Assessment for Genomics & Data Science Aspirant
This assessment form is to understand the minimal understanding of biology, math, world science and motivation for pursuing career in Genomics and Data Science at Theomics International Pvt Ltd.

PLEASE NOTE :

READ EACH QUESTION WITH GRAMMER EMPHASIS FOR BETTER UNDERSTANDING AND ANSWERING.  

NOTE :  THIS ASSESSMENT IS FOR 100 POINTS WHERE EACH POINT IS A CORRECT ANSWER / ANSWER

20 QUESTIONS FOR SCORING 100 POINTS  AND 7 QUESTIONS FOR CAPTURING BASIC INFORMATION

HENCE, PLEASE MAKE A COUNT OF ANSWERS YOU HAVE GIVEN. EACH QUESTION CAN HAVE MORE THAN ONE ANSWER

ALERT ! YOU CAN SUBMIT THIS FORM "ONLY ONCE FROM ONE GMAIL LOGIN" AND MAX TIME CONSIDERED TO SUBMIT IS 60 MINUTES ONLY.
Email *
Log formulas with with 2,4,6,8 that results in 2704 *
Required
Who are the women leaders in science and healthcare *
Required
Count of A, T, G and C in the following sequence :  >random sequence 1 consisting of 274 bases. atgacgtcgtgcgtagtgcccaggtaatctaaagacggttcccgtgcctagaaagggcaa gcaattcctgcacgcactggaggtcaggctgcaccgagttacggggaccggcttgatcac tgattatgcgacgctgatcgcatccgtacgcgaccttatttaagttcggtattgggccga attggattccttgtgtacgtgcagttacatacataaatgctcaaccgttttgtacgacgc ttatagctgacaaatgtgagcatcgtttatcacc *
Required
What is the time now ? *
Time
:
RNA Modifications ? *
Required
Mobile Phone Number (with Whatsapp) *
Essential Steps in Denovo Sequencing *
Required
Date of Birth *
MM
/
DD
/
YYYY
Order the organism by genome size (small to big) *
Carsonella ruddii (Bacterium):
Escherichia coli (Bacterium):
Drosophila melanogaster (Fruit fly):
Humans (Homo sapiens):
Pinus taeda (Loblolly Pine):
Cephaloscyllium ventriosum (Swell Shark):
Axolotyl (Ambystoma mexicanum):
Protopterus aethiopicus (Marbled lungfish):
Paris japonica (Canopy plant):
Amoeba proteus:
5
4
3
1
10
7
6
2
8
9
Best models to study Cancer *
Required
DNA Modifications ? *
Required
Which the following are inherited disease *
Required
Email *
Epigenetic Modifications ? *
Required
DNA Binding Enzymes *
Required
Which Code Belongs to Which Programming Language *
Total Platform Independence
TPH (Text Processing Powerhouse)
Interpreted
Package Ecosystem
Simple Syntax
Shell Script
R
Python
Java
Perl
Protein Modifications ? *
Required
Which of the following have extremely high or full regenerative abilities *
Required
Which of the following have extremely limited or no regenerative abilities *
Required
Name *
Essential Steps in Re-Sequencing *
Required
Protein Binding Enzymes *
Required
Diseases for which there is NO DEFINITIVE cure / treatment *
Required
Write 5 sentences on why a career in Genomics and Data Science and why join the Genomics Journey with Theomics International Pvt Ltd. *
Which of the following is true *
Required
If you have to Expand T H E O M I C S, what word would you assign for each letter ? *
Which formula using the numbers 2, 4, 6, 8, 18, and 27 will result in 1977
*
Required
About Theomics International Pvt Ltd
Theomics is an independent initiative as a genomics and data science company aiming to take up niche and challenging projects related to genomics and data analytics services that might lead to high impact publications / patents / actionable findings.

Founded by Madavan Vasudevan, With a solid foundation in biology and a career spanning over two decades, He has actively pioneered advancements in Bio-Information Technology since 1999. His professional journey has been dynamic, encompassing pivotal roles in project management, business development, marketing and sales, as well as groundbreaking contributions to biomedical informatics research and solution modeling. He has authored 75+ publications with 2000+ Citations and a H-index of 22 and i10 Index of 35.

We warmly welcome you onboard Theomics and looking forward for a journey together.
A copy of your responses will be emailed to .
Submit
Clear form
Never submit passwords through Google Forms.
This form was created inside of Theomics International Pvt Ltd. Report Abuse