heterozygous germline mutations of BRCA1 and/or BRCA2 genes can result in DNA repair deficiencies, chromosomal instability and eventual tumorigenesis (Dhillon, 2011) (Godet and Gilkes, 2017).
• These familial mutations (inherited from either parent) dramatically increases the risk of developing various cancers (especially breast or ovarian cancer) (Dhillon, 2011).
• By age 70, the risk BRCA1/2 mutation carriers have of developing breast cancer is: (Godet and Gilkes, 2017)
• 55-65% for BRCA1 carriers
• 45-55% for BRCA2 carriers

​

How are FEN1 and BRCA1/BRCA2 Related?

• Recent studies have shown that BRCA2 deficient cells may be selectively dependent on the FEN1 gene’s 5’ flap endonuclease activity in order to properly process the flaps generated during Microhomology-mediated end joining (MMEJ) (Mengwasser, 2019).
• As a result of its importance to the DNA repair process, existing inhibitors to FEN1 have been proven to be lethal for BRCA2 deficient cancer cells and tumors (Mengwasser, 2019) .

​

Significance of CRISPR/Cas9

• CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) is a mechanism used to edit genes by removing or replacing
• Target: Single guide RNA (sgRNA) finds target DNA
• Cleave: Cas9 cuts an area next to target DNA
• Repair: Repair template is a designed DNA sequence incorporated into DNA via homologous recombination DNA repair pathway
• CRISPR technology approved for FDA trials
• 9 trials currently active around the world
• BRCA1/2 mutated cells more dependent on several pathways to include FEN1 than BRCA1/2 wild type
• Proven using Avana CRISPR-Cas9 genome dataset to knockout FEN1

​

​

​

Research Question...

• Could using CRISPR/Cas9 to knockout the FEN1 gene suppress the proliferation of BRCA1/2 deficient breast cancer cells and increase their sensitivity to chemotherapeutic drugs?

​

Hypothesis…..

• FEN1 knockdown will significantly decrease the proliferation of BRCA1/2 decificent breast cancer cells and improve efficacy of chemotherapeutic drugs

Aims and Rationale of Research

1. Evaluate the effects FEN1 knockdown has on the viability of BRCA1/2 deficient breast cancer cell lines.
1. Determine if FEN1 inhibition selectively targets BRCA1 or BRCA2 deficient cells.
2. Confirm that BRCA1/2 deficient cancer cells dependent on one or more of the FEN1 gene’s repair pathways for continued growth and future tumorigenesis
2. Test the efficacy of chemotherapeutic drugs against BRCA1/2 deficient cancer cell lines (after FEN1 knockout/inhibition).
1. Determine if FEN1 inhibition augments the cytotoxicity of DNA-damaging agents and drugs.
2. Examine which chemotherapeutic drug(s) successfully decreased the concencentration of knockout cancer cells and how this protocol could be implemented in future breast cancer treatments.

​

​

Aim 1: Methods and Materials Used

• Control Group:
• BRCA1/2 Wild-type Breast Cancer Cell Lines (Obtained from the American Type Tissue Collection and cultured under conditions as directed by the product instructions) (He, 2016)
• Experimental Group:
• BRCA1/2 Deficient Breast Cancer Cell Lines (Obtained from the American Type Tissue Collection and cultured under conditions as directed by the product instructions) (He, 2016)

​

​

​

​

Aim 1: Methods and Materials Used Continued….

• CRISPR/Cas 9 FEN1 Knockout: Santa Cruz Biotechnology FEN1 CRISPR Plasmids (Human) with gRNA
• Price: $357.00
• Unit Size: 20 µg
• Catalog Number: SC-403168
• Product Description
• Protocol
• DNA Extraction Kit: PureLink™ Genomic DNA Mini Kit
• Price: $702.00
• Unit Size: 250 Preps
• Catalog Number: K182002
• Product Description
• Protocol

Aim 1: Methods and Materials Used Continued….

• Thermo Scientific NanoDrop™ 2000 Spectrophotometer
• Polymerase Chain Reaction (PCR) Kit: Qiagen Taq PCR Master Mix Kit
• Price: $99.70
• Unit Size: 250 Preps
• Catalog Number/ID: 201443
• Product Description
• Primers Used: Created on NCBI BLAST
• Forward Primer FEN1: 5’ TCCCAAAGGCCAGGTGAGA 3’
• Reverse Primer FEN1: 5’ GGACCTCTTGACTGCGAATC 3’
• Product Length: 119 bp
• Positive Control: Human Lymph Node Cell Line (Obtained from the American Type Tissue Collection and cultured under conditions as directed by the product instructions)
• Technical Negative Control: Qiagen Taq PCR Master Mix

​

Aim 1: Materials & Methods Used Continued….

• Gel Electrophoresis: E-Gel™ EX 2% Agarose Gel
• ELISA (Enzyme-Linked Immunosorbent Assay): LSBio Human FEN1 ELISA Kit (Sandwich ELISA)
• Price: $790.00
• Catalog Number: LS-F55000-1
• Product Description
• Protocol Instructions (pg 6-20)
• BioTek 800™ TS Absorbance Reader
• Cell Counting Kit-8 Assay (GLPBio Technology)
• Price: $50.00
• Size: 2x5mL (1000 tests)
• Catalog Number: GK10001
• Product Description and Instructions

​

​

Aim 1: Experimental Protocol Timeline

1.CRISPR/Cas Knockout

3. NanoDrop

2000

4. PCR

5. Gel Electrophoresis

6. Cell Counting Assay

2. DNA Extraction

Sandwich ELISA Protocol

1. Extract Samples (Supernatant)

3. ELISA (TMB Substrate)

2. Prepare Dilutions of Samples, Reagents and Standards

4. Determine Optical Density (450 nm)

5. Qualitative Analysis of Data

Aim 1: Experimental Protocol Summary

1. Use CRISPR/Cas9 and guide-RNA to knockout FEN1 gene in BRCA1/2 deficient breast cancer cells lines.
2. Extract and measure DNA with Nanodrop 2000 spectrophotometer to determine purity (Ratio of 1.6-2.1 at 260/280 nm)
3. Create primers and amplify FEN1 locus with PCR.
4. Perform Gel Electrophoresis on PCR products to determine if the FEN1 knockout was successful.
5. Further confirm FEN1 knockout with ELISA (determine if FEN1 proteins are still being produced).
6. Use Cell Counting Kit-8 Assay to measure and compare cell concentrations of experimental and control groups to determine a viability ratio

​

Aim 2: Methods & Materials Used

• Control Group:
• BRCA1/2 Deficient Breast Cancer Cell Lines (No FEN1 Knockout)
• BRCA1/2 Wild-type Breast Cancer Cell Lines
• Both cell lines were obtained from the American Type Tissue Collection and cultured under conditions directed by the product instructions) (He, 2016)
• Experimental Group:
• BRCA1/2 Deficient Breast Cancer Cell Lines (With FEN1 Knockout)

​

​

Aim 2: Methods & Materials Used

• Anti-Cancer (Cytotoxic) Chemotherapy Drugs:
• Doxorubicin (Adriamycin)-Anthracycline Antitumor Antibiotic (Cell Cycle Specific, S-phase)
• Vinorelbine (Navelbine)-Plant Alkaloid (Vinca Alkaloid) and Microtubule Agent (Cell Cycle Specific, M-phase)
• Methotrexate-Antimetabolite (Cell Cycle Specific, S phase)
• Cisplatin-Alkylating Agent (Metal Salt) (Cell-Cycle Non-Specific, resting phases)
• Teniposide-Plant Alkaloid (Podophyllotoxin) and Topoisomerase II inhibitor (Cell Cycle Specific, late S or early G2 phase)
• Olaparib (dissolved in DMSO)-(ADP-ribose) polymerase (PARP) inhibitor (Caulfield, 2019), (modeled after Norris, 2014), Cell Cycle Specific, G2 phase)

Aim 2: Methods & Materials Used Continued….

• BioVision Incorporated MTT Cell Proliferation Assay Kit (Colorimetric)
• Price: $245.00
• Size: 1000 Assays
• Catalog Number: K299
• Product Description
• Protocol

​

Aim 2: Experimental Protocol Timeline

• Note: Cytotoxicity assay procedure largely modeled after similar one conducted in Sangchul Lee’s Analysis of resistance-associated gene expression in docetaxel-resistant prostate cancer cells (Lee, 2017)

​

​

1. Experimental and Control cells seeded into 96-well plate and dissolved in solvent

2. Cells are treated with increasing doses of each chemotherapeutic drug over a 72 hour period

(0.0, 0.5, 1.0, 2.5, 5.0, 10.0, 20.0 μM)

3. Serum-free media

and MTT Reagent added to wells. (Background Control: MTT Reagent is added to a well containing media only (no cells))

4. Plate incubated at 37°C for 3 hours

5. MTT Solvent is added to each well and incubated for additional 3 hours at the same conditions

6. Absorbances measured (590 nm) and cell viability (%) determined

Aim 2: Experimental Protocol Summary

1. Add increasing doses of common chemotherapeutic drugs to experimental and control cell lines over a 72 hour period.
2. Measure the absorbance in the experimental and control groups after drug treatment with MTT Cell Proliferation Assay Kit.
3. Determine which chemotherapeutic drug enacted greatest cytotoxic effects against the experimental group and compare the concentrations of viable cells to their control group counterpart.

​

Aim 1: Expected Results (CRISPR, PCR, Electrophoresis, ELISA, CCK-8)

• Analysis of the CRISPR/Cas9 knockout of FEN1 gene
• PCR, Gel Electrophoresis ELISA tests confirm FEN1 knockout in experimental groups
• Significantly decreased FEN1 gene expression in BRCA1/2 deficient experimental groups
• BRCA1/2 cells have significantly decreased cell viability in the experimental group (after FEN1 knockout) compared to the control group
• Decreased cell viability after FEN1 knockout would demonstrate its role in BRCA1/2 cancer cell proliferation

Aim 2 Expected Results (Cytotoxicity Assay)

• FEN1 knockout results in G1/S, G2/M arrest (Zhang et al, 2017)
• FEN1 knockout dramatically increases efficacy of chemotherapeutic drugs
• Less proliferation from FEN1 to combat anticancer treatments
• Lower absorbance values measured in experimental BRCA1/2 deficient cell lines confirms significantly lower cell viability
• Control group cells demonstrated a much higher resistance to dose-dependent drug treatments at 72 hours (higher cell viability%)

​

​

Aim 2: Expected Results (Cytotoxicity Assay) Continued….

​

• We expect chemotherapeutic drugs to be more effective when acting before or during the G1/S, G2/M arrest induced by FEN1 knockout (KO)
• Less effective against the cell-cycle specific chemotherapeutic drugs active after the G2/M checkpoint (Vinorelbine)
• Experimental cell lines are expected to be the most sensitive to Cisplatin due to being active throughout any and/or all phases of the cell cycle (including resting phase) (Zhang et al, 2017).

​

Conclusion and Future Plans

• FEN1 knockout reducing proliferation and chemotherapeutic drug resistance of BRCA1/2 deficient breast cancer cells
• Increase in Chemotherapeutic drugs cytotoxicity towards BRCA1/2 experimental cells
• Cisplatin considered the most effective after FEN1 knockout
• As an alkylating agent, Cisplatin was already exceptional against slow-growing cancers and is currently part of clinical trials treating triple negative breast cancer (result of altered BRCA gene) (Godet and Gilkes, 2017)

Research Implications

• Contributing to breast cancer treatment design
• Coupled design: FEN1 knockout by gene editing (CRISPR/Cas) coupled with routine dose-dependent Cisplatin treatment
• Further research on Cisplatin treatment efficacy

References

1. Cooper GM. The Cell: A Molecular Approach. 2nd edition. Sunderland (MA): Sinauer Associates; 2000. The Development and Causes of Cancer. Available from: https://www.ncbi.nlm.nih.gov/books/NBK9963/
2. Haque, Reina et al. “Survival Outcomes in BRCA1 or BRCA2 Mutation Carriers and the Influence of Triple-Negative Breast Cancer Subtype.” The Permanente Journal vol. 22 17-197. 11 Oct. 2018, doi:10.7812/TPP/17-197
3. Larsen, Elisabeth et al. “Proliferation failure and gamma radiation sensitivity of Fen1 null mutant mice at the blastocyst stage.” Molecular and cellular biology, vol. 23, no. 15, 2003, pp. 5346-5353. doi:10.1128/mcb.23.15.5346-5353.2003
4. He, Lingfeng, et al. “Targeting DNA Flap Endonuclease 1 to Impede Breast Cancer Progression.” EBioMedicine, vol. 14, 10 Nov. 2016, pp. 32–43., doi:10.1016/j.ebiom.2016.11.012.
5. Dhillon, Kiranjit K., et al. “Secondary Mutations of BRCA1/2 and Drug Resistance.” Cancer Science, vol. 102, no. 4, 30 Jan. 2011, pp. 663–669., doi:10.1111/j.1349-7006.2010.01840.x.
6. Godet, Inês, and Daniele M Gilkes. “BRCA1 And BRCA2 Mutations and Treatment Strategies for Breast Cancer.” Integrative Cancer Science and Therapeutics, U.S. National Library of Medicine, 27 Feb. 2017, www.ncbi.nlm.nih.gov/pmc/articles/PMC5505673/.
7. “CRISPR Clinical Trials.” U.S. National Library of Medicine, clinicaltrials.gov/ct2/results?term=CRISPR.
8. Mengwasser, Kristen E., et al. “Genetic Screens Reveal FEN1 and APEX2 as BRCA2 Synthetic Lethal Targets.” Molecular Cell, vol. 73, no. 5, 24 Jan. 2019, pp. 885–899., doi:10.1016/j.molcel.2018.12.008.
9. Lee, Sangchul, et al. “Analysis of Resistance-Associated Gene Expression in Docetaxel-Resistant Prostate Cancer Cells.” National Center for Biotechnology Information, vol. 14, no. 3, Sept. 2017, pp. 3011–3018., doi:10.3892/ol.2017.6541.

​

​

References Continued….

10. https://mct.aacrjournals.org/content/molcanther/13/6/1645.full.pdf
11. Caulfield, Sarah E et al. “Olaparib: A Novel Therapy for Metastatic Breast Cancer in Patients With a BRCA1/2 Mutation.” Journal of the advanced practitioner in oncology vol. 10,2 (2019): 167-174.
12. “FEN1 Flap Structure-Specific Endonuclease 1 [Homo Sapiens (Human)] - Gene - NCBI.” National Center for Biotechnology Information, U.S. National Library of Medicine, www.ncbi.nlm.nih.gov/gene?Db=gene&Cmd=DetailsSearch&Term=2237#gene-expression.
13. Norris, Robin E et al. “Preclinical evaluation of the PARP inhibitor, olaparib, in combination with cytotoxic chemotherapy in pediatric solid tumors.” Pediatric blood & cancer vol. 61,1 (2014): 145-50. doi:10.1002/pbc.24697
14. Zhang, Keqiang, et al. “Overexpression of Flap Endonuclease 1 Correlates with Enhanced Proliferation and Poor Prognosis of Non–Small-Cell Lung Cancer.” The American Journal of Pathology, Elsevier, 14 Oct. 2017, www.sciencedirect.com/science/article/pii/S0002944017307022.
15. “Types of Chemotherapy Drugs.” Types of Chemotherapy Drugs | SEER Training, SEER, training.seer.cancer.gov/treatment/chemotherapy/types.html.

​

​