GENOMICS-ENABLED PRECISION MEDICINE FOR CANCER AND DISEASE

Why precision medicine is precise

• Have more studies?
• Hypothesis is better?
• Technology is more up-to-dated?
• Experiment is more precise?
• Data is larger?
• Analysis is more mature?

Hypothesis driven V.S Data driven

Hypothesis driven

Data driven

(Deductive reasoning)

(Inductive reasoning)

General theory

Testable hypothesis

Empirical test

Confirmation/rejection

Empirical observation

Detectable pattern

Tentative hypothesis

General theory

Hypothesis driven V.S Data driven

Example for hypothesis driven study

Lung cancer

Obtain sample

Hypothesis

Experiment

Discovery

Publication

Numerous times

Example for data driven study

Lung cancer

Obtain sample

Experiment

Confirmation

Publication

Data mining

Experiment based on data

Down syndrome

How can we detect the disorder from gene level?

Omics

• Omics aims at the collective characterization and quantification of pools of biological molecules that translate into the structure, function, and dynamics of an organism or organisms.

DNA to proteins

Basic procedures of omics study

Genomics

• Genomics – DNA-Seq
• Mutation (SNP)
• Protein-DNA interactions
• Transcriptomics – RNA-Seq
• Differential expression
• Non-coding RNA
• Splice variants
• Protein-RNA interactions

Replicates

• Avoid bias
• Produce reliable results
• Make statistics reasonable

Biological Replicates VS technical replicates

• Biological replicates
• Experiments from different samples but same conditions
• Avoid the special or individual cases
• Technical replicates
• Doing multiple times of experiments from the identical samples
• Avoid the technical influences.

Instrument

Alzheimer’s disease

• Risk gene – APOE-e4
• APOE-e4 can be inherited from the parents
• These genes, which are estimated to account for 1% or less of Alzheimer's cases

Do we have an efficient way to detect more novel mutations of Alzheimer’s disease?

DNA-Seq

• DNA sequencing is the process of determining the nucleic acid sequence – the order of nucleotides in DNA.

​

https://youtu.be/fCd6B5HRaZ8

Read depth and length

• Read depth
• The amount of DNA/RNA reads produced from sequencers
• Read length
• How many nucleotides are included in a read

Example

GeneA

GeneA

ATACGTCATCCGCGCTATCGAATATTTTACGACCGCGATGAGGA

Reference Sequence

GTCATCCACGCTATCGAATATTTTACGACC

GTCATCCGCGCTATCGAATATTTTACGACC

Lung cancer

Normal

The way to detect mutation

The way to detect mutation

Mutations of Cancer

• Tumor-suppressor genes BRCA1 and BRCA2
• HER2-positive breast cancer

Mechanism of BRCA2 and BRCA1

HER2 mutations

Normal cell V.S HER2+ cell

Genome-wide association study (GWAS)

• GWA studies typically focus on associations between single-nucleotide polymorphisms (SNPs) and traits like major human diseases

Genome-wide association study (GWAS)

Shortages of DNA-Seq

• The related genes of the mutations are still unclear
• The influenced functions or pathways of the mutated genes are unknown
• Silent mutations - Change a codon into a mutant codon that specifies exactly the same amino acid.
• Gene expression cannot be measured

RNA-seq

• RNA-Seq can reveal the quantity of RNAs in biological sample at a given moment and condition

​

Applications of Rna-Seq

• Alternative gene spliced transcripts
• Gene fusion
• Non-coding RNA
• Quantification comparison

​

Splice event

Gene fusion

Philadelphia chromosome – CML and BCR-ABL

Quantification comparison

Differential expression analysis

Clustering heatmap

Non-coding RNA

• RNA molecule that is not translated into a protein
• tRNA, rRNA

RNA-Seq is the efficient approach

Bacteria – small RNA (sRNA)

• Length = 50-500 nts
• Highly structured and containing several stem-loops.
• Mechanism
• Bind to protein targets and modify the function of the bound protein.
• Interact with mRNA targets and regulate gene expression by binding to complementary mRNA and blocking translation.
• Unmask or block the ribosome-binding site

Functions of sRNA

• Stress response
• Regulation of outer membrane proteins
• Virulence
• Biofilm formation
• Antibiotic resistance

Example of sRNAs in Bordetella pertussis

• MgSO₄ is known to repress the expression of the virulence factors of B. pertussis that are coordinately regulated by the bvg locus
• BvgAS is a two-component system, when BvgS is active, BvgA is phosphorylated (BvgA~P), and virulence-activated genes are expressed

​

Micro RNA (miRNA)

• Length: ~22 nts
• miRNA forms base-pairing with complementary mRNA to achieve RNA silencing
• Cleavage of the mRNA
• Destabilization of the mRNA through shortening of its poly(A) tail
• Less efficient translation of the mRNA
• Related diseases
• Chronic lymphocytic leukemia
• Heart disease
• DNA repair
• Kidney disease
• Nervous – Stroke, Alzheimer’s disease
• Obesity
• Hemostatsis

​

​

Circular RNA (circRNA)

Small interfering RNA (siRNA)

Main differences

• miRNA
• Internal
• Can interact with not 100% complementary sequences
• siRNA
• External
• Only can interact with 100% complementary sequences

​

First siRNA treatment for amyloidosis

Long non-coding RNA (lncRNA)

• Length is ~200 nts
• Currently, only small proportion of lncRNAs are proved having biological functions.

​

DNA-Seq

DNA

RNA

RNA-Seq

Why we need single cell

• A typical human cell consists
• ~2 x 3.3 billion base pairs of DNA
• ~600 million bases of mRNA
• Every cell is different, the differences are lost in bulk cells.
• Studying heterogenicity of the samples from diseases, tissues or organisms.
• Understanding the potential risk of specific diseases deeply.

Personalized medicine

• One of the most important goal for personalized medicine is to understand the risk of getting diseases.
• Only using single cell can really reflect the risk of a person for getting a specific disease.

Bulk cells V.S Single cell

The issue of bulk cells

• Bulk cells can reflect the most representative situation but will ignore the samples which may be few but important.

Ignore

Cell differentiation

Acute Myeloid Leukemia (AML)

• AML contains many subtypes. The commonly found types are at least 8 types.

Progress

Academic research

RNA-Seq

DNA-Seq

Academic research

Genomics

Transcriptomics