Session 1 (February 9, 2026)

Introduction to Recombinant DNA Technology:� Restriction Enzymes, PCR, Plasmids, Transformation

Lecturer: Michael Jeltsch, Faculty of Pharmacy, University of Helsinki

Course: FARM-409, Recombinant DNA technology in therapeutic protein engineering - lecture course

Spring semester 2026

Most recent version of this presentation: mjlab.fi/PROV-409-1

Slide 1 of 35

All material in this presentation is�licensed under the CC BY-NC-SA 4.0 by�the creator except if differently indicated.

Faculty of Pharmacy

Schedule

Slide 2 of 38

03/02/2023

Jeltsch Lab

Faculty of Pharmacy

Course prerequisites & completion requirements

Slide 3 of 38

Prerequisites

• Elemental knowledge of DNA, RNA, Proteins and basics of molecular biology
• Textbook: Openstax Concepts of Biology, chapter: Molecular Biology and Biotechnology
• Course pages on Moodle

PROV-409: Lectures

• 5 lectures: 80% participation, completion of the pre- and post-lecture assignments

PROV-410: Plan your own DNA construct and assemble it in the lab

• Max. 8 students (in 2 or 3 groups)
• Development of a cloning project and in-silico simulation of the cloning (SnapGene)
• Depending on complexity, partial or full realization of the cloning simulation (contact me asap!)
• Realization of an alternative cloning plan (for projects that are not feasible in the context of a course such as proteins toxic to humans, etc.)
• No own project or no idea? No problem, this course will stimulate your creativity!

Jeltsch Lab

Faculty of Pharmacy

Who?

Slide 4 of 38

• Michael Jeltsch
• Moved from Germany to Finland in 1995
• PhD in 2003 with Kari Alitalo (discovery of the first growth factors for lymphatic vessels: VEGF-C and VEGF-D; Jeltsch et al. 1997, Science; Achen et al. 1998, PNAS)
• Since 2013 group leader at the Faculty of Medicine (UH) & since 2020 assoc. professor at the Faculty of Pharmacy (UH)
• - Best Basic Science Paper award by the American Heart Association (Jeltsch 2014, Circulation)�- Three Medix-Prizes (Tvorogov 2011, Cancer Cell; Kärkkäinen 2004, Nat Im­munol; Jeltsch 1998, Science)
• Experience in three biotech startups with 3 drugs in clinical trials: sozinibercept/OPT-302 (developer, phase 3), VGX-100 (co-developer, halted after phase 1) and Lymfactin (co-developer, halted after phase 2)
• More at jeltsch.org(/science) or mjlab.fi

Jeltsch Lab

Faculty of Pharmacy

Cloning, aka Recombinant DNA Technology (RDT)

Slide 5 of 38

Jeltsch Lab

Faculty of Pharmacy

Different types of cloning

Slide 6 of 38

Organism cloning

Sheep, bovine, cats, dogs…

Cell cloning

Bacterial and other cells…

DNA/molecular cloning

DNA sequences (genes), …

Jeltsch Lab

Faculty of Pharmacy

Therapeutic protein engineering

Slide 7 of 38

Why is RDT essential for today’s pharmaceutical industry?

• Almost all life science research (including pharmacology research) involves RDT: e.g. creating an animal disease model for preclinical drug trials
• Protein drugs are the fastest growing drug class
• Replacement drugs (insulin and other protein hormones)
• Antibody drugs (cancer, diseases of the immune system, migraine, Alzheimer’s disease, …)
• What the the third big subclass among protein drugs?
• Protein toxins: Botox, Tirzepatide (semaglutin homolog, weight loss/diabetes), Ziconotide (pain killer)

Jeltsch Lab

Faculty of Pharmacy

Why manual cloning?

Slide 8 of 38

Why do need to know how to clone myself?

I can order all the constructs I need from companies!

1. Somebody in the company does the cloning. Even if a machine is doing the cloning, somebody needs to know the underlying technology.
2. “DNA printers” are still too expensive, rare and limited.
3. It happens quite frequently that companies fail to deliver!
4. In a post-apocalyptic world, you would like to continue cloning, wouldn’t you? (Thomas Landrain example)
5. If you do larger projects (e.g.many different versions of the same proteins, that differ only a bit from each other), it is much more cost-effective.
6. Any other reasons?

Jeltsch Lab

Faculty of Pharmacy

Central dogma of molecular biology

Slide 9 of 38

Why is recombinant DNA technology the starting point of nearly all biological research?

1. DNA replication
2. Transcription
3. Translation
4. Reverse transcription�(retroviruses, e.g. HIV)
5. RNA replication (RNA viruses, e.g. SARS-CoV-2)
6. Direct DNA-to-protein translation (forced in cell-free extracts)

Jeltsch Lab

Faculty of Pharmacy

There are not enough cows & pigs on this planet!

Slide 10 of 38

By 2021,

we would have

needed to kill 11

billion cows/year to

isolate enough insulin for

the worldwide 400 Mio. diabetics.

Jeltsch Lab

Faculty of Pharmacy

Antibodies are the drugs that you own body produces on demand

Slide 11 of 38

Adaptive immune system

• Antibody / B-cell* response
• Cellular / T-cell* response

B-cell response

• Antibodies = Specific protein drugs generated�on demand to fight everything non-self (antigens)
• Each antibody binds specifically to a particular�part of the antigen (epitope)
• Antibodies can be made (almost) against any chemical�structure that is large and complex (not against small molecules, but possible from somewhere around 300 Da)
• Human antibodies are human proteins, therefore they are typically very well tolerated.

Jeltsch Lab

Faculty of Pharmacy

Big business

Slide 12 of 39

https://doi.org/10.1186/s12929-019-0592-z

https://doi.org/10.1007/s42977-021-00072-6

Number of approved antibody drugs

Jeltsch Lab & University of Helsinki

The big picture: moving DNA pieces around

Slide 13 of 38

• Multi-step clonings
• Multi-fragment clonings
• Different methods beyond restriction enzymes cloning (but the purpose is the same: to assemble DNA pieces from differ- ent origins into a functional plasmid that is DOING something once inserted into a cell)

Jeltsch Lab

Faculty of Pharmacy

Topics for today

Slide 14 of 38

1. Recombinant DNA technology
2. Restriction enzyme cloning
3. Most important enzymes
4. Plasmids
5. Cells (E. coli)
6. Transformation & Transfection

Jeltsch Lab

Faculty of Pharmacy

RDT: Basic cut- and paste operation

Slide 15 of 38

Jeltsch Lab

Faculty of Pharmacy

Every step needs normally at least one enzyme (= protein catalyst)

Slide 16 of 38

restriction

enzyme(s) (+ BEs)

ligase

polymerase

reverse

transcriptase

phosphatase

restriction

enzyme(s)

(+BEs)

polynucleotide

kinase

BEs (blunting enzymes)

• DNA Polymerase I, Large (Klenow) Fragment
• T4 polymerase
• Mung bean nuclease

Jeltsch Lab

Faculty of Pharmacy

Phosphatases: preventing ligation without insert (“backligation”)

Slide 17 of 38

5'-AGCTGG-3' 5'-pAATTCAGGAT-3'

3'-TCGACCTTAAp-5' 3'-GTCCTA-5'

• Restriction enzymes leave the phosphate at the 5’-end
• Phosphatases remove the phosphate group from the DNA 5’-end
• DNA cannot circularize without an insert (which needs to carry a phosphate group at its 5’-ends!)

Phosphorylated

parental vector

Dephosphorylated

parental vector

Jeltsch Lab

Faculty of Pharmacy

Blunting: DNA Polymerase I Large (Klenow) Fragment („Klenow“) and T4 DNA Polymerase

Slide 18 of 38

5'-AGTTGGAATTCAGGAT-3'

3'-TCAACCTTAAGTCCTA-5'

5'-AGCTGAAGCTTTGGATACGGATGCGGGTACCGCTC-3'

3'-TCGACTTCGAAACCTATGCCTACGCCCATGGCGAG-5'

EcoRI

KpnI

HindIII

Parent plasmid

Insert

5'-AGTTGG AATTCAGGAT-3'

3'-TCAACCTTAA GTCCTA-5'

5'-AGCTGA AGCTTTGGATACGGATGCGGGTAC CGCTC-3'

3'-TCGACTTCGA AACCTATGCCTACGCC CATGGCGAG-5'

Klenow

T4 polymerase

Klenow

5'-AGTTGGAATT AATTCAGGAT-3'

3'-TCAACCTTAA TTAAGTCCTA-5'

5'-AGCTGAAGCT AGCTTTGGATACGGATGCGG CGCTC-3'

3'-TCGACTTCGA TCGAAACCTATGCCTACGCC GCGAG-5'

Jeltsch Lab

Faculty of Pharmacy

Common mistake: Cleavage close to the end of DNA fragments

Slide 19 of 38

https://www.neb.com/en/tools-and-resources/usage-guidelines/cleavage-close-to-the-end-of-dna-fragments

Jeltsch Lab

Faculty of Pharmacy

Ligase

Slide 20 of 38

TTAATGAGGATACGGAGATACGGATGCGGGTAC

AATTACTCCTATGCCTCTATGCCTACGCC

GGTTAGTTGGAATT

GGTTTCAACCTTAA

GCGATGCGGGTTAGTTGGAATTTTAATGAGGATACGGAGATACGGATGCGGGTACCAGGATGTCGGGAGATACG

CGCTACGCGGTTTCAACCTTAAAATTACTCCTATGCCTCTATGCCTACGCCCATGGTCCTACAGCCCTCTATGC

CAGGATGTCG

CATGGTCCTACAGC

Ligase (ATP needed)

“Overhang” cloning is easier due to complementary bases!

Blunt-end cloning is more difficult since ends have no affinity for each other

Jeltsch Lab

Faculty of Pharmacy

Ligation-independent cloning (LIC)

Slide 21 of 38

Free DNA ends are unstable inside the E. coli cell → Degradation by DNases.

Jeltsch Lab

Faculty of Pharmacy

PCR

Slide 22 of 38

• PCR conditions are rarely optimal
• PCR goals are different in analytical PCR versus preparative PCR: cycle number should be as low as possible (14-25), relatively large amount of template (1ng - 0.5µg)
• All PCR-derived sequences should be checked by sequencing
• Primer quality issues (DNA synthesis error rate: 1 in ~160)
• T/A overhangs or not? Non-proofreading enzymes attach a single A-overhang to the 3'-end of the PCR product (exploited by T/A cloning)!

Jeltsch Lab

Faculty of Pharmacy

Cloning vectors

Slide 23 of 38

• Multiple cloning site
• Insert size
• Copy number
• Ori incompatibilities
• Selectable marker
• Cloning sites
• Specialized vector�functions

Vector map of the pUC19 plasmid

(SnapGene)

Multiple Cloning Site (MCS)

Jeltsch Lab

Faculty of Pharmacy

SnapGene

Slide 24 of 38

• Commercial cloning software: SnapGene, Benchling, Clone Manager
• Free cloning software: SnapGene Viewer, SerialCloner
• The course assignments are most easily done with SnapGene → install it on your computer if you have not done it yet!
• Fully functional 1-month demo, longer with the license for this course

Jeltsch Lab

Faculty of Pharmacy

The origin of replication (ori) determines the copy number of plasmids

Slide 25 of 38

• The origin of replication (“ori”) makes�the E. coli cells replicating the plasmid.
• ColE1 ori: 15-20 copies/cell (e.g.�pBR322, “low copy plasmid”)
• pUC ori (= mutated ColE1):�500-700 copies/cell
• f ori (BACs): 1 copy/cell (“single�copy plasmid”)
• Some oris are temperature sensitive!
• Amplification of low-copy plasmids is�possible with chloramphenicol
• 2 plasmids in the same host cell require�different, but compatible oris.

Jeltsch Lab

Faculty of Pharmacy

Insert size

Slide 26 of 38

• Plasmids have practical limitations to their insert size at ~15-20 kb
• Larger inserts require special vectors:
• Cosmid (28-45 kb, hybrid plasmid that can become a ʎ phage)
• ʎ (Lambda) vectors (8-24 kb)
• Bacterial Artificial Chromosomes (up to 350 kb, large plasmid similar to the bacterial genome)
• Yeast Artificial Chromosomes (up to 1 Mb, linear, stability issues)

Jeltsch Lab

Faculty of Pharmacy

How to get DNA into cells: 1. Electroporation

Slide 27 of 38

Electroporation

Jeltsch Lab

Faculty of Pharmacy

How to get DNA into bacteria? 2. Chemical transformation

Slide 28 of 38

Chemical transformation

Jeltsch Lab

Faculty of Pharmacy

Plating and colony formation

Slide 29 of 38

Incubation

at 37°C for

~16h

Jeltsch Lab

Faculty of Pharmacy

Which of these colonies contain plasmid with an insert?

Slide 30 of 38

How to confirm that the cloning succeeded?

1. Growing a culture, isolating the plasmid DNA and performing
1. restriction analysis with the enzymes that were used for the cloning
2. DNA sequencing

Jeltsch Lab

Faculty of Pharmacy

Which of these colonies contain plasmid with an insert?

Slide 31 of 38

• Blue-White/LacZ screening: The LacZ⍺ peptide complements a partial β-galactosidase enzyme, which metabolizes X-Gal into a blue product

• Instead of LacZ⍺, you can have a “kill gene” (ccdB = DNA gyrase toxin). You never ever see the “blue” cells, since they all die…

Jeltsch Lab

Faculty of Pharmacy

Selection markers

Slide 32 of 38

• Mostly antibiotics: Ampicillin, Kanamycin, Chloramphenicol, Tetracyclin, Zeocin, Streptomycin, etc.
• Metabolic selection markers: The plasmid carries a gene that enables the cells to use an otherwise indigestible nutrient.
• Selection markers do not have to be identical (different genes can confer resistance to the same antibiotic, e.g. for kanamycin)
• Mechanisms of antibiotic action and resistance are different (with consequences: amp inhibits cell wall synthesis, but not protein synthesi; amp is inactivated by enzymatic cleavage)
• Some E. coli strains are antibiotic resistant to specific antibiotics (e.g. XL1blue is tetracyclin-resistant)

Jeltsch Lab

Faculty of Pharmacy

Specialized vector functions

Slide 33 of 38

Specialized functions depend on downstream applications

• Bacteriophage ori (f1, M13)
• Production of single stranded�DNA (mutagenesis)
• Converting the plasmid into�a virus (such plasmid are�called phagemids)
• f1 ori = packaging signal�to put the plasmid into�the viral capsid

Jeltsch Lab

Faculty of Pharmacy

Specialized vector functions

Slide 34 of 38

• Sp6/T7/M13 promoters
• Making RNA, in-vitro transcription by RNA polymerase (RNA vaccines)
• Universal primer annealing sites for Sanger sequencing
• Promoters & other regulatory sequences
• Important for protein expression. These elements are often species- and cell-specific! Bacterial expression requires a bacterial promoter, mammalian expression requires a mammalian promoter, etc.

Jeltsch Lab

Faculty of Pharmacy

Most cloning is done in E. coli (and a bit in yeast)

Slide 35 of 38

CH₃

Different E. coli strains (specialized for certain tasks)

• Dam-negative/dcm-negative (restriction enzymes are methylation sensitive)

GATC

dam methylase

GATC

BclI TGATCA

XbaI TCTAGATC

cannot be cleaved by

Jeltsch Lab

Faculty of Pharmacy

Most cloning is done in E. coli (and a bit in yeast)

Slide 36 of 38

Different E. coli strains (specialized for certain tasks)

• Dam-negative/dcm-negative (restriction enzymes are methylation sensitive)
• Restriction-modification (RM) systems defend bacteria against bacteriophages

Jeltsch Lab

Faculty of Pharmacy

Most cloning is done in E. coli (and a bit in yeast)

Slide 37 of 38

Different E. coli strains (specialized for certain tasks)

• Dam-negative/dcm-negative (restriction enzymes are methylation sensitive)
• Restriction-modification (RM) systems defend bacteria against bacteriophages
• Protein expression: BL21(DE3)
• These strains are e.g. deficient is some protein-degrading enzymes
• Virus production: Adenovirus (AdEasy), Baculovirus (DH10BAC)
• These strains contain a complete (circular double-stranded) viral DNA, which can be manipulated by transposition (→ lecture 5)

Jeltsch Lab

Faculty of Pharmacy

Assignment for lecture #1

Slide 38 of 38

Simulating the subcloning of a cDNA from a pREP7�plasmid into a pCDNA3.1(+) plasmid using SnapGene

You received from a collaborator the pREP7-hVEGF-C-FLwt plasmid, which is suitable for protein expression in 293EBNA cells. You also received its plasmid map (see below). However, since you do not have 293EBNA cells, but only 293T cells, you need to subclone the VEGF-C cDNA from the pREP7 plasmid into the pCDNA3.1(+) plasmid! Return the SnapGene file with the cloning history to Moodle! Bonus question: Can you explain why you need to subclone the cDNA from the pREP7 into the pCDNA3.1(+) plasmid?

Jeltsch Lab

Faculty of Pharmacy

Questions, contact

Slide 39 of 38

• My laboratory: mjlab.fi (https://www.helsinki.fi/en/researchgroups/lymphangiogenesis-research-and-antibody-development)
• jeltsch.org (private rumblings)
• Questions to: michael@jeltsch.org or via Whatsapp: 050-3200235
• Consultation hours every Friday 9-12
• This presentation: https://mjlab.fi/PROV-409-1
• A fairly good recap is Khan Academy’s Applied Biology Unit 2, Biotechnology: principles and processes

Jeltsch Lab

Faculty of Pharmacy